Host-parasite interactions: Evolutionary genetics of the House Finch- Mycoplasma epizootic

Size: px
Start display at page:

Download "Host-parasite interactions: Evolutionary genetics of the House Finch- Mycoplasma epizootic"

Transcription

1 Host-parasite interactions: Evolutionary genetics of the House Finch- Mycoplasma epizootic Scott V. Edwards Department of Organismic and Evolutionary Biology Harvard University Cambridge, MA USA

2 House Finches and Mycoplasma: a strong host-parasite interaction Mycoplasma gallisepticum escaped chickens and invaded House Finches in the eastern U. S., ~ years later, finches are more resistant and recent bacterial strains are attenuated Natural selection (?) on House Finches by disease Higher survival rates found in: Females versus males Smaller versus larger males Bright males versus dull males Can we identify the genes contributing to survival or susceptibility?

3 Multi-pronged approach to a recently established host-parasite interaction 1. Genetic structure of pre-epizootic house finch populations (AFLPs) 2. Large-scale screen for parasite-induced gene expression in house finches 3. Shifts in allele frequency between pre- and post-epizootic house finches 4. Molecular evolution and host range expansion of the Mycoplasma parasite

4 Recent history of House Finch populations historic range ~1870 bottleneck? 1940 ~200 birds

5 Mycoplasma are obligate parasites and have some of the smallest genomes of any non-virus sequenced

6 Mycoplasma-House Finch History -Mycoplasma gallisepticum escaped chickens and invaded House Finches in the eastern U. S., ~ years later, finches are more resistant to the bacterium and recent strains are attenuated -Have finches evolved resistance? Courtesy Cornell Lab of Ornithology

7 Population and phenotypic consequences of 1994 epidemic Males decline after epidemic Increased redness in males and decreased size after epidemic Sex ratio (M/F) Percent change Pre post epidemic July 1995 August 1996 October Redness Wing chord (mm) Bill (mm) Tarsus (mm) Males Tail Lengt h(mm) Weight (g) Wing chord (mm) Bill (mm) Tarsus (mm) Females Weigh t (g) From Nolan, P. M., G.E. Hill and A. M. Stoehr Proc. R. Soc. Lond. B.265:

8 AFLPs: House Finch are moderately structured with little evidence for genetic bottlenecks 163 individuals, 16 populations, 3 primer combinations, 166 polymorphic bands, 61% polymorphic bands Distribution of variation (AMOVA) Among individuals w/in pops. 70.7% 8.1% 21.2% Nucleotide diversity (estimated number of substitutions per 1000 sites) Nucleotide diversity original range introduced range CA CA TX AR CO WAMex. HI MI ME NY OH MD PA AL Can. Among pops. w/in subspecies (native range) Among subspecies (native range) Wang, Z., Hill, G. E., Baker, A. J. & Edwards, S. V. (2003) Evolution 57,

9 Tripartite structure of House Finch populations suggested by assignment test of AFLP data (program STRUCTURE: J. Pritchard et al Genetics 155: ) Western U.S. Hawaii Eastern U. S. Wang, Z., Hill, G. E., Baker, A. J. & Edwards, S. V. (2003) Evolution 57,

10 Suppression subtractive hybridization Experimental cdna, split into two pools A PCR method for differentially amplifying transcripts that differ in expression in two cell populations Often used in plant studies; a useful alternative to microarrays cdnas differentially expressed cdnas cdnas shared between control and tester normalization driver tester 1 tester 2 (control) ligate primers ( ) to two cdna pools hybridization 1 hybridization 2 fill in ends selectively amplify

11 Example macroarray results Probe identical filters with RNA from infected and uninfected birds Distinct hybridizations - differentially expressed genes Common hybridizations -- noise C A identical filters (A + B, C + D) B Reciprocally subtracted probes (A vs. B, C vs. D) D

12 Sequencing suggests change in expression for heat shock and immune system genes Additional upregulated genes Number of sequenced clones Granzyme A Additional downregulated genes Mhc class II Wang et al. (2006) Mol. Ecol. 15,

13 Preliminary network of genes induced by infection infection Mycoplasma Healthy Finch infected finch HSP90 TIM1 Granzyme A Mhc class II, invariant chain chaperone with diverse substrates apoptosis elongation factor 1α mitochondrial degredation COI, COIII, NADH4 Host modulation or parasite subversion of immune response? Wang et al. (2006) Mol. Ecol. 15,

14 Museum specimens permit temporal comparison of genetic diversity pre- and post-epidemic House Finch populations Recently exposed California? Michigan Exposed 1990s present control comparison Unexposed Alabama diachronic comparison late 1980s Royal Ontario Museum (A. J. Baker) Unexposed

15 Mhc class I crystal structure α1 domain [ peptide binding region (PBR) peptide α2 domain β2 microglobulin

16 Both increases and decreases in diversity are predicted by evolution of resistance in house finches Finch with conjunctivitis Mhc class II molecules Healthy Finch homozygote heterozygote Foreign pathogen

17 Little evidence for change in heterozygosity (θ) at an Mhc class II locus between pre- and post-epidemic samples θ Michigan late 1980s Michigan 2000 Alabama 1994 Alabama 2000 California late 1980s California 1999 Hess, C. M., Wang, Z. & Edwards, S. V. (2007) Genetica 129,

18 However, rapid shifts in frequency observed at some peptide-binding codons * MHC class II peptide binding codon Hess, C. M., Wang, Z. & Edwards, S. V. (2007) Genetica 129,

19 The Mycoplasma gallisepticum genome: ~0.99 Mb Papazisi, L., et al. (2003) Microbiology 149,

20 Variation in genome size among House Finch (HF) and Turkey (TK) isolates of Mycoplasma SmaI EagI HF GA 1995 TK GA 1973 HF GA 1995 TK GA kb kb kb kb * 48.5 kb 23.1 kb Courtesy Wendy Smith, unpubl. data

21 Recent host shift of Mycoplasma gallisepticum to house finches (HF) - but how recent? 99% 100% 89% 95% 100% HF-TK clade 64% 0.05 substitutions/site TK GA 1973 CK SC 2000 CK GA 1974 CK GA 1964 CK Vaccine TK NC 1995 HF GA 1995 HF GA 1995 HF AL 2001 TK IN 2000 HF VA 1994 TK IN 2000 TK VA 1996 M. penetrans M. genitalium M. synoviae M. hypopneumoniae Bacillus subtilis TK = turkey CK = chicken HF = House Finch Mycoplasma gallisepticum Maximum likelihood tree, ~5200 bp RpoB and fusa genes Courtesy Wendy Smith, unpubl. data

22 Empirical conclusions Pre-epizootic House Finch structure AFLPs suggest significant but mild population differentiation Parasite - induced gene expression House Finches show up- and down-regulation of key immune system genes upon experimental infection Diachronic allele frequency shifts in house finch populations Little evidence for reductions in diversity but some evidence for allele frequency shifts at key immune system genes Parasite evolution DNA sequence information provides a detailed view of Mycoplasma history

23 Conservation implications A double invasion Range expansions in both hosts and parasites results in novel evolutionary pressures Microbial host range expansion Adaptation of Mycoplasma gallisepticum to a novel host could result in yet further increases in host range in wild birds Implications for infectious disease biology Pathogens can spread across the country in a matter of years A number of unresolved issues in the role of genetic diversity in regulating parasite expansion

24 Acknowledgments MHC evolution Christopher Hess, U. Washington AFLPs, macroarray analysis Zhenshan Wang, U. Washington Kristy Farmer, Geoff Hill, Auburn U. Funding NSF Mycoplasma evolution Wendy Smith & Colin Dale, U. Utah and Auburn U.

Investigation of the genetic differences between bovine herpesvirus type 1 variants and vaccine strains

Investigation of the genetic differences between bovine herpesvirus type 1 variants and vaccine strains Investigation of the genetic differences between bovine herpesvirus type 1 variants and vaccine strains Name: Claire Ostertag-Hill Mentor: Dr. Ling Jin Bovine herpesvirus Bovine herpesvirus-1 (BHV-1) Pathogen

More information

Prevention of infection 2 : immunisation. How infection influences the host : viruses. Peter

Prevention of infection 2 : immunisation. How infection influences the host : viruses. Peter Prevention of infection 2 : immunisation How infection influences the host : viruses Peter Balfe, p.balfe@bham.ac.uk @pbalfeuk Let s have some LO s just for fun 1. Define the Immune response to viruses,

More information

Evolution of influenza

Evolution of influenza Evolution of influenza Today: 1. Global health impact of flu - why should we care? 2. - what are the components of the virus and how do they change? 3. Where does influenza come from? - are there animal

More information

Viral Genetics. BIT 220 Chapter 16

Viral Genetics. BIT 220 Chapter 16 Viral Genetics BIT 220 Chapter 16 Details of the Virus Classified According to a. DNA or RNA b. Enveloped or Non-Enveloped c. Single-stranded or double-stranded Viruses contain only a few genes Reverse

More information

Culex pipiens complex (Diptera:Culicidae) host feeding patterns in Sacramento and Yolo Counties. Matthew Montgomery LTJG MSC USN 2010

Culex pipiens complex (Diptera:Culicidae) host feeding patterns in Sacramento and Yolo Counties. Matthew Montgomery LTJG MSC USN 2010 Culex pipiens complex (Diptera:Culicidae) host feeding patterns in Sacramento and Yolo Counties Matthew Montgomery LTJG MSC USN 2010 Introduction Significance Background West Nile Virus Cx. pipiens complex

More information

EVOLUTION. Reading. Research in my Lab. Who am I? The Unifying Concept in Biology. Professor Carol Lee. On your Notecards please write the following:

EVOLUTION. Reading. Research in my Lab. Who am I? The Unifying Concept in Biology. Professor Carol Lee. On your Notecards please write the following: Evolution 410 9/5/18 On your Notecards please write the following: EVOLUTION (1) Name (2) Year (3) Major (4) Courses taken in Biology (4) Career goals (5) Email address (6) Why am I taking this class?

More information

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared

More information

Overview: Chapter 19 Viruses: A Borrowed Life

Overview: Chapter 19 Viruses: A Borrowed Life Overview: Chapter 19 Viruses: A Borrowed Life Viruses called bacteriophages can infect and set in motion a genetic takeover of bacteria, such as Escherichia coli Viruses lead a kind of borrowed life between

More information

Basic Immunology. Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction

Basic Immunology. Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction Basic Immunology Lecture 5 th and 6 th Recognition by MHC. Antigen presentation and MHC restriction Molecular structure of MHC, subclasses, genetics, functions. Antigen presentation and MHC restriction.

More information

Ultrastructural Studies on Plasmodium vivax

Ultrastructural Studies on Plasmodium vivax Characterization of Human Malaria Parasites Ultrastructural Studies on Plasmodium vivax For the first time a detailed ultrastructural study was carried out on P. vivax. Fine structural analysis of growth

More information

the HLA complex Hanna Mustaniemi,

the HLA complex Hanna Mustaniemi, the HLA complex Hanna Mustaniemi, 28.11.2007 The Major Histocompatibility Complex Major histocompatibility complex (MHC) is a gene region found in nearly all vertebrates encodes proteins with important

More information

Isolation and identification of Mycoplasma gallisepticum in chickensbn from industrial farms in Kerman province

Isolation and identification of Mycoplasma gallisepticum in chickensbn from industrial farms in Kerman province Available online at http://www.ijabbr.com International journal of Advanced Biological and Biomedical Research Volume 2, Issue 1, 2014: 100-104 Isolation and identification of Mycoplasma gallisepticum

More information

Major Histocompatibility Complex (MHC) and T Cell Receptors

Major Histocompatibility Complex (MHC) and T Cell Receptors Major Histocompatibility Complex (MHC) and T Cell Receptors Historical Background Genes in the MHC were first identified as being important genes in rejection of transplanted tissues Genes within the MHC

More information

Chapter 19: The Genetics of Viruses and Bacteria

Chapter 19: The Genetics of Viruses and Bacteria Chapter 19: The Genetics of Viruses and Bacteria What is Microbiology? Microbiology is the science that studies microorganisms = living things that are too small to be seen with the naked eye Microorganisms

More information

Molecular typing insight on diversity and antimicrobial resistance of Campylobacter jejuni from Belgian chicken meat

Molecular typing insight on diversity and antimicrobial resistance of Campylobacter jejuni from Belgian chicken meat Molecular typing insight on diversity and antimicrobial resistance of Campylobacter jejuni from Belgian chicken meat Ihab Habib Ghent University Department of Public Health and Food Safety. Contents: Molecular

More information

New genomic typing method MLST

New genomic typing method MLST New genomic typing method MLST Bon KIMURA fingerprinting PFGE DNA multilocus sequence typingmlst alleles PFGE MLST 1990 PCR 1 PCR DNA PFGE 1 PFGE RAPDrandomly amplified polymorphic DNA 3 AFLPAmplified

More information

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared

More information

Lecture 11. Immunology and disease: parasite antigenic diversity

Lecture 11. Immunology and disease: parasite antigenic diversity Lecture 11 Immunology and disease: parasite antigenic diversity RNAi interference video and tutorial (you are responsible for this material, so check it out.) http://www.pbs.org/wgbh/nova/sciencenow/3210/02.html

More information

Avian Influenza Virus H7N9. Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences

Avian Influenza Virus H7N9. Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences Avian Influenza Virus H7N9 Dr. Di Liu Network Information Center Institute of Microbiology Chinese Academy of Sciences Avian Influenza Virus RNA virus, Orthomyxoviruses Influenza A virus Eight Gene segments

More information

An Evolutionary Story about HIV

An Evolutionary Story about HIV An Evolutionary Story about HIV Charles Goodnight University of Vermont Based on Freeman and Herron Evolutionary Analysis The Aids Epidemic HIV has infected 60 million people. 1/3 have died so far Worst

More information

Bio 1M: Evolutionary processes

Bio 1M: Evolutionary processes Bio 1M: Evolutionary processes Evolution by natural selection Is something missing from the story I told last chapter? Heritable variation in traits Selection (i.e., differential reproductive success)

More information

Name: Due on Wensday, December 7th Bioinformatics Take Home Exam #9 Pick one most correct answer, unless stated otherwise!

Name: Due on Wensday, December 7th Bioinformatics Take Home Exam #9 Pick one most correct answer, unless stated otherwise! Name: Due on Wensday, December 7th Bioinformatics Take Home Exam #9 Pick one most correct answer, unless stated otherwise! 1. What process brought 2 divergent chlorophylls into the ancestor of the cyanobacteria,

More information

7.012 Quiz 3 Answers

7.012 Quiz 3 Answers MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84

More information

Mutants and HBV vaccination. Dr. Ulus Salih Akarca Ege University, Izmir, Turkey

Mutants and HBV vaccination. Dr. Ulus Salih Akarca Ege University, Izmir, Turkey Mutants and HBV vaccination Dr. Ulus Salih Akarca Ege University, Izmir, Turkey Geographic Distribution of Chronic HBV Infection 400 million people are carrier of HBV Leading cause of cirrhosis and HCC

More information

Topic 7 - Commonality

Topic 7 - Commonality II. Organism Topic 7 - Commonality From Viruses to Bacteria to Genetic Engineering Prebiotic Period Refers to before life Early Earth contained little O 2 O 2 prevents complex molecules Complex organic

More information

2000 and Beyond: Confronting the Microbe Menace 1999 Holiday Lectures on Science Chapter List

2000 and Beyond: Confronting the Microbe Menace 1999 Holiday Lectures on Science Chapter List 2000 and Beyond: Confronting the Microbe Menace 1999 Holiday Lectures on Science Chapter List Lecture One Microbe Hunters: Tracking Infectious Agents Donald E. Ganem, M.D. 1. Start of Lecture One 2. Introduction

More information

Acute respiratory illness This is a disease that typically affects the airways in the nose and throat (the upper respiratory tract).

Acute respiratory illness This is a disease that typically affects the airways in the nose and throat (the upper respiratory tract). Influenza glossary Adapted from the Centers for Disease Control and Prevention, US https://www.cdc.gov/flu/glossary/index.htm and the World Health Organization http://www.wpro.who.int/emerging_diseases/glossary_rev_sept28.pdf?ua=1

More information

Coevolution. Coevolution

Coevolution. Coevolution Coevolution Fitness is a genotype-by-environment interaction. The environment for one species includes other species For species that interact, they form part of each other s environment As one species

More information

HOST-PARASITE INTERPLAY

HOST-PARASITE INTERPLAY HOST-PARASITE INTERPLAY Adriano Casulli EURLP, ISS (Rome, Italy) HOST-PARASITE INTERPLAY WP3 (parasite virulence vs human immunity) (Parasite) Task 3.1: Genotypic characterization Task 3.6: Transcriptome

More information

AP Biology. Viral diseases Polio. Chapter 18. Smallpox. Influenza: 1918 epidemic. Emerging viruses. A sense of size

AP Biology. Viral diseases Polio. Chapter 18. Smallpox. Influenza: 1918 epidemic. Emerging viruses. A sense of size Hepatitis Viral diseases Polio Chapter 18. Measles Viral Genetics Influenza: 1918 epidemic 30-40 million deaths world-wide Chicken pox Smallpox Eradicated in 1976 vaccinations ceased in 1980 at risk population?

More information

Significance of the MHC

Significance of the MHC CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

More information

Antigen Presentation to T lymphocytes

Antigen Presentation to T lymphocytes Antigen Presentation to T lymphocytes Immunology 441 Lectures 6 & 7 Chapter 6 October 10 & 12, 2016 Jessica Hamerman jhamerman@benaroyaresearch.org Office hours by arrangement Antigen processing: How are

More information

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic

More information

Sex is determined by genes on sex chromosomes

Sex is determined by genes on sex chromosomes BREVIA Temperature Sex Reversal Implies Sex Gene Dosage in a Reptile Alexander E. Quinn, 1 * Arthur Georges, 1 Stephen D. Sarre, 1 Fiorenzo Guarino, 1 Tariq Ezaz, 2 Jennifer A. Marshall Graves 2 Sex is

More information

Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection

Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Melissa Mihelidakis May 6, 2004 7.340 Research Proposal Introduction Apoptosis, or programmed cell

More information

Phase of immune response

Phase of immune response Antigen and antigen recognition by lymphocytes Antigen presentation to T lymphocytes Sanipa Suradhat Department of Veterinary Microbiology Faculty of Veterinary Science Phase of immune response 1 Phase

More information

Antigen Recognition by T cells

Antigen Recognition by T cells Antigen Recognition by T cells TCR only recognize foreign Ags displayed on cell surface These Ags can derive from pathogens, which replicate within cells or from pathogens or their products that cells

More information

What is influenza virus? 13,000 base RNA genome: 1/ the size of the human genome

What is influenza virus? 13,000 base RNA genome: 1/ the size of the human genome What is influenza virus? 13,000 base RNA genome: 1/246153 the size of the human genome CDC Principles of Virology, 4e Neumann et al. Nature. 2009. Influenza virus is one of the most deadly viral pathogens

More information

Analyzing Evolvability To Anticipate New Pathogens

Analyzing Evolvability To Anticipate New Pathogens Analyzing Evolvability To Anticipate New Pathogens Fusing the study of microbial pathogens with evolutionary biology potentially provides a means for predicting emergent pathogens Meghan A. May Scientists

More information

Supplementary Material

Supplementary Material Supplementary Material 2 4 6 Single-locus gene screening methods We screened for single nucleotide polymorphisms (SNPs) at 16 candidate immune genes (Table S1) by initially sequencing three captive-bred

More information

NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY. 16th International WAVLD symposium, 10th OIE Seminar

NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY. 16th International WAVLD symposium, 10th OIE Seminar NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY S. Van Borm, I. Monne, D. King and T. Rosseel 16th International WAVLD symposium, 10th OIE Seminar 07.06.2013 Viral livestock

More information

Two hierarchies. Genes Chromosomes Organisms Demes Populations Species Clades

Two hierarchies. Genes Chromosomes Organisms Demes Populations Species Clades Evolution cont d Two hierarchies Genes Chromosomes Organisms Demes Populations Species Clades Molecules Cells Organisms Populations Communities Ecosystems Regional Biotas At its simplest level Evolution

More information

Agricultural Outlook Forum Presented: February 16, 2006 THE CURRENT STATE OF SCIENCE ON AVIAN INFLUENZA

Agricultural Outlook Forum Presented: February 16, 2006 THE CURRENT STATE OF SCIENCE ON AVIAN INFLUENZA Agricultural Outlook Forum Presented: February 16, 2006 THE CURRENT STATE OF SCIENCE ON AVIAN INFLUENZA David L. Suarez Southeast Poultry Research Laboratory, Exotic and Emerging Avian Viral Diseases Research

More information

Chapter 6- An Introduction to Viruses*

Chapter 6- An Introduction to Viruses* Chapter 6- An Introduction to Viruses* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. 6.1 Overview of Viruses

More information

7.014 Problem Set 7 Solutions

7.014 Problem Set 7 Solutions MIT Department of Biology 7.014 Introductory Biology, Spring 2005 7.014 Problem Set 7 Solutions Question 1 Part A Antigen binding site Antigen binding site Variable region Light chain Light chain Variable

More information

Mina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia

Mina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia Mina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia AIDSvaccine conference, 14 th September 2011 IMGT HLA database July 2011 >5000 class

More information

Hybridization and Genetic Extinction. Can and do we preserve the genetic integrity of species, and if so, how?

Hybridization and Genetic Extinction. Can and do we preserve the genetic integrity of species, and if so, how? Hybridization and Genetic Extinction Can and do we preserve the genetic integrity of species, and if so, how? Hybridization Hybridization: mating between different species or two genetically distinct populations

More information

Rapid and Accuracy Diagnosis of Highly Pathogenic Avian Influenza (H5N8) Virus used for the Control of the Outbreak in the Republic of Korea

Rapid and Accuracy Diagnosis of Highly Pathogenic Avian Influenza (H5N8) Virus used for the Control of the Outbreak in the Republic of Korea Rapid and Accuracy Diagnosis of Highly Pathogenic Avian Influenza (H5N8) Virus used for the Control of the Outbreak in the Republic of Korea Third Global Conference of OIE Reference Centres Incheon(Seoul),

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

Chapter 18. Viral Genetics. AP Biology

Chapter 18. Viral Genetics. AP Biology Chapter 18. Viral Genetics 2003-2004 1 A sense of size Comparing eukaryote bacterium virus 2 What is a virus? Is it alive? DNA or RNA enclosed in a protein coat Viruses are not cells Extremely tiny electron

More information

Random Sample. Pages for Preview USF&WS. Mallard with duck plague exhibiting prolapsed penis

Random Sample. Pages for Preview USF&WS. Mallard with duck plague exhibiting prolapsed penis Random Sample Mallard with duck plague exhibiting prolapsed penis USF&WS Random Sample Duck plague: Intestinal tract with hemorrhagic annular bands Cornell Duck Lab. Random Sample Digestive tract from

More information

Global Catastrophic Biological Risks

Global Catastrophic Biological Risks Global Catastrophic Biological Risks Working Definition of Global Catastrophic Biological Risks (GCBRs) Events in which biological agents whether naturally emerging or reemerging, deliberately created

More information

PopGen4: Assortative mating

PopGen4: Assortative mating opgen4: Assortative mating Introduction Although random mating is the most important system of mating in many natural populations, non-random mating can also be an important mating system in some populations.

More information

otherwise known as Cytotoxic T lymphocytes (CTLs)

otherwise known as Cytotoxic T lymphocytes (CTLs) MIT Biology Department 7.012: Introductory Biology - Fall 200 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 5 FRIDAY October 29, 2004

More information

Structure and Function of Antigen Recognition Molecules

Structure and Function of Antigen Recognition Molecules MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and

More information

Microevolution: The Forces of Evolutionary Change Part 2. Lecture 23

Microevolution: The Forces of Evolutionary Change Part 2. Lecture 23 Microevolution: The Forces of Evolutionary Change Part 2 Lecture 23 Outline Conditions that cause evolutionary change Natural vs artificial selection Nonrandom mating and sexual selection The role of chance

More information

Diagnostic Methods of HBV and HDV infections

Diagnostic Methods of HBV and HDV infections Diagnostic Methods of HBV and HDV infections Zohreh Sharifi,ph.D Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine Hepatitis B-laboratory diagnosis Detection

More information

7.013 Spring 2005 Problem Set 7

7.013 Spring 2005 Problem Set 7 MI Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor yler Jacks, Dr. Claudette Gardel 7.013 Spring 2005 Problem Set 7 FRIDAY May 6th, 2005 Question

More information

Diagnosis of drug resistant TB

Diagnosis of drug resistant TB Diagnosis of drug resistant TB Megan Murray, MD, ScD Harvard School of Public Health Brigham and Women s Hospital Harvard Medical School Broad Institute Global burden of TB 9 million new cases year 2 million

More information

Sequencing-Based Identification of a Novel Coronavirus in Ferrets with Epizootic Catarrhal Enteritis and Development of Molecular Diagnostic Tests

Sequencing-Based Identification of a Novel Coronavirus in Ferrets with Epizootic Catarrhal Enteritis and Development of Molecular Diagnostic Tests Sequencing-Based Identification of a Novel Coronavirus in Ferrets with Epizootic Catarrhal Enteritis and Development of Molecular Diagnostic Tests A. Wise, Matti Kiupel,, C. Isenhour, R. Maes Coronaviruses

More information

Diagnosis of infectious diseases and confirmation of diagnosis. Molecular epidemiology of emerging/re-emerging pathogens

Diagnosis of infectious diseases and confirmation of diagnosis. Molecular epidemiology of emerging/re-emerging pathogens LA PREPARAZIONE E LA RISPOSTA ALLE EMERGENZE INFETTIVE Padova, 20 settembre 2012 Laboratory advanced technologies in the support of Public Health interventions in infectious disease emergencies Prof. Giorgio

More information

Research Strategy: 1. Background and Significance

Research Strategy: 1. Background and Significance Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity

More information

General information. Cell mediated immunity. 455 LSA, Tuesday 11 to noon. Anytime after class.

General information. Cell mediated immunity. 455 LSA, Tuesday 11 to noon. Anytime after class. General information Cell mediated immunity 455 LSA, Tuesday 11 to noon Anytime after class T-cell precursors Thymus Naive T-cells (CD8 or CD4) email: lcoscoy@berkeley.edu edu Use MCB150 as subject line

More information

Multi-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis

Multi-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis JCM Accepts, published online ahead of print on 30 May 2012 J. Clin. Microbiol. doi:10.1128/jcm.00678-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Multi-clonal origin

More information

Avian Disease & Oncology Lab (ADOL) Research Update. John Dunn, Hans Cheng, Mohammad Heidari, Huanmin Zhang USDA-ARS-USPNRC

Avian Disease & Oncology Lab (ADOL) Research Update. John Dunn, Hans Cheng, Mohammad Heidari, Huanmin Zhang USDA-ARS-USPNRC Avian Disease & Oncology Lab (ADOL) Research Update John Dunn, Hans Cheng, Mohammad Heidari, Huanmin Zhang USDA-ARS-USPNRC Research Programs at ADOL 1) Genomics (Cheng, Zhang, Vacant SY) Title: Employing

More information

What can pathogen phylogenetics tell us about cross-species transmission?

What can pathogen phylogenetics tell us about cross-species transmission? The Boyd Orr Centre for Population and Ecosystem Health What can pathogen phylogenetics tell us about cross-species transmission? Roman Biek! Bovine TB workshop 3 Sep 2015 Talk outline Genetic tracking

More information

6/7/17. Immune cells. Co-evolution of innate and adaptive immunity. Importance of NK cells. Cells of innate(?) immune response

6/7/17. Immune cells. Co-evolution of innate and adaptive immunity. Importance of NK cells. Cells of innate(?) immune response Immune cells Co-evolution of innate and adaptive immunity 1 2 Importance of NK cells Cells of innate(?) immune response Patients with NK cell deficiency may lead to fatal infections and have an increased

More information

علم األحياء الدقيقة Microbiology Introduction to Virology & Immunology

علم األحياء الدقيقة Microbiology Introduction to Virology & Immunology علم األحياء الدقيقة Microbiology Introduction to Virology & Immunology What is a virus? Viruses may be defined as acellular organisms whose genomes consist of nucleic acid (DNA or RNA), and which obligatory

More information

Characterizing intra-host influenza virus populations to predict emergence

Characterizing intra-host influenza virus populations to predict emergence Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems

More information

The roadmap. Why do we need mathematical models in infectious diseases. Impact of vaccination: direct and indirect effects

The roadmap. Why do we need mathematical models in infectious diseases. Impact of vaccination: direct and indirect effects Mathematical Models in Infectious Diseases Epidemiology and Semi-Algebraic Methods Why do we need mathematical models in infectious diseases Why do we need mathematical models in infectious diseases Why

More information

Genetic diversity in the fungal pathogen Dothistroma septosporum. Angie Dale Masters of Science, NRES Supervisor: Kathy Lewis

Genetic diversity in the fungal pathogen Dothistroma septosporum. Angie Dale Masters of Science, NRES Supervisor: Kathy Lewis Genetic diversity in the fungal pathogen Dothistroma septosporum Angie Dale Masters of Science, NRES Supervisor: Kathy Lewis 1 Outline Introduction Research Questions Methods Results to date Implications

More information

Significance of the MHC

Significance of the MHC CHAPTER 8 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

More information

LESSON 4.5 WORKBOOK. How do viruses adapt Antigenic shift and drift and the flu pandemic

LESSON 4.5 WORKBOOK. How do viruses adapt Antigenic shift and drift and the flu pandemic DEFINITIONS OF TERMS Gene a particular sequence of DNA or RNA that contains information for the synthesis of a protien or RNA molecule. For a complete list of defined terms, see the Glossary. LESSON 4.5

More information

Exploring the Importance of Single Nucleotide Polymorphisms of HSPA9 in DNA of Sarcoma Patients

Exploring the Importance of Single Nucleotide Polymorphisms of HSPA9 in DNA of Sarcoma Patients University of New Hampshire University of New Hampshire Scholars' Repository Honors Theses and Capstones Student Scholarship Summer 2013 Exploring the Importance of Single Nucleotide Polymorphisms of HSPA9

More information

2018 Perinatal Hepatitis B Summit. Eva Hansson, RN, MSN Perinatal Hepatitis B Prevention Coordinator

2018 Perinatal Hepatitis B Summit. Eva Hansson, RN, MSN Perinatal Hepatitis B Prevention Coordinator 2018 Perinatal Hepatitis B Summit Eva Hansson, RN, MSN Perinatal Hepatitis B Prevention Coordinator Overview of Summit Summary of perinatal Hepatitis B in the US & Texas ACIP Hepatitis B Prevention recommendations

More information

Ch. 23 The Evolution of Populations

Ch. 23 The Evolution of Populations Ch. 23 The Evolution of Populations 1 Essential question: Do populations evolve? 2 Mutation and Sexual reproduction produce genetic variation that makes evolution possible What is the smallest unit of

More information

IMMUNOLOGY. Elementary Knowledge of Major Histocompatibility Complex and HLA Typing

IMMUNOLOGY. Elementary Knowledge of Major Histocompatibility Complex and HLA Typing IMMUNOLOGY Elementary Knowledge of Major Histocompatibility Complex and HLA Typing Tapasya Srivastava and Subrata Sinha Department of Biochemistry All India Institute of Medical Sciences New Delhi - 110029

More information

Research Update: Avian Disease & Oncology Lab (ADOL) and SEPRL Endemic Poultry Virus Diseases (EPVD)

Research Update: Avian Disease & Oncology Lab (ADOL) and SEPRL Endemic Poultry Virus Diseases (EPVD) Research Update: Avian Disease & Oncology Lab (ADOL) and SEPRL Endemic Poultry Virus Diseases (EPVD) John Dunn, Hans Cheng, Mohammad Heidari, Huanmin Zhang, Taejoong Kim, Stephen Spatz, Qingzhong Yu USDA-ARS-USPNRC

More information

The Distribution of Human Differences. If all this genetic variation is so recent and continuous, why do we think of it in categorical terms?

The Distribution of Human Differences. If all this genetic variation is so recent and continuous, why do we think of it in categorical terms? Expansion Routes of Homo sapiens ~40-25,000 b.p. The Distribution of Human Differences ~120-100,000 b.p. ~50-40,000 b.p. ~20-15,000 b.p. - - - Coastal Route Circa 10-3,500 b.p. If all this genetic variation

More information

Funky Leaf Spot, Viruses, and Xylella Update Winter Phillip M. Brannen University of Georgia Plant Pathology Department

Funky Leaf Spot, Viruses, and Xylella Update Winter Phillip M. Brannen University of Georgia Plant Pathology Department Funky Leaf Spot, Viruses, and Xylella Update Winter 2011 Phillip M. Brannen University of Georgia Plant Pathology Department Background: Systemic Blueberry Diseases At least nine species of plant viruses

More information

Prof. Ibtesam Kamel Afifi Professor of Medical Microbiology & Immunology

Prof. Ibtesam Kamel Afifi Professor of Medical Microbiology & Immunology By Prof. Ibtesam Kamel Afifi Professor of Medical Microbiology & Immunology Lecture objectives: At the end of the lecture you should be able to: Enumerate features that characterize acquired immune response

More information

Lecture 19 Evolution and human health

Lecture 19 Evolution and human health Lecture 19 Evolution and human health The evolution of flu viruses The evolution of flu viruses Google Flu Trends data US data Check out: http://www.google.org/flutrends/ The evolution of flu viruses the

More information

Chapter 6. Antigen Presentation to T lymphocytes

Chapter 6. Antigen Presentation to T lymphocytes Chapter 6 Antigen Presentation to T lymphocytes Generation of T-cell Receptor Ligands T cells only recognize Ags displayed on cell surfaces These Ags may be derived from pathogens that replicate within

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

T cell maturation. T-cell Maturation. What allows T cell maturation?

T cell maturation. T-cell Maturation. What allows T cell maturation? T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry

More information

Lecture 2: Virology. I. Background

Lecture 2: Virology. I. Background Lecture 2: Virology I. Background A. Properties 1. Simple biological systems a. Aggregates of nucleic acids and protein 2. Non-living a. Cannot reproduce or carry out metabolic activities outside of a

More information

HLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012.

HLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012. www.ebmt.org HLA and more Ilias I.N. Doxiadis Geneva 03/04/2012 HLA and more HLA and more / Doxiadis 2 Topic of the day Compatibility testing is a type of testing used to ensure compatibility of the system/application/website

More information

Neutrophils Macrophages CD4+ T-cells CD8+ T-cells B-cells None

Neutrophils Macrophages CD4+ T-cells CD8+ T-cells B-cells None Question 3 a) Cells present antigens on MHC I and MHC II molecules. The following table lists several different antigen types, and two different cell types that will present the antigen. For each box,

More information

Outline. How archaics shaped the modern immune system. The immune system. Innate immune system. Adaptive immune system

Outline. How archaics shaped the modern immune system. The immune system. Innate immune system. Adaptive immune system Outline How archaics shaped the modern immune system Alan R. Rogers February 14, 2018 Why the immune system is sensitive to archaic introgression. Archaic MHC alleles The OAS1 innate immunity locus 1 /

More information

Robert B. Colvin, M.D. Department of Pathology Massachusetts General Hospital Harvard Medical School

Robert B. Colvin, M.D. Department of Pathology Massachusetts General Hospital Harvard Medical School Harvard-MIT Division of Health Sciences and Technology HST.035: Principle and Practice of Human Pathology Dr. Robert B. Colvin Transplantation: Friendly organs in a hostile environment Robert B. Colvin,

More information

c) Macrophages and B cells present antigens to helper T_-cells. (Fill in blanks.) 2 points

c) Macrophages and B cells present antigens to helper T_-cells. (Fill in blanks.) 2 points Question 1 You are an immunologist who wants to make the big bucks. You decide to leave the world of science and get a job as a script-consultant on a new medical drama (ER-like) show. You test the writers

More information

Supplementary Figure 1 Weight and body temperature of ferrets inoculated with

Supplementary Figure 1 Weight and body temperature of ferrets inoculated with Supplementary Figure 1 Weight and body temperature of ferrets inoculated with A/Anhui/1/2013 (H7N9) influenza virus. (a) Body temperature and (b) weight change of ferrets after intranasal inoculation with

More information

Cristina Cassetti, Ph.D.

Cristina Cassetti, Ph.D. NIAID Extramural Research Update: Recombinant Influenza Viruses and Biosafety Cristina Cassetti, Ph.D. Influenza Program Officer Division of Microbiology and Infectious Diseases NIAID Influenza virus DMID

More information

Determinants of Immunogenicity and Tolerance. Abul K. Abbas, MD Department of Pathology University of California San Francisco

Determinants of Immunogenicity and Tolerance. Abul K. Abbas, MD Department of Pathology University of California San Francisco Determinants of Immunogenicity and Tolerance Abul K. Abbas, MD Department of Pathology University of California San Francisco EIP Symposium Feb 2016 Why do some people respond to therapeutic proteins?

More information

Richard Malik Centre for Veterinary Education The University of Sydney

Richard Malik Centre for Veterinary Education The University of Sydney Richard Malik Centre for Veterinary Education The University of Sydney 1 Pathology Update 3/8/2019 Pathology Update 3/8/2019 2 Pathology Update 3/8/2019 3 Pathology Update 3/8/2019 4 Pathology Update 3/8/2019

More information

Suggestions to prevent / control Respiratory Disease Complex in poultry

Suggestions to prevent / control Respiratory Disease Complex in poultry Suggestions to prevent / control Respiratory Disease Complex in poultry Dr. J. L. Vegad Adviser Phoenix Group 201/15, Gorakhpur, Jabalpur - 482001 Introduction Today, respiratory disease complex has emerged

More information

The Distribution of Human Differences. If all this genetic variation is so recent and continuous, why do we think of it in categorical terms?

The Distribution of Human Differences. If all this genetic variation is so recent and continuous, why do we think of it in categorical terms? Expansion Routes of Homo sapiens ~40-25,000 b.p. The Distribution of Human Differences ~120-100,000 b.p. ~50-40,000 b.p. ~20-15,000 b.p. - - - Coastal Route Circa 10-3,500 b.p. If all this genetic variation

More information

Tolerance vs. Resistance of infectious diseases. Lea Mösch& Hanna Schiff

Tolerance vs. Resistance of infectious diseases. Lea Mösch& Hanna Schiff Tolerance vs. Resistance of infectious diseases Lea Mösch& Hanna Schiff Introduction Definitions: Tolerance: the ability to limit the disease severity induced by a given parasite burden Resistance: the

More information

Fluid movement in capillaries. Not all fluid is reclaimed at the venous end of the capillaries; that is the job of the lymphatic system

Fluid movement in capillaries. Not all fluid is reclaimed at the venous end of the capillaries; that is the job of the lymphatic system Capillary exchange Fluid movement in capillaries Not all fluid is reclaimed at the venous end of the capillaries; that is the job of the lymphatic system Lymphatic vessels Lymphatic capillaries permeate

More information

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T

More information