Table S1. Social-demographic characteristics of HIV-1 infected IDUs in Northern Myanmar. Variable (n=83) (%)

Size: px
Start display at page:

Download "Table S1. Social-demographic characteristics of HIV-1 infected IDUs in Northern Myanmar. Variable (n=83) (%)"

Transcription

1 Table S1. Social-demographic characteristics of HIV-1 infected IDUs in Northern Myanmar. Variable (n=83) Count (%) HIV-1 recombinants (Prevalence, %) Location Maizayang town 31(37.3) 25(80.6) Laza city 52(62.7) 43(82.7) Marital status Unmarried 46(55.4) 38(82.6) Married 25 (30.1) 19(76) Divorced 12 (14.5) 11(91.7) Education level 0 year 9(10.8) 6(66.7) Elementary 34(41.0) 27(79.4) Junior high 17(20.5) 15(88.2) Senior high 11(13.3) 10(90.9) College 12(14.5) 10(83.3) Age (years old) (2.4) 1(50) (51.8) 40(90.9) (36.1) 22(73.3) (7.2) 4(66.7) (2.4) 2() Age at first injection (years old) (14.5) 10(83.3) (57.8) 41(85.4) (24.1) 14(70) (1.2) 1() (2.4) 2() Nationality Han 19(22.9) 15(78.9) Dai 8(9.6) 6(75) Lahujingpo 40(48.2) 32(80) Bammar 9(10.8) 9() Sam myan 2(2.4) 2() Lili 1(1.2) 1() Hui 1(1.2) 1() Other 3(3.6) 1(33.3) Occupation Farmer 35(42.2) 27(77.1) Entertainment 2(2.4) 1(50) Businessman 6(7.2) 6() Soldier 1(1.2) 1() Worker 8(9.6) 7(87.5) Casual worker 15(18.1) 14(93.3) Unemployment 11(13.3) 9(81.8) Civil servant 2(2.4) 1(50) Driver 2(2.4) 1(50) Other 1(1.2) 1() RF: recombination forms

2 Table S2. Information of the primer pairs used in this study. Genomic fragments Reactions Primer Sequence (5-3 ) Location in pnl4.3 (nt) P17 1 st PCR Forward PBS-172A ATCTCTAGCAGTGGCGCCCGAACAG 2-26 Reverse p24-173b CTGATAATGCTGAAAACATGGGTAT nd PCR Forward PSI-174A CTCTCGACGCAGGACTCGGCTTGCT Reverse p17-175b CCCATGCATTCAAAGTTCTAGGTGA C2/V3 1 st PCR Forward ED-5 ATGGGATCAAAGCCTAAAGCCATGTG Reverse ED-12 AGTGCTTCCTGCTGCTCCCAAGAACCCAAG nd PCR Forward ED-31 CCTCAGCCATTACACAGGCCTGTCCAAAG Reverse ED-33 TTACAGTAGAAAAATTCCCCTC Pol 1 st PCR Forward AW26 TGGAAATGTGGAAAGGAAGGAC Reverse RT21 CTGTATTTCTGCTATTAAGTCTTTTGATGGG nd PCR Forward PRO-1 CAGAGCCAACAGCCCCACCA Reverse RT20 CTGCCAGTTCTAGCTCTGCTTC vif-vpr 1 st PCR Forward VIF-362A GGCAGGTGATGATTGTGTGGC Reverse VIF-364B GGCTGACTTCCTGGATGGTTCCAGGGC nd PCR Forward VIF-363A GGATGAGGATTAGAACATGG Reverse VIF-365B GCCTATTCTGCTATGTTGACACCC vpr-env 1 st PCR Forward VIF-368A GCCCCAGAAGACCAAGGGCC Reverse ENV-360B GGGGTCTGTGGGTACACAGGCATGTGT nd PCR Forward VIF-369A GACATTTTCCTAGGCCATGGC Reverse ENV-370B GTGGGTACACAGGCATGTGTGGC

3 Table S3. Summary of primary screening of HIV-1 genotypes in Northern Myanmar. Genomic Size Num Subtypes (%) Recombinants (%) fragments (nt) ber B C CRF01_ CRF07_ Recombinan BC CRF01_AE CRF0 CRF01_AE AE BC ts /B 1_AE /B/C /C P (8.0) 47(62.7) 10(13.3) 0 12(16) 1(8.3) 0 11(91. 7) 0 pol (7.2) 8(11.6) 2(2.9) 0 54(78.3) 50(92.6) 0 1(1.9) 3(5.6) vif-env (4.1) 4(8.2) 4(8.2) 1(1.4) 38(77.6) 22(57.9) (42.1) Env (6.7) 37(61.7) 9(15) 0 10(16.7) 0 0 9(90) 1(10)

4 Figure S1. Phylogenetic tree of p17 fragments (A) and bootscanning plots of some recombinants (B). The recombination was determined using bootscan analyses (SimPlot software). Because some recombinants (i.e. CRF01_AE/C recombinants) shared identical breakpoint, only one representative bootscanning plot is shown. The HIV-1 subtype references used in bootscan analyses are: subtypes A (PS1044 and 92UG037), B (RL42, BK132, 671_00T36, and 1058_11), C (95IN21068, BR025-D, ETH2220, and SK16481), and CRF01_AE (93TH051 and CM240). For other details, please see Fig. 2.

5 Figure S2. Phylogenetic tree of C2V3 fragments of HIV-1 strains isolated from Northern Myanmar. A, phylogenetic tree. B, bootscanning plots of some recombinants. Please see Figs. s. 2 and S1 for other details.

6 Figure S3. Bootscanning plots of pol fragments of HIV-1 intersubtype recombinants from IDUs in Northern Myanmar. For other details, please see Figs. 2 and S1. CRF07_BC CRF08_BC 09mIDU020 (09mIDU033) 09mIDU087 09mIDU082 09mIDU070 09mIDU014 09mIDU031 09mIDU094 09mIDU076 09mIDU039 (09mIDU002) 09mIDU074 09mIDU073 09mIDU045 09mIDU064 09mIDU053 09mIDU005 09mIDU034 (09mIDU088; 09mIDU009) 09mIDU051 09mIDU047 09mIDU041 09mIDU078 09mIDU093 09mIDU035 (09mIDU030; 09mIDU003; 09mIDU027; 09mIDU029; 09mIDU010)

7 Figure S3 (Continued). Bootscanning plots of pol fragments of HIV-1 intersubtype recombinants from IDUs in Northern Myanmar. For other details, please see Figs. 2 and S1. 09mIDU065 09mIDU036 09mIDU044 (09mIDU092) 09mIDU069 09mIDU090 CRF01_AE/B/C recombinants 09mIDU042 09mIDU072 09mIDU007 (09mIDU024) 09mIDU mIDU043 09mIDU008 09mIDU017 (09mIDU016) 09mIDU054 09mIDU032 CRF01_AE/C recombinants 09mIDU052 09mIDU089 09mIDU018 (09mIDU019) 09mIDU015 09mIDU038

8 Figure S4. Bootscanning plots of vif-env fragments of HIV-1 intersubtype recombinants from IDUs in Northern Myanmar. For other details, please see Figs. 2 and S1. CRF07_BC 09mIDU003 (09mIDU030) 09mIDU018 09mIDU084 09mIDU051 09mIDU005 09mIDU043 09mIDU073 09mIDU002 09mIDU057 (09mIDU076) 09mIDU032 09mIDU089 09mIDU082 09mIDU053 09mIDU015 09mIDU095 09mIDU041 09mIDU044 09mIDU048 09mIDU033 09mIDU034 09mIDU092

9 Figure S4 (Continued). Bootscanning plots of vif-env fragments of HIV-1 intersubtype recombinants from IDUs in Northern Myanmar. For other details, please see Figs. 2 and S1. 09mIDU065 (09mIDU031) 09mIDU094 09mIDU036 (09mIDU047 09mIDU054 09mIDU014 09mIDU069) 09mIDU088 09mIDU045 09mIDU078 09mIDU087 09mIDU072 09mIDU090 09mIDU093 09mIDU064

10 Figure S5. Phylogenetic tree of vif-vpr fragments of HIV-1 strains isolated from Northern Myanmar. For other details, please see Figs. 2 and S1. 07 BC.CN.97.97CN001.AF mIDU007 09mIDU BC.CN.05.XJDC EF BC.CN.05.XJDC6441.EF mIDU010 09mIDU mIDU026 B/C recombinant 09mIDU040 C.IN.95.95IN21068.AF mIDU028 09mIDU004 09mIDU BC.CN.97.97CNGX 6F.AY BC.CN.98.98CN006.AF C.ET.86.ETH2220.U46016 C.BR.92.BR025 d.u BC.BR.04.04BR142.AY C.ZA.04.SK164B1.AY B.US AY mIDU B.CN.-.RL42 B B.NL T36.AY B.TH.90.BK132.AY D.TZ.01.A280.AY D.UG.94.94UG114.U88824 H.BE.93.VI991.AF H.CF AF J.SE.93.SE7887.AF J.SE.94.SE7022.AF F2.CM.02.02CM 0016BBY.AY F2.CM.95.MP255.AJ K.CD.97.EQTB11C.AJ K.CM.96.MP535.AJ F1.FI.93.FIN9363.AF F1.FR.96.MP411.AJ A2.CD.97.97CDKTB48.AF A2.CY.94.94CY AF A1.AU.03.PS1044 Day0.DQ A1.UG.92.92UG037.AB G.PT.x.PT2695.AY BG.DE AY G.BE.96.DRCBL.AF B.MY.05.05MYKL007 1.DQ B.MY.05.05MYKL045 1.DQ AE.TH.90.CM240.U AE.TH.93.93TH051.AB B.TH.99.OUR2478P.EF B.TH.99.99TH MU2079.AF B.TH.99.99TH R2399.AF CPZ.CM.05.SIVcpzMT145.DQ C CRF07_BC 0.05

11 Figure S6. Phylogenetic tree of vpr-env fragments of HIV-1 strains isolated from Northern Myanmar. For other details, please see Figs. 2 and S1. CRF07_BC 09mIDU025 09mIDU BC.CN.05.XJDC6441.EF BC.CN.97.97CN001.AF BC.CN.05.XJDC EF mIDU022 B/C recombinant 09mIDU017 B/C recombinant 09mIDU025 B/C recombinant B.US AY B.CN..RL42 B.NL T36.AY B.TH.90.BK132.AY mIDU035 09mIDU086 09mIDU024 CRF01_AE/B recombinants 78 09mIDU037 09mIDU039 B/C recombinant C.BR.92.BR025 d.u BC.BR.04.04BR142.AY C.ET.86.ETH2220.U46016 C.ZA.04.SK164B1.AY mIDU020 09mIDU023 C 84 C.IN.95.95IN21068.AF mIDU BC.CN.97.97CNGX 6F.AY BC.CN.98.98CN006.AF D.TZ.01.A280.AY D.UG.94.94UG114.U88824 J.SE.93.SE7887.AF J.SE.94.SE7022.AF H.BE.93.VI991.AF H.CF AF K.CD.97.EQTB11C.AJ K.CM.96.MP535.AJ F2.CM.02.02CM 0016BBY.AY F2.CM.95.MP255.AJ F1.FI.93.FIN9363.AF F1.FR.96.MP411.AJ G.BE.96.DRCBL.AF G.PT.x.PT2695.AY BG.DE AY A2.CD.97.97CDKTB48.AF A2.CY.94.94CY AF A1.AU.03.PS1044 Day0.DQ A1.UG.92.92UG037.AB mIDU052 CRF01_AE/B/C recombinant B.TH.99.99TH MU2079.AF B.TH.96.M169.DQ B.TH.99.99TH R2399.AF mIDU mIDU058 09mIDU042 CRF01_AE 33 01B.MY.05.05MYKL045 1.DQ B.MY.05.05MYKL007 1.DQ B.TH.99.OUR2478P.EF AE.TH.90.CM240.U AE.TH.93.93TH051.AB CPZ.CM.05.SIVcpzMT145.DQ mIDU035 09mIDU017 09mIDU048 ( 09mIDU024 09mIDU037) 09mIDU mIDU039

12 Figure S7. Phylogenetic tree based on concatenated sequences from 47 HIV-1 strains isolated from Northern Myanmar. The sequences were concatenated in an order of p17, pol, vif-env, and C2V3. For other details, please see Figs. 2 and S1.

HIV 1 diversity in infected individuals in Suzhou and Suqian, China

HIV 1 diversity in infected individuals in Suzhou and Suqian, China DOI 10.1186/s40064-016-2378-z RESEARCH Open Access HIV 1 diversity in infected individuals in Suzhou and Suqian, China Chenhao Qin 1, Ping Zhang 1, Weiguang Zhu 2, Fangyuan Hao 3, Aiping Gu 1, Ping Fen

More information

EVOLUTION OF EPITOPE REGIONS IN HIV GENOME: DELINEATING SELECTIVE FORCES ACTING ON CONFORMATIONAL AND LINEAR EPITOPES

EVOLUTION OF EPITOPE REGIONS IN HIV GENOME: DELINEATING SELECTIVE FORCES ACTING ON CONFORMATIONAL AND LINEAR EPITOPES EVOLUTION OF EPITOPE REGIONS IN HIV GENOME: DELINEATING SELECTIVE FORCES ACTING ON CONFORMATIONAL AND LINEAR EPITOPES A thesis submitted to Kent State University in partial fulfillment of the requirements

More information

Increased Genetic Diversity of HIV-1 Circulating in Hong Kong

Increased Genetic Diversity of HIV-1 Circulating in Hong Kong Increased Genetic Diversity of HIV-1 Circulating in Hong Kong Jonathan Hon-Kwan Chen 1,2, Ka-Hing Wong 3, Zhiwei Chen 2, Kenny Chan 3, Ho-Yin Lam 1, Sabrina Wai-Chi To 1, Vincent Chi-Chung Cheng 1, Kwok-Yung

More information

HIV-1 Dual Infection and Neurocognitive Impairment

HIV-1 Dual Infection and Neurocognitive Impairment HIV-1 Dual Infection and Neurocognitive Impairment Gabriel Wagner, MD Assistant Professor of Medicine Infectious Diseases & Global Public Health UC San Diego HIV-Associated End Organ Damage Antiretroviral

More information

National Retrovirus Reference Center, Department of Hygiene and Epidemiology, Athens University Medical School, M. Asias 75, Athens , Greece 2

National Retrovirus Reference Center, Department of Hygiene and Epidemiology, Athens University Medical School, M. Asias 75, Athens , Greece 2 Journal of General Virology (2001), 82, 575 580. Printed in Great Britain... SHORT COMMUNICATION Re-analysis of human immunodeficiency virus type 1 isolates from Cyprus and Greece, initially designated

More information

Downloaded from:

Downloaded from: Kiwelu, IE; Novitsky, V; Margolin, L; Baca, J; Manongi, R; Sam, N; Shao, J; McLane, MF; Kapiga, SH; Essex, M (2012) HIV-1 subtypes and recombinants in Northern Tanzania: distribution of viral quasispecies.

More information

HIV . HIV-1 HIV. . NJplot. Nested RT-PCR . CRF35-AD

HIV . HIV-1 HIV. . NJplot. Nested RT-PCR . CRF35-AD (-) HIV-1 POL HIV.. HIV-1 HIV Nested RT- HIV-1. PTZ-57RT PCR.. ClustalW /. NJplot Nested RT-PCR.. CRF35-AD. CRF35-AD. HIV1 : // : // : : PhD : - PhD - HIV-1 POL. HIV.. HIV-1 PCR CRFs= ) (Criculating Recombinant

More information

Classification of HIV-1 Sequences Using Profile Hidden Markov Models

Classification of HIV-1 Sequences Using Profile Hidden Markov Models Using Profile Hidden Markov Models Sanjiv K. Dwivedi 1,2, Supratim Sengupta 1,3 * 1 School of Computational and Integrative Sciences, Jawaharlal Nehru University, New Delhi, India, 2 School of Sciences,

More information

Since the first case of AIDS was reported in Malaysia in

Since the first case of AIDS was reported in Malaysia in BASIC SCIENCE Identification of a Novel Circulating Recombinant Form (CRF33_01B) Disseminating Widely Among Various Risk Populations in Kuala Lumpur, Malaysia Kok Keng Tee, MMedSc,* Xiao-Jie Li, MD, PhD,*

More information

Gkikas Magiorkinis, 1 Dimitrios Paraskevis, 1 Anne-Mieke Vandamme, 2 Emmanouil Magiorkinis, 1 Vana Sypsa 1 and Angelos Hatzakis 1 INTRODUCTION

Gkikas Magiorkinis, 1 Dimitrios Paraskevis, 1 Anne-Mieke Vandamme, 2 Emmanouil Magiorkinis, 1 Vana Sypsa 1 and Angelos Hatzakis 1 INTRODUCTION Journal of General Virology (2003), 84, 2715 2722 DOI 10.1099/vir.0.19180-0 In vivo characteristics of human immunodeficiency virus type 1 intersubtype recombination: determination of hot spots and correlation

More information

Emergence of New Forms of Human Immunodeficiency Virus Type 1 Intersubtype Recombinants in Central Myanmar

Emergence of New Forms of Human Immunodeficiency Virus Type 1 Intersubtype Recombinants in Central Myanmar AIDS RESEARCH AND HUMAN RETROVIRUSES Volume 16, Number 17, 2000, pp. 1831 1843 Mary Ann Liebert, Inc. Emergence of New Forms of Human Immunodeficiency Virus Type 1 Intersubtype Recombinants in Central

More information

High Failure Rate of the ViroSeq HIV-1 Genotyping System for Drug Resistance Testing in Cameroon, a Country with Broad HIV-1 Genetic Diversity

High Failure Rate of the ViroSeq HIV-1 Genotyping System for Drug Resistance Testing in Cameroon, a Country with Broad HIV-1 Genetic Diversity JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2011, p. 1635 1641 Vol. 49, No. 4 0095-1137/11/$12.00 doi:10.1128/jcm.01478-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. High Failure

More information

Introduction. Abstract

Introduction. Abstract Virology 367 (2007) 288 297 www.elsevier.com/locate/yviro Complex patterns of the HIV-1 epidemic in Kuala Lumpur, Malaysia: Evidence for expansion of circulating recombinant form CRF33_01B and detection

More information

Panther has new prey

Panther has new prey Raising the Bar for Performance Testing Panther has new prey The Aptima HIV-1 Quant Dx assay leads the hunt for HIV-1 diagnosis and viral load monitoring. Freedom to work the way you choose Run what assays

More information

HIV-1 subtype C in Karonga District, Malawi. Simon Travers

HIV-1 subtype C in Karonga District, Malawi. Simon Travers HIV-1 subtype C in Karonga District, Malawi Simon Travers HIV-1; closely related to HIV found in chimps HIV-2; closely related to HIV found in mangabys Worldwide Distribution of HIV-1 group M subtypes

More information

A Comprehensive Panel of Near-Full-Length Clones and Reference Sequences for Non-Subtype B Isolates of Human Immunodeficiency Virus Type 1

A Comprehensive Panel of Near-Full-Length Clones and Reference Sequences for Non-Subtype B Isolates of Human Immunodeficiency Virus Type 1 JOURNAL OF VIROLOGY, July 1998, p. 5680 5698 Vol. 72, No. 7 0022-538X/98/$04.00 0 Copyright 1998, American Society for Microbiology. All Rights Reserved. A Comprehensive Panel of Near-Full-Length Clones

More information

3,4 It is essential to continuously monitor the diversity

3,4 It is essential to continuously monitor the diversity AIDS RESEARCH AND HUMAN RETROVIRUSES Volume 31, Number 4, 2015 Mary Ann Liebert, Inc. DOI: 10.1089/aid.2014.0230 Sequencing and Phylogenetic Analysis of Near Full-Length HIV-1 Subtypes A, B, G and Unique

More information

Potential overestimation of HIV-1 sub-subtype F1 circulation in Rio de Janeiro, Brazil

Potential overestimation of HIV-1 sub-subtype F1 circulation in Rio de Janeiro, Brazil SHORT COMMUNICATION Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 113(8): e170483, 2018 1 6 Potential overestimation of HIV-1 sub-subtype F1 circulation in Rio de Janeiro, Brazil Bianca Cristina Leires Marques,

More information

Human Immunodeficiency Virus Type 1 Subtypes Prevalence in Central China

Human Immunodeficiency Virus Type 1 Subtypes Prevalence in Central China Original Article DOI 10.3349/ymj.2009.50.5.644 pissn: 0513-5796, eissn: 1976-2437 Yonsei Med J 50(5): 644-649, 2009 Human Immunodeficiency Virus Type 1 Subtypes Prevalence in Central China Fei Zhao, 1

More information

HIV-1 Subtypes: An Overview. Anna Maria Geretti Royal Free Hospital

HIV-1 Subtypes: An Overview. Anna Maria Geretti Royal Free Hospital HIV-1 Subtypes: An Overview Anna Maria Geretti Royal Free Hospital Group M Subtypes A (1, 2, 3) B C D F (1, 2) G H J K Mechanisms of HIV-1 genetic diversification Point mutations RT error rate: ~1 per

More information

Chronic HIV-1 Infection Frequently Fails to Protect against Superinfection

Chronic HIV-1 Infection Frequently Fails to Protect against Superinfection Chronic HIV-1 Infection Frequently Fails to Protect against Superinfection Anne Piantadosi 1,2[, Bhavna Chohan 1,2[, Vrasha Chohan 3, R. Scott McClelland 3,4,5, Julie Overbaugh 1,2* 1 Division of Human

More information

VIROLOGY. Engineering Viral Genomes: Retrovirus Vectors

VIROLOGY. Engineering Viral Genomes: Retrovirus Vectors VIROLOGY Engineering Viral Genomes: Retrovirus Vectors Viral vectors Retrovirus replicative cycle Most mammalian retroviruses use trna PRO, trna Lys3, trna Lys1,2 The partially unfolded trna is annealed

More information

Matthew J. Gonzales, Rhoderick N. Machekano, and Robert W. Shafer

Matthew J. Gonzales, Rhoderick N. Machekano, and Robert W. Shafer 998 Human Immunodeficiency Virus Type Reverse-Transcriptase and Protease Subtypes: Classification, Amino Acid Mutation Patterns, and Prevalence in a Northern California Clinic-Based Population Matthew

More information

HIV/AIDS in Asia: The Shape of Epidemics and. Their Molecular Epidemiology *

HIV/AIDS in Asia: The Shape of Epidemics and. Their Molecular Epidemiology * VIROLOGICA SINICA, December 2007, 22 (6):426-433 CLC number: R511 Document code: A Article ID: 1674-0769(2007)06-0426-08 HIV/AIDS in Asia: The Shape of Epidemics and Their Molecular Epidemiology * Xiao-Jie

More information

JOURNAL OF VIROLOGY, Dec. 2000, p Vol. 74, No. 23. Copyright 2000, American Society for Microbiology. All Rights Reserved.

JOURNAL OF VIROLOGY, Dec. 2000, p Vol. 74, No. 23. Copyright 2000, American Society for Microbiology. All Rights Reserved. JOURNAL OF VIROLOGY, Dec. 2000, p. 11286 11295 Vol. 74, No. 23 0022-538X/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. A Recent Outbreak of Human Immunodeficiency

More information

Received 4 August 2005/Accepted 7 December 2005

Received 4 August 2005/Accepted 7 December 2005 JOURNAL OF VIROLOGY, Mar. 2006, p. 2472 2482 Vol. 80, No. 5 0022-538X/06/$08.00 0 doi:10.1128/jvi.80.5.2472 2482.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Extensive Recombination

More information

HIV-1 acute infection: evidence for selection?

HIV-1 acute infection: evidence for selection? HIV-1 acute infection: evidence for selection? ROLLAND Morgane University of Washington Cohort & data S6 S5 T4 S4 T2 S2 T1 S1 S7 T3 DPS (days post symptoms) 3 (Fiebig I) 7 (Fiebig I) 13 (Fiebig V) 14 (Fiebig

More information

Yale University, New Haven, CT, USA

Yale University, New Haven, CT, USA HEPATITIS C VIRUS INFECTION IS UBIQUITOUS AMONG DRUG INJECTORS IN ST. PETERSBURG, RF Robert Heimer 1, Elijah Paintsil 1, Sergei Verevochkin 2, Russell Barbour 1, Edward d White 1, Olga Toussova 2, Linda

More information

COMET: Rapid and reliable HCV subtype predictor

COMET: Rapid and reliable HCV subtype predictor COMET: Rapid and reliable HCV subtype predictor (Context-based Modeling for Expeditious Typing) Daniel Struck CRP-SANTÉ Laboratory of Retrovirology (daniel.struck@crp-sante.lu) Background HCV genotype/subtype

More information

One Way Ticket to Hell for young migrant drug users in Myanmar

One Way Ticket to Hell for young migrant drug users in Myanmar One Way Ticket to Hell for young migrant drug users in Myanmar Thinzar Tun, Willy De Maere, Dr.Thein Han, Jar Aung Asian Harm Reduction Network (AHRN) Myanmar Drug use in Myanmar Population size estimate

More information

Identification of a Novel Second-Generation Circulating Recombinant Form (CRF48_01B) in Malaysia: A Descendant of the Previously Identified CRF33_01B

Identification of a Novel Second-Generation Circulating Recombinant Form (CRF48_01B) in Malaysia: A Descendant of the Previously Identified CRF33_01B BASIC AND TRANSLATIONAL SCIENCE Identification of a Novel Second-Generation Circulating Recombinant Form (CRF48_01B) in Malaysia: A Descendant of the Previously Identified CRF33_01B Yue Li, BSc,* Kok Keng

More information

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4

More information

Micropathology Ltd. University of Warwick Science Park, Venture Centre, Sir William Lyons Road, Coventry CV4 7EZ

Micropathology Ltd. University of Warwick Science Park, Venture Centre, Sir William Lyons Road, Coventry CV4 7EZ www.micropathology.com info@micropathology.com Micropathology Ltd Tel 24hrs: +44 (0) 24-76 323222 Fax / Ans: +44 (0) 24-76 - 323333 University of Warwick Science Park, Venture Centre, Sir William Lyons

More information

Going Nowhere Fast: Lentivirus genetic sequence evolution does not correlate with phenotypic evolution.

Going Nowhere Fast: Lentivirus genetic sequence evolution does not correlate with phenotypic evolution. Going Nowhere Fast: Lentivirus genetic sequence evolution does not correlate with phenotypic evolution. Brian T. Foley, PhD btf@lanl.gov HIV Genetic Sequences, Immunology, Drug Resistance and Vaccine Trials

More information

Genotypes and Transmitted Drug Resistance among Treatment-Naive HIV-1-Infected Patients in a Northwestern Province, China: Trends from 2003 to 2013

Genotypes and Transmitted Drug Resistance among Treatment-Naive HIV-1-Infected Patients in a Northwestern Province, China: Trends from 2003 to 2013 Genotypes and Transmitted Drug Resistance among Treatment-Naive HIV-1-Infected Patients in a Northwestern Province, China: Trends from 2003 to 2013 Ke Zhao 1., Wenzhen Kang 1., Qingquan Liu 2,YuanLi 1,

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Rodger AJ, Cambiano V, Bruun T, et al; PARTNER Study Group. Sexual activity without condoms and risk of HIV transmission in serodifferent couples when the HIVpositive partner

More information

Background. A systematic analysis from previous studies reported the following prevalence:

Background. A systematic analysis from previous studies reported the following prevalence: High levels of resistance among HIV-1 treatment naive patients in Greece. a nationwide study: Evidence for country and regional level transmission networks D. Paraskevis 1. E. Kostaki 1. G. Magiorkinis

More information

Recombination in RNA viruses

Recombination in RNA viruses Recombination in RNA viruses Dr Rowena Bull NHMRC Career Development Fellow School of Medical Sciences, University of New South Wales Great diversity in viruses Arshan Nasir, and Gustavo Caetano-Anollés

More information

HIV-1 co-receptor tropism in recently diagnosed patients: correlates of CXCR4-use, impact of subtype and indications for X4/DM virus transmission

HIV-1 co-receptor tropism in recently diagnosed patients: correlates of CXCR4-use, impact of subtype and indications for X4/DM virus transmission Poster nr. O_26 HIV-1 co-receptor tropism in recently diagnosed patients: correlates of CXCR4-use, impact of subtype and indications for X4/DM virus transmission Kristen Chalmet, Kenny Dauwe, Lander Foquet,

More information

Results of Pilot NIH Study of Global HIV Variants

Results of Pilot NIH Study of Global HIV Variants Results of Pilot NIH Study of Global HIV Variants SoGAT Blood Virology Meeting Vilnius, Lithuania - 16-17 April 2012 Mark Manak, Ph.D. MHRP, USA The opinions expressed herein are those of the authors and

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1126531/dc1 Supporting Online Material for Chimpanzee Reservoirs of Pandemic and Nonpandemic HIV-1 Brandon F. Keele, Fran Van Heuverswyn, Yingying Li, Elizabeth Bailes,

More information

HIV 1 drug resistant mutations and related risk factors among HIV 1 positive individuals experiencing treatment failure in Hebei Province, China

HIV 1 drug resistant mutations and related risk factors among HIV 1 positive individuals experiencing treatment failure in Hebei Province, China DOI 10.1186/s12981-017-0133-3 AIDS Research and Therapy RESEARCH Open Access HIV 1 drug resistant mutations and related risk factors among HIV 1 positive individuals experiencing treatment failure in Hebei

More information

Review Article. Indian Journal of Experimental Biology Vol 47, June 2009, pp

Review Article. Indian Journal of Experimental Biology Vol 47, June 2009, pp Indian Journal of Experimental Biology Vol 47, June 2009, pp. 424-431 Review Article Global HIV-1 molecular epidemiology with special reference to genetic analysis of HIV-1 subtypes circulating in North

More information

Virus Research 116 (2006)

Virus Research 116 (2006) Virus Research 116 (2006) 201 207 Low prevalence of primary antiretroviral resistance mutations and predominance of HIV-1 clade C at polymerase gene in newly diagnosed individuals from south Brazil Rosangela

More information

Increased predominance of HIV-1 CRF01_AE and its recombinants in the Philippines

Increased predominance of HIV-1 CRF01_AE and its recombinants in the Philippines RESEARCH ARTICLE DOI 10.1099/jgv.0.001198 Increased predominance of HIV-1 CRF01_AE and its recombinants in the Philippines Yue Chen, 1 Bhavna Hora, 1 Todd DeMarco, 1 Regina Berba, 2 Heidi Register, 1 Sylvia

More information

An integrated map of HIV genome-wide variation from a population perspective. Li et al.

An integrated map of HIV genome-wide variation from a population perspective. Li et al. An integrated map of HIV genome-wide variation from a population perspective Li et al. Li et al. Retrovirology (2015) 12:18 DOI 10.1186/s12977-015-0148-6 Li et al. Retrovirology (2015) 12:18 DOI 10.1186/s12977-015-0148-6

More information

RESEARCH NOTE USE OF DRIED BLOOD SPOTS FOR HIV-1 GENOTYPING IN SOUTHEAST ASIA: THAILAND EXPERIENCE

RESEARCH NOTE USE OF DRIED BLOOD SPOTS FOR HIV-1 GENOTYPING IN SOUTHEAST ASIA: THAILAND EXPERIENCE RESEARCH NOTE USE OF DRIED BLOOD SPOTS FOR HIV-1 GENOTYPING IN SOUTHEAST ASIA: THAILAND EXPERIENCE Wiriya Rutvisuttinunt 1, Miguel A Arroyo 1,3,4, Vatcharain Assawadarachai 1, Kultida Poltavee 1, Francine

More information

HOST-PATHOGEN CO-EVOLUTION THROUGH HIV-1 WHOLE GENOME ANALYSIS

HOST-PATHOGEN CO-EVOLUTION THROUGH HIV-1 WHOLE GENOME ANALYSIS HOST-PATHOGEN CO-EVOLUTION THROUGH HIV-1 WHOLE GENOME ANALYSIS Somda&a Sinha Indian Institute of Science, Education & Research Mohali, INDIA International Visiting Research Fellow, Peter Wall Institute

More information

6/10/2015. Background. Background. Background. Background. Methods

6/10/2015. Background. Background. Background. Background. Methods /1/1 The challenges of diversity: HIV-1 subtype distribution and transmission s within the Australian Molecular Epidemiology Network-HIV -1 Castley A, Sawleshwarkar S, Varma R, Herring B, Thapa K, Chibo

More information

Socio-Demographic Factors associated with Success of Antiretroviral Treatment among HIV Patients in Tanzania

Socio-Demographic Factors associated with Success of Antiretroviral Treatment among HIV Patients in Tanzania Socio-Demographic Factors associated with Success of Antiretroviral Treatment among HIV Patients in Tanzania Dr. Fausta Franklin Mosha (MD, MSc, MSc, PHD) Ministry of Health and Social Welfare 22 nd October

More information

Characterising hepatitis C virus transmission dynamics in a highrisk incarcerated population

Characterising hepatitis C virus transmission dynamics in a highrisk incarcerated population Characterising hepatitis C virus transmission dynamics in a highrisk incarcerated population Neil Bretaña, Lies Boelen, Rowena Bull, Suzy Teutsch, Peter White, Andrew Lloyd, Fabio Luciani on behalf of

More information

Variability of HIV-1 Genomes among Children and Adolescents from São Paulo, Brazil

Variability of HIV-1 Genomes among Children and Adolescents from São Paulo, Brazil Variability of HIV-1 Genomes among Children and Adolescents from São Paulo, Brazil Sabri Saeed Sanabani 1,2 *., Rodrigo Pessôa 2., Ana Carolina Soares de Oliveira 2, Vanessa Pouza Martinez 2, Maria Teresa

More information

Hepatitis C Virus Genotype Diversity among Intravenous Drug Users in Yunnan Province, Southwestern China

Hepatitis C Virus Genotype Diversity among Intravenous Drug Users in Yunnan Province, Southwestern China Hepatitis C Virus Genotype Diversity among Intravenous Drug Users in Yunnan Province, Southwestern China Zhihui Zhang 1., Yufeng Yao 1., Wenlong Wu 2, Ruilin Feng 2, Zhongxiang Wu 1, Wei Cun 1 *, Shaozhong

More information

Genetic characterization and antiretroviral resistance mutations among treatment-naive HIV-infected individuals in Jiaxing, China

Genetic characterization and antiretroviral resistance mutations among treatment-naive HIV-infected individuals in Jiaxing, China /, 2017, Vol. 8, (No. 11), pp: 18271-18279 Genetic characterization and antiretroviral resistance mutations among treatment-naive HIV-infected individuals in Jiaxing, China Jinlei Guo 1,*, Yong Yan 1,*,

More information

Chen et al. BMC Infectious Diseases 2012, 12:382

Chen et al. BMC Infectious Diseases 2012, 12:382 Chen et al. BMC Infectious Diseases 2012, 12:382 RESEARCH ARTICLE Open Access Genetic diversity and drug resistance among newly diagnosed and antiretroviral treatmentnaive HIV-infected individuals in western

More information

New technologies reaching the clinic

New technologies reaching the clinic New technologies reaching the clinic Martin Däumer May 31, 2018 Deep-sequencing Standard Sanger-sequencing...PQIYMDDHTRE... Ultra-deep-sequencing...PQIYMDDHTRE......PQIYMDDHTRE......PQIYVDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE...

More information

Midgley, Sofie E; Nielsen, Astrid G; Trebbien, Ramona; Poulsen, Mille Weismann; Andersen, Peter H; Fischer, Thea Kølsen

Midgley, Sofie E; Nielsen, Astrid G; Trebbien, Ramona; Poulsen, Mille Weismann; Andersen, Peter H; Fischer, Thea Kølsen Syddansk Universitet Co-circulation of multiple subtypes of enterovirus A71 (EV- A71) genotype C, including novel recombinants characterised by use of whole genome sequencing (WGS), Denmark 216 Midgley,

More information

Molecular Epidemiology of HIV-1 Subtypes in India: Origin and Evolutionary History of the Predominant Subtype C

Molecular Epidemiology of HIV-1 Subtypes in India: Origin and Evolutionary History of the Predominant Subtype C Molecular Epidemiology of HIV-1 Subtypes in India: Origin and Evolutionary History of the Predominant Subtype C Ujjwal Neogi 1,2 *, Irene Bontell 1, Anita Shet 3,4, Ayesha De Costa 3, Soham Gupta 2, Vishal

More information

Inter-compartment recombination of HIV-1 contributes to env intra-host diversity and modulates viral tropism and senstivity to entry inhibitors

Inter-compartment recombination of HIV-1 contributes to env intra-host diversity and modulates viral tropism and senstivity to entry inhibitors JVI Accepts, published online ahead of print on 6 April 2011 J. Virol. doi:10.1128/jvi.00131-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

HIV 1 Preventive Vaccine Regimen. Community based Trial in Thailand V 144. for the MOPH TAVEG Collaboration

HIV 1 Preventive Vaccine Regimen. Community based Trial in Thailand V 144. for the MOPH TAVEG Collaboration V ALVAC HIV and AIDSVAX B/E Prime Boost HIV 1 Preventive Vaccine Regimen Final Results of the Phase III Community based Trial in Thailand Supachai Rerks Ngarm, Punnee Pittisutthithum, Sorachai Nitayaphan,

More information

HIV and drug resistance Simon Collins UK-CAB 1 May 2009

HIV and drug resistance Simon Collins UK-CAB 1 May 2009 HIV and drug resistance Simon Collins UK-CAB 1 May 2009 slides: thanks to Prof Clive Loveday, Intl. Clinical Virology Centre www.icvc.org.uk Tip of the iceberg = HIV result, CD4, VL Introduction: resistance

More information

A new human immunodeficiency virus derived from gorillas

A new human immunodeficiency virus derived from gorillas A new human immunodeficiency virus derived from gorillas Jean-Christophe Plantier, Marie Leoz, Jonathan E Dickerson, Fabienne De Oliveira, François Cordonnier, Véronique Lemée, Florence Damond, David L

More information

Characterization of a new circulating recombinant form comprising HIV-1 subtypes C and B in southern Brazil

Characterization of a new circulating recombinant form comprising HIV-1 subtypes C and B in southern Brazil Characterization of a new circulating recombinant form comprising HIV-1 subtypes C and B in southern Brazil André F. Santos a, Thatiana M. Sousa a, Esmeralda A.J.M. Soares a, Sabri Sanabani b, Ana M.B.

More information

HIV Neutralization Assays: p24 PBMC Assays as Compared with the Pseudovirus (TZM-bl) Assay Using Multiple HIV-1 Subtypes

HIV Neutralization Assays: p24 PBMC Assays as Compared with the Pseudovirus (TZM-bl) Assay Using Multiple HIV-1 Subtypes HIV Neutralization Assays: p24 PBMC Assays as Compared with the Pseudovirus (TZM-bl) Assay Using Multiple HIV-1 Subtypes Vicky Polonis The USMHRP: Walter Reed Institute of Research and The Henry M. Jackson

More information

Prevalence of different HIV-1 subtypes in sexual transmission in China: a systematic review and meta-analysis

Prevalence of different HIV-1 subtypes in sexual transmission in China: a systematic review and meta-analysis Epidemiol. Infect. (2016), 144, 2144 2153. Cambridge University Press 2016 doi:10.1017/s0950268816000212 Prevalence of different HIV-1 subtypes in sexual transmission in China: a systematic review and

More information

CBER update and International Collaboration for development of HIV variant panels

CBER update and International Collaboration for development of HIV variant panels CBER update and International Collaboration for development of HIV variant panels Indira K. Hewlett, Ph.D Chief, Laboratory of Molecular Virology DETTD/CBER/FDA XXII SoGAT meeting HIV genetic diversity:

More information

ELIMINATION OF VIRAL HEPATITIS IN ROMANIA LESSONS LEARNT AND THE WAY FORWARD

ELIMINATION OF VIRAL HEPATITIS IN ROMANIA LESSONS LEARNT AND THE WAY FORWARD ELIMINATION OF VIRAL HEPATITIS IN ROMANIA LESSONS LEARNT AND THE WAY FORWARD 17 May 2018 Bucharest, Romania Organisers Associations Collaborating on Hepatitis to Immunize and Eliminate the Viruses in Europe

More information

To test the possible source of the HBV infection outside the study family, we searched the Genbank

To test the possible source of the HBV infection outside the study family, we searched the Genbank Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),

More information

HIV Life Cycle & Genetics

HIV Life Cycle & Genetics HIV Life Cycle & enetics! etroviruses (and transposable elements) appear to be part of every cell's genome! From bacteria to yeast, flies, fish, and humans! ome endogenous retroviruses (most notably in

More information

Tiered Categorization of a Diverse Panel of HIV-1 Env Pseudoviruses for Assessment of Neutralizing Antibodies

Tiered Categorization of a Diverse Panel of HIV-1 Env Pseudoviruses for Assessment of Neutralizing Antibodies JOURNAL OF VIROLOGY, Feb. 2010, p. 1439 1452 Vol. 84, No. 3 0022-538X/10/$12.00 doi:10.1128/jvi.02108-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Tiered Categorization of

More information

Original article Universal profiling of HIV-1 pol for genotypic study and resistance analysis across subtypes

Original article Universal profiling of HIV-1 pol for genotypic study and resistance analysis across subtypes Antiviral Therapy 2011; 16:1267 1275 (doi: 10.3851/IMP1892) Original article Universal profiling of HIV-1 pol for genotypic study and resistance analysis across subtypes Ting Nie 1, Mervi Detorio 1, Raymond

More information

Under the Radar Screen: How Bugs Trick Our Immune Defenses

Under the Radar Screen: How Bugs Trick Our Immune Defenses Under the Radar Screen: How Bugs Trick Our Immune Defenses Session 7: Cytokines Marie-Eve Paquet and Gijsbert Grotenbreg Whitehead Institute for Biomedical Research HHV-8 Discovered in the 1980 s at the

More information

Analysis of HIV-1 Resistance Mutations from various Compartments of the Peripheral Blood in Patients with Low-Level Viremia

Analysis of HIV-1 Resistance Mutations from various Compartments of the Peripheral Blood in Patients with Low-Level Viremia Andrea Freystetter / Christian Paar / Herbert Stekel / Jörg Berg Analysis of HIV-1 Resistance Mutations from various Compartments of the Peripheral Blood in Patients with Low-Level Viremia 107 - Translationale

More information

Extremely rapid spread of HIV-1 BF recombinants. in Argentina ACCEPTED. Laboratorio de Biología Celular y Retrovirus-CONICET,

Extremely rapid spread of HIV-1 BF recombinants. in Argentina ACCEPTED. Laboratorio de Biología Celular y Retrovirus-CONICET, JVI Accepts, published online ahead of print on October 00 J. Virol. doi:0./jvi.00-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 0 0 Extremely

More information

Improvement of the jphmm approach to recombination detection in viral genomes and its application to HIV and HBV

Improvement of the jphmm approach to recombination detection in viral genomes and its application to HIV and HBV Improvement of the jphmm approach to recombination detection in viral genomes and its application to HIV and HBV Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultäten

More information

H CAHPS Results for End of Sept 2010 Dec 2010

H CAHPS Results for End of Sept 2010 Dec 2010 H CAHPS Results for End of Sept 2010 Dec 2010 34 patients to be contacted 23 successfully contacted 11 could not be reached (never answered phone) Note: Intracranial pts and non elective admissions excluded

More information

Racial/Ethnic Disparities in Second Breast Lesions after DCIS. Graham A. Colditz, MD DrPH Kevin Garza Ying Liu, MD PhD Rosy Luo, PhD Yu Tao, PhD

Racial/Ethnic Disparities in Second Breast Lesions after DCIS. Graham A. Colditz, MD DrPH Kevin Garza Ying Liu, MD PhD Rosy Luo, PhD Yu Tao, PhD Racial/Ethnic Disparities in Second Breast Lesions after DCIS Graham A. Colditz, MD DrPH Kevin Garza Ying Liu, MD PhD Rosy Luo, PhD Yu Tao, PhD Why DCIS? DCIS over 45,000 cases per year SEER 18 Cancer

More information

Temporal and Spatial Dynamics of Human Immunodeficiency Virus Type 1 Circulating Recombinant Forms 08_BC and 07_BC in Asia

Temporal and Spatial Dynamics of Human Immunodeficiency Virus Type 1 Circulating Recombinant Forms 08_BC and 07_BC in Asia JOURNAL OF VIROLOGY, Sept. 2008, p. 9206 9215 Vol. 82, No. 18 0022-538X/08/$08.00 0 doi:10.1128/jvi.00399-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. Temporal and Spatial

More information

Divergent Evolution of Norovirus GII/4 by Genome Recombination from May 2006 to February 2009 in Japan

Divergent Evolution of Norovirus GII/4 by Genome Recombination from May 2006 to February 2009 in Japan JOURNAL OF VIROLOGY, Aug. 2010, p. 8085 8097 Vol. 84, No. 16 0022-538X/10/$12.00 doi:10.1128/jvi.02125-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Divergent Evolution of

More information

Selection on the Human Immunodeficiency Virus Type 1 Proteome following Primary Infection

Selection on the Human Immunodeficiency Virus Type 1 Proteome following Primary Infection JOURNAL OF VIROLOGY, Oct. 2006, p. 9519 9529 Vol. 80, No. 19 0022-538X/06/$08.00 0 doi:10.1128/jvi.00575-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Selection on the Human

More information

Julius M. Nwobegahay 1, Pascal O. Bessong 1, Tracy M. Masebe 1, Lufuno G. Mavhandu 1, Benson C. Iweriebor 1, and Gloria Selabe 2 ABSTRACT INTRODUCTION

Julius M. Nwobegahay 1, Pascal O. Bessong 1, Tracy M. Masebe 1, Lufuno G. Mavhandu 1, Benson C. Iweriebor 1, and Gloria Selabe 2 ABSTRACT INTRODUCTION J HEALTH POPUL NUTR 2011 Aug;29(4):303-309 ISSN 1606-0997 $ 5.00+0.20 INTERNATIONAL CENTRE FOR DIARRHOEAL DISEASE RESEARCH, BANGLADESH Prevalence of Antiretroviral Drug Resistance Mutations and HIV-1 Subtypes

More information

Received 30 January 2002/Accepted 10 May 2002

Received 30 January 2002/Accepted 10 May 2002 JOURNAL OF VIROLOGY, Aug. 2002, p. 8298 8309 Vol. 76, No. 16 0022-538X/02/$04.00 0 DOI: 10.1128/JVI.76.16.8298 8309.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Characterization

More information

Characterization of Hepatitis B Virus (HBV) Among Liver Patients in Kenya

Characterization of Hepatitis B Virus (HBV) Among Liver Patients in Kenya Characterization of Hepatitis B Virus (HBV) Among Liver Patients in Kenya By MISSIANI OCHWOTO (Medical Research officer, KEMRI) Julius Oyugi 2, Dufton Mwaengo 2, James Kimotho 1 Carla Osiowy 3 and Elijah

More information

An Analysis of Genital Tract Derived HIV from Heterosexual Transmission Pairs. Debrah Boeras Emory University October 14, 2008

An Analysis of Genital Tract Derived HIV from Heterosexual Transmission Pairs. Debrah Boeras Emory University October 14, 2008 An Analysis of Genital Tract Derived HIV from Heterosexual Transmission Pairs Debrah Boeras Emory University October 14, 2008 Background A majority of HIV-1 infections occur through heterosexual exposure

More information

Host Double Strand Break Repair Generates HIV-1 Strains Resistant to CRISPR/Cas9

Host Double Strand Break Repair Generates HIV-1 Strains Resistant to CRISPR/Cas9 Host Double Strand Break Repair Generates HIV-1 Strains Resistant to CRISPR/Cas9 Kristine E. Yoder, a * and Ralf Bundschuh b a Department of Molecular Virology, Immunology and Medical Genetics, Center

More information

Transmission of integrase resistance HIV

Transmission of integrase resistance HIV Transmission of integrase resistance HIV Charles Boucher, MD, PhD Clinical Virology, Dept. Viroscience, Erasmus Medical Center, Erasmus Universiy, The Netherlands Major resistance mutations (Stanford)

More information

Affordable tests for HIV drug resistance and HIV viral load in Africa Prof Tobias Rinke de Wit

Affordable tests for HIV drug resistance and HIV viral load in Africa Prof Tobias Rinke de Wit Affordable tests for HIV drug resistance and HIV viral load in Africa Prof Tobias Rinke de Wit 6 th INTEREST Workshop Mombasa, Kenya, May 8-11, 2012 The roll-out of ART in resource poor settings has followed

More information

aV (modules 1 and 9 are required)

aV (modules 1 and 9 are required) This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). For guidance, see the notes written in blue and the

More information

Detection of HEV in Estonia. Anna Ivanova, Irina Golovljova, Valentina Tefanova

Detection of HEV in Estonia. Anna Ivanova, Irina Golovljova, Valentina Tefanova Detection of HEV in Estonia Anna Ivanova, Irina Golovljova, Valentina Tefanova National Institute for Health Development Department of Virology Zoonotic pathogens Tick-borne pathogens: TBEV, Borrelia sp.,

More information

Molecular Epidemiology of Hepatitis C virus in Prishtina region of Kosovo

Molecular Epidemiology of Hepatitis C virus in Prishtina region of Kosovo UNIVERSITY OF ZAGREB SCHOOL OF MEDICINE Xhevat Jakupi Molecular Epidemiology of Hepatitis C virus in Prishtina region of Kosovo DISSERTATION Zagreb, 2018 UNIVERSITY OF ZAGREB SCHOOL OF MEDICINE Xhevat

More information

ISBT WP-TTID Annual Report for Subgroup on Virology Drs. Michael Busch, Kurt Roth and Susan Stramer

ISBT WP-TTID Annual Report for Subgroup on Virology Drs. Michael Busch, Kurt Roth and Susan Stramer ISBT WP-TTID Annual Report for Subgroup on Virology Drs. Michael Busch, Kurt Roth and Susan Stramer Questionnaire on NAT Screening of Blood Donations for an International Forum on 10 years of NAT Screening

More information

The PTAP sequence duplication in HIV-1 subtype C Gag p6 in drug-naive subjects of India and South Africa

The PTAP sequence duplication in HIV-1 subtype C Gag p6 in drug-naive subjects of India and South Africa Sharma et al. BMC Infectious Diseases (2017) 17:95 DOI 10.1186/s12879-017-2184-4 RESEARCH ARTICLE The PTAP sequence duplication in HIV-1 subtype C Gag p6 in drug-naive subjects of India and South Africa

More information

Genetic dynamics of HIV-1:

Genetic dynamics of HIV-1: From Microbiology and Tumorbiology Center (MTC), Karolinska Institutet and the Swedish Institute for Infectious Disease Control, Stockholm, Sweden Genetic dynamics of HIV-1: recombination, drug resistance

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the

More information

Notes Testing: Follow Up and Giving Results

Notes Testing: Follow Up and Giving Results As you do more tests it may become impractical to give all results face to face. You need to think of a system for calling in patients with a positive test promptly and without giving the result on the

More information

Sequence determinants of breakpoint location during HIV-1 intersubtype recombination

Sequence determinants of breakpoint location during HIV-1 intersubtype recombination Published online 26 September 2006 Nucleic Acids Research, 2006, Vol. 34, No. 18 5203 5216 doi:10.1093/nar/gkl669 Sequence determinants of breakpoint location during HIV-1 intersubtype recombination Heather

More information

An update on Human Immuno Deficiency Virus/Acquired Immuno Deficiency Syndrome (HIV/AIDS)

An update on Human Immuno Deficiency Virus/Acquired Immuno Deficiency Syndrome (HIV/AIDS) An update on Human Immuno Deficiency Virus/Acquired Immuno Deficiency Syndrome (HIV/AIDS) (July 1, 2010) Ministry of Health Thimphu: Bhutan A. Background Total HIV cases as of December 1, 2009 185 Total

More information

The prevalence of HBV, HCV and malaria parasites among blood donors in Amhara and Tigray regional states

The prevalence of HBV, HCV and malaria parasites among blood donors in Amhara and Tigray regional states Original article The prevalence of HBV, HCV and malaria parasites among blood donors in Amhara and Tigray regional states Baye Gelaw 1,2, Yohannes Mengistu 2 Abstract Background: Blood serves as a vehicle

More information

HIV-1 transmitted drug resistance-associated mutations and mutation co-variation in HIV-1 treatment-naïve MSM from 2011 to 2013 in Beijing, China

HIV-1 transmitted drug resistance-associated mutations and mutation co-variation in HIV-1 treatment-naïve MSM from 2011 to 2013 in Beijing, China Jiao et al. BMC Infectious Diseases 2014, 14:689 RESEARCH ARTICLE Open Access HIV-1 transmitted drug resistance-associated mutations and mutation co-variation in HIV-1 treatment-naïve MSM from 2011 to

More information