Monitoring for Drug Resistance by Genotyping. Urvi M Parikh, PhD MTN Virology Core Lab

Transcription

1 Monitoring for Drug Resistance by Genotyping Urvi M Parikh, PhD MTN Virology Core Lab

2 Outline What is Drug Resistance? Genotyping Algorithm Standard vs Sensitive Resistance Testing Sequencing Protocols ViroSeq Allele-specific PCR Single Genome Sequencing Interpreting the Data

3 What is drug resistance? High error rate of HIV causes misincorporations, resulting in changes in genome F Some changes enable HIV to replicate in presence of antiviral compounds, thus reducing drug effectiveness

4 MTN Study Drugs MTN-001 tenofovir MTN-002 tenofovir MTN-003 tenofovir, TDF, TDF/FTC MTN-004 SPL7013 (VivaGel TM ) MTN-005 non-medicated intravaginal ring MTN-015 seroconverter HPTN-035 BufferGel, PRO2000/5 Gel

5 Mutations of Interest Tenofovir K65R (3%) K70E (0.24%) L74V (rare) Q151M (rare) T69SS (rare) A62V and S68G Compensatory Replication capacity FTC M184V Virus with K65R causes resistance to FTC M184V makes the virus MORE SUSCEPTIBLE to Tenofovir

6 Microbicide Resistance Unlikely BufferGel Carbopol974P Maintains acidic ph of vagina Virus inactivated at ph Pro2000/5 Inhibits virus entry into cells Non-specific mechanism BufferGel Pro2000/5 Tenofovir FTC From Weber PLOS Med 2005

7 Genotyping Algorithm Plasma Samples from VOICE ViroSeq Standard Genotyping Resistance mutations detected NO Resistance mutations detected Allele-Specific PCR (K65R and M184V) Report mutations Resistance mutations detected NO Resistance mutations detected Subset of samples Single Genome Sequencing (unknown changes) Identify new mutations or linkages between known mutations Report that participant does not have drug resistance Subset of samples

8 Why Sensitive Testing? Standard sequencing can miss mutations that are present at <25% of the population Minority variants can be associated with treatment failure (Johnson PLOS Med 2008) All patients were reported as having wild type infection by standard sequencing

9 Standard Sequencing (ViroSeq) Plasma virus STANDARD SEQUENCE (Population) To cdna PCR Bulk cdna Detects the majority or population variant Misses bases present at <25% N = G and A N = G and T Reported T Actually T and G

10 Protocol: ViroSeq Coverage

11

12 Allele-Specific PCR (ASPCR) Plasma virus To cdna 1 st round PCR Amplify target region Quantify with CYBR green Discriminatory Primer Detects % Mutant Dilute DNA to 10 7 copies/reaction Amplify and Quantify with CYBR green Total Primer Detects ALL

13 Allele-specific PCR (ASPCR) Round 1 Amplify pol region 2195 HIV-1 pol 2818 PCR Product Dilute to 10 7 copies 65K AAA 65R AGA WT HIV-1 pol WT MUT HIV-1 pol MUT Detection Limit: 0.1% mutant (Halvas, J Clin Micro 2006)

14 Single Genome Sequencing (SGS) Plasma virus To cdna Dilute to 30% positive Sensitivity depends on number of genomes sequenced 20 sequences detects mutations present at 10% SINGLE GENOME SEQUENCE (SGS) cdna 1 copy/rxn Sequence Positives Ref: Palmer et al., J Clin Micro 2005

15 Single Genome Sequencing (SGS) Certainty of Detection # Sequences needed to detect mutation present at 1% 5% 10% 25% 50% 90% % % Table from L.Halvas

16 What is the difference? Method Type Description VIROSEQ CLINICAL (USA FDAapproved) Population genotype major mutations ASPCR SGS RESEARCH ONLY RESEARCH ONLY % of a specific mutant All mutations, major and minor polymorphisms

17 How will we use the data? Method VIROSEQ ASPCR SGS What we learn If patient has virus with resistance mutations, can help decide what therapy to put her on Gives an idea if patient has undetected resistance, and to what extent Gives a picture of the diversity of virus in the patient to help better understand how resistance occurred

18 Finally, remember If the microbicide PROTECTS against HIV, drug resistance is not an issue!!! Drug resistance is a concern if: A positive person uses a microbicide The microbicide does not protect and the participant becomes infected MONITORING for drug resistance can assure us that resistance is not occurring, or help identify the correct drugs for treatment

19 Questions? ATTCTGGACATAAGACAAGGACCAAAAG AACCCTTTAGAGACTATGTAGACCGGTT CTATAAAACTCTAAGAGCCGAGCAAGCT TCACAGGAGGTAAAAAATTGGATGACAG AAACCTTGTTGGTCCAAAATGCGAACCC AGATTGTAAGACTATTTTAAAAGCATTG GGACCAGCAGCTACACTAGAAGAAATGA TGACAGCATGTCAGGGAGTGGGAGGACC CGGCCATAAGGCAAGAGTTTTGGCTGAA GCAATGAGCCAAGTAACAAATTCAGCTA CCATAATGATGCAAAGAGGCAATTTTAG GAACCAAAGAAAGATTGTTAAGTGTTTC AATTGTGGCAAAGAAGGGCACATAGCCA