Surface plasmon resonance (SPR) analysis

Size: px
Start display at page:

Download "Surface plasmon resonance (SPR) analysis"

Transcription

1 Surface plasmon resonance (SPR) analysis Soluble CD8αα and was manufactured as described previously. 1,2 The C12C heterodimeric TCR was produced using an engineered disulfide bridge between the constant domains of the TCRα and TCRβ chains, which were expressed separately in BL21 Escherichia coli. Inclusion bodies were resuspended in 8M urea, 20mM Tris-HCl ph 8, 0.5mM Na-EDTA and 1mM DTT. The C12C TCR was refolded by flash dilution in a solution containing 5M urea, 100mM Tris ph8, 2mM Na-EDTA, 400mM L-Arginine-HCl, 0.5mM oxidised glutathione and 5mM reduced glutathione. The refolding solution was then dialysed to eliminate the urea, and the resulting protein solution was purified by gel filtration and HiTrap-Q anion exchange chromatography. Soluble biotinylated pmhci monomers were manufactured as described previously 3. Binding analysis was performed by SPR using a BIAcore 3000 TM equipped with a CM5 sensor chip 4. Biotinylated pmhci was immobilized to streptavidin, which was chemically linked to the chip surface; alternatively, soluble C12C TCR was immobilized by 12H8 mab capture on the chip surface. Solid phase analytes were injected at slow flow rates to ensure uniform distribution on the chip surface. For equilibrium analysis, ten serial dilutions of each fluid phase analyte were carefully prepared in duplicate or triplicate and injected over the relevant sensor chips (experimental and control) at 25 C. All proteins were prepared, purified and concentrated on the day of analysis to reduce the likelihood of aggregation affecting the results. Data were analyzed using BIAevaluation 3.1, Microsoft Excel and Origin 6.1. The equilibrium binding constant (K D ) values were calculated using a nonlinear curve fit (y = (P 1 x)/(p 2 + x)). REFERENCES 1. Wooldridge L, van den Berg HA, Glick M, et al. Interaction between the CD8 coreceptor and major histocompatibility complex class I stabilizes T cell receptor-antigen complexes at the cell surface. J Biol Chem. 2005;280(30): Gao GF, Gerth UC, Wyer JR, et al. Assembly and crystallization of the complex between the human T cell coreceptor CD8alpha homodimer and HLA-A2. Protein Sci. 1998;7(5): Price DA, Brenchley JM, Ruff LE, et al. Avidity for antigen shapes clonal dominance in CD8+ T cell populations specific for persistent DNA viruses. J Exp Med. 2005;202(10):

2 4. Wyer JR, Willcox BE, Gao GF, et al. T cell receptor and coreceptor CD8 alphaalpha bind peptide-mhc independently and with distinct kinetics. Immunity. 1999;10(2):

3 Figure S1. Surface plasmon resonance analyses of soluble CD8αα and cognate TCR binding to HLA-B*2705-wt and HLA-B*2705-D227K/T228A proteins refolded with the KK10 peptide A. SPR equilibrium binding of soluble CD8αα to HLA-A*0201-wt, HLA-B*2705-wt, and HLA- B*2705-D227K/T228A. The mean response for each concentration is plotted (n = 3). B. SPR equilibrium binding of a soluble KK10-specific TCR (C12C) to HLA-B*2705-wt and HLA- B*2705-D227K/T228A. The mean response for each concentration is plotted (n = 2). The equilibrium dissociation constant (K D ) values were calculated assuming 1:1 Langmuir binding and plotted using a nonlinear curve fit (y = (P 1 x)/(p 2 + x)). Experimental details are provided in Supplementary Materials and Methods. Figure S2. Genetic coding of KK10-specific TCRβ clonotypes Shown are the observed nucleotide sequences coding for the TRBV4-3/TRBJ1-3 clonotypes, together with the contributions from the TRBV (green), TRBD (orange), and TRBJ (blue) genes that would require the minimum number of nucleotide additions (black). Potential P-additions are underlined. The conserved amino acids in the CASSXGXXXNTIY motif are predominantly germline-encoded. The variable amino acid at position 5 (counting from C) was either a fully germline-encoded glutamine (in 5 of the 15 TRBV4-3/TRBJ1-3 clonotypes) or a proline, the

4 germline-encoding of which was largely dependent on P-additions from the 5 end of the TRBD genes. In many of the TRBV4-3/TRBJ1-3 clonotypes, the variable amino acid at position 7 could be either fully or partially TRBD gene-encoded. The multiple lines per nucleotide sequence display the multiple potential recombination events, i.e. different gene contributions and nucleotide additions, that could produce the observed nucleotide sequences with the minimum number of nucleotide additions. Figure S3. TRBV4-3/TRBJ1-3 clones have high antigen sensitivity levels for wt KK10 (A) wt KK10 sensitivity (EC50 for Cr 51 release) of KK10-specific CD8 + T-cell clones grouped according to TRBV/TRBJ usage. Each symbol represents one clone. (B) Similar results are shown with a threshold limit of antigen sensitivity set at 10-8 M to exclude poorly sensitive clones. Statistical analyses were conducted using the Mann-Whitney U-test with Bonferroni correction for multiple comparisons (P< was considered significant). ** and *** indicate P values <0.01 and <0.001, respectively. Figure S4. Activation of KK10-specific CD8 + T-cell clones by wt or Nef viruses Polyfunctional profiles are shown for one high and one low avidity KK10-specific CD8 + T-cell clone after incubation for 6 hours with primary HLA-B CD4 + T-cells presenting similar levels of p24 expression (i.e. 45% or 46%) at day 3 post-infection with wt or Nef viruses (E:T ratio 10:1).

5 Figure S5. Reactivity of KK10-specific CD8 + T-cell clones for wt or L 268 M peptides EC50 values for HLA B*2705-restricted KK10-specific CD8 + T-cell clones (n=11) were determined in standard chromium release assays using peptide (wt or L268M) titrations and a common antigen presenting HLA-B* B-cell line. Ten clones (C2A, E3A, G11C, G12C, E2C, F9A, G10A, G10H, H8B, H9B) displayed lower AgS levels in response to L 268 M compared to wt KK10; only clone C12C showed the inverse pattern.

6

7

8

9

10

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice

More information

Crystallization-grade After D After V3 cocktail. Time (s) Time (s) Time (s) Time (s) Time (s) Time (s)

Crystallization-grade After D After V3 cocktail. Time (s) Time (s) Time (s) Time (s) Time (s) Time (s) Ligand Type Name 6 Crystallization-grade After 447-52D After V3 cocktail Receptor CD4 Resonance Units 5 1 5 1 5 1 Broadly neutralizing antibodies 2G12 VRC26.9 Resonance Units Resonance Units 3 1 15 1 5

More information

Supplementary Material

Supplementary Material Supplementary Material HLA-DM Captures Partially Empty HLA-DR Molecules for Catalyzed Peptide Removal Anne-Kathrin Anders, Melissa J. Call, Monika-Sarah E. D. Schulze, Kevin D. Fowler, David A. Schuert,

More information

Supplementary Table 1. Data collection and refinement statistics (molecular replacement).

Supplementary Table 1. Data collection and refinement statistics (molecular replacement). Supplementary Table 1. Data collection and refinement statistics (molecular replacement). Data set statistics HLA A*0201- ALWGPDPAAA PPI TCR PPI TCR/A2- ALWGPDPAAA PPI TCR/A2- ALWGPDPAAA Space Group P2

More information

<Supplemental information>

<Supplemental information> The Structural Basis of Endosomal Anchoring of KIF16B Kinesin Nichole R. Blatner, Michael I. Wilson, Cai Lei, Wanjin Hong, Diana Murray, Roger L. Williams, and Wonhwa Cho Protein

More information

Avidity for antigen shapes clonal dominance in CD8 T cell populations specific for persistent DNA viruses

Avidity for antigen shapes clonal dominance in CD8 T cell populations specific for persistent DNA viruses Avidity for antigen shapes clonal dominance in CD8 T cell populations specific for persistent DNA viruses David A. Price, 1 Jason M. Brenchley, 1 Laura E. Ruff, 1 Michael R. Betts, 2 Brenna J. Hill, 1

More information

CD44

CD44 MR1-5-OP-RU CD24 CD24 CD44 MAIT cells 2.78 11.2 WT RORγt- GFP reporter 1 5 1 4 1 3 2.28 1 5 1 4 1 3 4.8 1.6 8.1 1 5 1 4 1 3 1 5 1 4 1 3 3.7 3.21 8.5 61.7 1 2 1 3 1 4 1 5 TCRβ 2 1 1 3 1 4 1 5 CD44 1 2 GFP

More information

T cell recognition. Statistics & Dynamics of Functional Sensitivity

T cell recognition. Statistics & Dynamics of Functional Sensitivity T cell recognition Statistics & Dynamics of Functional Sensitivity C Molina-París LEEDS APPLIED MATHEMATICS G Lythe LEEDS APPLIED MATHEMATICS A K Sewell CARDIFF MEDICAL BIOCHEMISTRY & IMMUNOLOGY L Wooldridge

More information

T Cell Receptor Optimized Peptide Skewing of the T-Cell Repertoire Can Enhance Antigen Targeting

T Cell Receptor Optimized Peptide Skewing of the T-Cell Repertoire Can Enhance Antigen Targeting T Cell Receptor Optimized Peptide Skewing of the T-Cell Repertoire Can Enhance Antigen Targeting Julia Ekeruche-Makinde 1*, Mathew Clement 1*, David K Cole 1*, Emily S J Edwards 1, Kristin Ladell 1, John

More information

Journal of Immunological Methods

Journal of Immunological Methods Journal of Immunological Methods 338 (2008) 31 39 Contents lists available at ScienceDirect Journal of Immunological Methods journal homepage: www.elsevier.com/locate/jim Research paper Detection of low

More information

Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints

Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide

More information

Supplementary Table 1. Functional avidities of survivin-specific T-cell clones against LML-peptide

Supplementary Table 1. Functional avidities of survivin-specific T-cell clones against LML-peptide Supplementary Table 1. Functional avidities of survivin-specific T-cell clones against LML-peptide pulsed T2 cells. clone avidity by 4-hour 51 Cr-release assay 50% lysis at E:T 10:1 [LML peptide, M] #24

More information

SUPPLEMENTAL INFORMATION

SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION EXPERIMENTAL PROCEDURES Tryptic digestion protection experiments - PCSK9 with Ab-3D5 (1:1 molar ratio) in 50 mm Tris, ph 8.0, 150 mm NaCl was incubated overnight at 4 o C. The

More information

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. Schematic of Ras biochemical coupled assay.

More information

Purification of Glucagon3 Interleukin-2 Fusion Protein Derived from E. coli

Purification of Glucagon3 Interleukin-2 Fusion Protein Derived from E. coli Purification of Glucagon3 Interleukin-2 Fusion Protein Derived from E. coli Hye Soon Won Dept. of Chem. Eng. Chungnam National University INTRODUCTION Human interleukin-2(hil-2) - known as T Cell Growth

More information

Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.

Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. Supplementary Figure 1 Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. (a) Modeling of the kinase domain of LCK with ATP (left) or pc-lys

More information

Data are contained in multiple tabs in Excel spreadsheets and in CSV files.

Data are contained in multiple tabs in Excel spreadsheets and in CSV files. Contents Overview Curves Methods Measuring enzymatic activity (figure 2) Enzyme characterisation (Figure S1, S2) Enzyme kinetics (Table 3) Effect of ph on activity (figure 3B) Effect of metals and inhibitors

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity Supplementary Figure 1 Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity (a, b) Fluorescent-based determination of the binding capacity of DNA-barcoded MHC multimers (+barcode)

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression

More information

The Adaptive Immune Response. T-cells

The Adaptive Immune Response. T-cells The Adaptive Immune Response T-cells T Lymphocytes T lymphocytes develop from precursors in the thymus. Mature T cells are found in the blood, where they constitute 60% to 70% of lymphocytes, and in T-cell

More information

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone.

Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. alpha beta ATGCTCCTGCTGCTCGTCCCAGTGCTCGAGGTGATTTTTACTCTGGGAGGAACCAGAGCC CAGTCGGTGACCCAGCTTGACAGCCACGTCTCTGTCTCTGAAGGAACCCCGGTGCTGCTG

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Nair S, Branagan AR, Liu J, Boddupalli CS, Mistry PK, Dhodapkar

More information

In situ drug-receptor binding kinetics in single cells: a quantitative label-free study of anti-tumor drug resistance

In situ drug-receptor binding kinetics in single cells: a quantitative label-free study of anti-tumor drug resistance Supplementary Information for In situ drug-receptor binding kinetics in single cells: a quantitative label-free study of anti-tumor drug resistance Wei Wang 1, Linliang Yin 2,3, Laura Gonzalez-Malerva

More information

Antigen Receptor Structures October 14, Ram Savan

Antigen Receptor Structures October 14, Ram Savan Antigen Receptor Structures October 14, 2016 Ram Savan savanram@uw.edu 441 Lecture #8 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Today): Structural features of the BCR and TCR Janeway Chapter

More information

Tricks with tetramers: how to get the most from multimeric peptide MHC

Tricks with tetramers: how to get the most from multimeric peptide MHC IMMUNOLOGY REVIEW ARTICLE Tricks with tetramers: how to get the most from multimeric peptide MHC Ó 2009 Blackwell Publishing Ltd, Immunology, 126, 147 164 147 L. Wooldridge et al. Linda Wooldridge, 1,

More information

Evidence for antigen-driven TCRβ chain convergence in the tumor infiltrating T cell repertoire

Evidence for antigen-driven TCRβ chain convergence in the tumor infiltrating T cell repertoire Evidence for antigen-driven TCRβ chain convergence in the tumor infiltrating T cell repertoire Geoffrey M. Lowman, PhD Senior Staff Scientist EACR - 02 July 2018 For Research Use Only. Not for use in diagnostic

More information

Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in

Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Fig. 2 Substitution Sequence Position variant Sequence original APNCYGNIPL original APNCYGNIPL

More information

Lecture 6. Burr BIO 4353/6345 HIV/AIDS. Tetramer staining of T cells (CTL s) Andrew McMichael seminar: Background

Lecture 6. Burr BIO 4353/6345 HIV/AIDS. Tetramer staining of T cells (CTL s) Andrew McMichael seminar: Background Lecture 6 Burr BIO 4353/6345 HIV/AIDS Andrew McMichael seminar: Background Tetramer staining of T cells (CTL s) 1. Vβ 19: There are 52 T cell receptor (TCR) Vβ gene segments in germ line DNA (See following

More information

SUPPLEMENTAL DATA. Experimental Procedures

SUPPLEMENTAL DATA. Experimental Procedures SUPPLEMENTAL DATA Experimental Procedures For surface plasmon resonance (SPR) measurements, the setup was similar to a previous study (1). In brief, a gold surface (Au SIA-Kit, GE Healthcare) was carboxylated

More information

Introduction. and Department of Medical Oncology, Dana-Farber Cancer Institute, 77 Avenue Louis Pasteur, Boston, MA 02115, USA

Introduction. and Department of Medical Oncology, Dana-Farber Cancer Institute, 77 Avenue Louis Pasteur, Boston, MA 02115, USA doi:10.1016/j.jmb.2007.06.057 J. Mol. Biol. (2007) 372, 535 548 CTL Recognition of a Protective Immunodominant Influenza A Virus Nucleoprotein Epitope Utilizes a Highly Restricted Vβ but Diverse Vα Repertoire:

More information

Antigen Recognition by T cells

Antigen Recognition by T cells Antigen Recognition by T cells TCR only recognize foreign Ags displayed on cell surface These Ags can derive from pathogens, which replicate within cells or from pathogens or their products that cells

More information

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared

More information

Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood

Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood Antibody-mediated depletion of CD19-CAR T cells Supplemental 1 Supplemental Materials Supplemental Figure 1. Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood cells were

More information

T cell development October 28, Dan Stetson

T cell development October 28, Dan Stetson T cell development October 28, 2016 Dan Stetson stetson@uw.edu 441 Lecture #13 Slide 1 of 29 Three lectures on T cells (Chapters 8, 9) Part 1 (Today): T cell development in the thymus Chapter 8, pages

More information

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 CHRISTOPH RADER, 2 MIKHAIL POPKOV, JOHN A. NEVES, AND CARLOS F. BARBAS III 2 Department of Molecular Biology and The

More information

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood tree illustrating CRF01_AE gp120 protein sequence relationships between 107 Envs sampled in the RV144 trial

More information

Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION

Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION Scott Abrams, Ph.D. Professor of Oncology, x4375 scott.abrams@roswellpark.org Kuby Immunology SEVENTH EDITION CHAPTER 11 T-Cell Activation, Differentiation, and Memory Copyright 2013 by W. H. Freeman and

More information

Structure and Function of Antigen Recognition Molecules

Structure and Function of Antigen Recognition Molecules MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and

More information

Rapid perforin upregulation directly ex vivo by CD8 + T cells is a defining characteristic of HIV elite controllers

Rapid perforin upregulation directly ex vivo by CD8 + T cells is a defining characteristic of HIV elite controllers Rapid perforin upregulation directly ex vivo by CD8 + T cells is a defining characteristic of HIV elite controllers Adam R. Hersperger Department of Microbiology University of Pennsylvania Evidence for

More information

BIOASSAYS IN PRODUCT DEVELOPMENT: An Immuno-Oncology Perspective

BIOASSAYS IN PRODUCT DEVELOPMENT: An Immuno-Oncology Perspective BIOASSAYS IN PRODUCT DEVELOPMENT: An Immuno-Oncology Perspective CASSS Bioassays May 09, 2017 Tara Stauffer 1 Overview Introduction: Cell-based bioassays in IO product development Immuno-Oncology (IO)

More information

Immune surveillance: The immune system can recognize and destroy nascent malignant cells

Immune surveillance: The immune system can recognize and destroy nascent malignant cells Immune surveillance: The immune system can recognize and destroy nascent malignant cells Control Escape APC T C T H B NKT NK Innate Tumor T cells are believed to play a major role in controlling tumor

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated

More information

Luminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells

Luminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2016 Contents Supporting Information Luminescent platforms for monitoring changes in the

More information

Stalking influenza by vaccination with pre-fusion headless HA mini-stem

Stalking influenza by vaccination with pre-fusion headless HA mini-stem Stalking influenza by vaccination with pre-fusion headless HA mini-stem Sophie A Valkenburg a,b, V Vamsee Aditya Mallajosyula c, Olive TW Li b, Alex WH hin b, George arnell d, Nigel Temperton d, Raghavan

More information

a) The statement is true for X = 400, but false for X = 300; b) The statement is true for X = 300, but false for X = 200;

a) The statement is true for X = 400, but false for X = 300; b) The statement is true for X = 300, but false for X = 200; 1. Consider the following statement. To produce one molecule of each possible kind of polypeptide chain, X amino acids in length, would require more atoms than exist in the universe. Given the size of

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray

More information

Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random

Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:

More information

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared

More information

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.

More information

Nature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA.

Nature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA. Supplementary Figure 1 Fluorescent titration of probe CPDSA. Fluorescent titration of probe CPDSA (10 um) upon addition of GSH in HEPES (10 mm, ph = 7.4) containing 10% DMSO. Each spectrum was recorded

More information

The CD8 T Cell Coreceptor Exhibits Disproportionate Biological Activity at Extremely Low Binding Affinities*

The CD8 T Cell Coreceptor Exhibits Disproportionate Biological Activity at Extremely Low Binding Affinities* THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 27, Issue of July 4, pp. 24285 24293, 2003 Printed in U.S.A. The CD8 T Cell Coreceptor Exhibits Disproportionate Biological Activity at Extremely Low Binding

More information

The T cell receptor for MHC-associated peptide antigens

The T cell receptor for MHC-associated peptide antigens 1 The T cell receptor for MHC-associated peptide antigens T lymphocytes have a dual specificity: they recognize polymporphic residues of self MHC molecules, and they also recognize residues of peptide

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Johnson DB, Balko JM, Compton ML, et al. Fulminant myocarditis

More information

A mechanism for glycoconjugate vaccine activation of the adaptive immune system and its implications for vaccine design

A mechanism for glycoconjugate vaccine activation of the adaptive immune system and its implications for vaccine design A mechanism for glycoconjugate vaccine activation of the adaptive immune system and its implications for vaccine design Fikri Y. Avci 1,2, Xiangming Li 3, Moriya Tsuji 3, Dennis L. Kasper 1,2* Supplementary

More information

Incomplete immune response to Coxsackie B viruses. associates with early autoimmunity against insulin

Incomplete immune response to Coxsackie B viruses. associates with early autoimmunity against insulin Incomplete immune response to Coxsackie B viruses associates with early autoimmunity against insulin Michelle P. Ashton 1, Anne Eugster 1, Denise Walther 1, Natalie Daehling 1, Stephanie Riethausen 2,

More information

Supplementary Information

Supplementary Information Supplementary Information Two common structural motifs for TCR recognition by staphylococcal enterotoxins Karin Erica Johanna Rödström 1, Paulina Regenthal 1, Christopher Bahl 2, Alex Ford 2, David Baker

More information

T Cell Development II: Positive and Negative Selection

T Cell Development II: Positive and Negative Selection T Cell Development II: Positive and Negative Selection 8 88 The two phases of thymic development: - production of T cell receptors for antigen, by rearrangement of the TCR genes CD4 - selection of T cells

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 A β-strand positions consistently places the residues at CDR3β P6 and P7 within human and mouse TCR-peptide-MHC interfaces. (a) E8 TCR containing V β 13*06 carrying with an 11mer

More information

Significance of the MHC

Significance of the MHC CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

More information

and Jamie Rossjohn 1,2,4 *

and Jamie Rossjohn 1,2,4 * Understanding the drivers of MHC restriction of T cell receptors Nicole L. La Gruta 1,2 *, Stephanie Gras 1,2, Stephen R. Daley 1, Paul G. Thomas 3 and Jamie Rossjohn 1,2,4 * Abstract T cell discrimination

More information

Supporting information (protein purification, kinetic characterization, product isolation, and characterization by NMR and mass spectrometry):

Supporting information (protein purification, kinetic characterization, product isolation, and characterization by NMR and mass spectrometry): Supporting Information Mechanistic studies of a novel C-S lyase in ergothioneine biosynthesis: the involvement of a sulfenic acid intermediate Heng Song, 1 Wen Hu, 1,2 Nathchar Naowarojna, 1 Ampon Sae

More information

Significance of the MHC

Significance of the MHC CHAPTER 8 Major Histocompatibility Complex (MHC) What is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) - MHC molecules were initially discovered during studies aimed

More information

White Blood Cells (WBCs)

White Blood Cells (WBCs) YOUR ACTIVE IMMUNE DEFENSES 1 ADAPTIVE IMMUNE RESPONSE 2! Innate Immunity - invariant (generalized) - early, limited specificity - the first line of defense 1. Barriers - skin, tears 2. Phagocytes - neutrophils,

More information

High-Throughput Sequencing of Islet-Infiltrating Memory CD4 + T Cells Reveals a Similar Pattern of TCR Vb Usage in Prediabetic and Diabetic NOD Mice

High-Throughput Sequencing of Islet-Infiltrating Memory CD4 + T Cells Reveals a Similar Pattern of TCR Vb Usage in Prediabetic and Diabetic NOD Mice High-Throughput Sequencing of Islet-Infiltrating Memory CD4 + T Cells Reveals a Similar Pattern of TCR Vb Usage in Prediabetic and Diabetic NOD Mice Idania Marrero 1 *, David E. Hamm 2, Joanna D. Davies

More information

Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA ELISA Pair Set

Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA ELISA Pair Set Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK40103 To achieve the best assay results, this manual must be read carefully before using this product and the assay

More information

Immunology - Lecture 2 Adaptive Immune System 1

Immunology - Lecture 2 Adaptive Immune System 1 Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers

More information

The Different Folding Behavior of Insulin and Insulin-like Growth Factor 1 Is Mainly Controlled by Their B-Chain/Domain

The Different Folding Behavior of Insulin and Insulin-like Growth Factor 1 Is Mainly Controlled by Their B-Chain/Domain 1556 Biochemistry 2002, 41, 1556-1567 The Different Folding Behavior of Insulin and Insulin-like Growth Factor 1 Is Mainly Controlled by Their B-Chain/Domain Zhan-Yun Guo, Lu Shen, and You-Min Feng* State

More information

Chemical Nature of the Amino Acids. Table of a-amino Acids Found in Proteins

Chemical Nature of the Amino Acids. Table of a-amino Acids Found in Proteins Chemical Nature of the Amino Acids All peptides and polypeptides are polymers of alpha-amino acids. There are 20 a- amino acids that are relevant to the make-up of mammalian proteins (see below). Several

More information

Multiple-Choice Questions Answer ALL 20 multiple-choice questions on the Scantron Card in PENCIL

Multiple-Choice Questions Answer ALL 20 multiple-choice questions on the Scantron Card in PENCIL Multiple-Choice Questions Answer ALL 20 multiple-choice questions on the Scantron Card in PENCIL For Questions 1-10 choose ONE INCORRECT answer. 1. Which ONE of the following statements concerning the

More information

Introduction. Introduction. Lymphocyte development (maturation)

Introduction. Introduction. Lymphocyte development (maturation) Introduction Abbas Chapter 8: Lymphocyte Development and the Rearrangement and Expression of Antigen Receptor Genes Christina Ciaccio, MD Children s Mercy Hospital January 5, 2009 Lymphocyte development

More information

A TCRα framework centered codon shapes a biased T cell repertoire through direct MHC and CDR3β interactions

A TCRα framework centered codon shapes a biased T cell repertoire through direct MHC and CDR3β interactions A TCRα framework centered codon shapes a biased T cell repertoire through direct MHC and CDR3β interactions Kristin Støen Gunnarsen, 1,2 Lene Støkken Høydahl, 1,2 Louise Fremgaard Risnes, 1 Shiva Dahal-Koirala,

More information

Supplementary Information

Supplementary Information Supplementary Information Vedolizumab is associated with changes in innate rather than adaptive immunity in patients with inflammatory bowel disease Sebastian Zeissig, Elisa Rosati, C. Marie Dowds, Konrad

More information

Recombinant Trypsin, Animal Origin Free

Recombinant Trypsin, Animal Origin Free Recombinant Trypsin, Animal Origin Free PRODUCT INFORMATION: BioGenomics r-trypsin powder is ready to use, animal origin free optimized for cell culture applications. It is derived by r-dna technology.

More information

Chapter 8. Interaction between the phosphatidylinositol 3- kinase SH3 domain and a photocleavable cyclic peptide

Chapter 8. Interaction between the phosphatidylinositol 3- kinase SH3 domain and a photocleavable cyclic peptide Interaction between the phosphatidylinositol 3- kinase SH3 domain and a photocleavable cyclic peptide 129 Abstract The interaction of the PI3K SH3 domain with a cyclic photocleavable peptide and the linear

More information

the HLA complex Hanna Mustaniemi,

the HLA complex Hanna Mustaniemi, the HLA complex Hanna Mustaniemi, 28.11.2007 The Major Histocompatibility Complex Major histocompatibility complex (MHC) is a gene region found in nearly all vertebrates encodes proteins with important

More information

HBsAg, HBsAg. Tris - HCl, 200 mmol/ L NaCl, ph ml Amp 100 mg/ L, 4-5 h, [pqe - scfv] Kana 25 mg/ L 2 YT,37, 111 pqe - scfv

HBsAg, HBsAg. Tris - HCl, 200 mmol/ L NaCl, ph ml Amp 100 mg/ L, 4-5 h, [pqe - scfv] Kana 25 mg/ L 2 YT,37, 111 pqe - scfv Chinese Journal of Pathophysiology 2002,18 (9) :1069-1073 1069 [ ] 1000-4718 (2002) 09-1069 - 05 HBsAg 3 1, 2, 1, 2, 2, 2, 2, 1 ( 1, 510640 ; 2 458, 510602) [ ] :6 His, :,, 3 ;, :, (61108 1145) % ; (2130

More information

Objective: You will be able to explain how the subcomponents of

Objective: You will be able to explain how the subcomponents of Objective: You will be able to explain how the subcomponents of nucleic acids determine the properties of that polymer. Do Now: Read the first two paragraphs from enduring understanding 4.A Essential knowledge:

More information

Section 1 Proteins and Proteomics

Section 1 Proteins and Proteomics Section 1 Proteins and Proteomics Learning Objectives At the end of this assignment, you should be able to: 1. Draw the chemical structure of an amino acid and small peptide. 2. Describe the difference

More information

Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB

Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB Bindu L. Raveendra, 1,5 Ansgar B. Siemer, 2,6 Sathyanarayanan V. Puthanveettil, 1,3,7 Wayne A. Hendrickson,

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Workflow of CDR3 sequence assembly from RNA-seq data.

Nature Genetics: doi: /ng Supplementary Figure 1. Workflow of CDR3 sequence assembly from RNA-seq data. Supplementary Figure 1 Workflow of CDR3 sequence assembly from RNA-seq data. Paired-end short-read RNA-seq data were mapped to human reference genome hg19, and unmapped reads in the TCR regions were extracted

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from

More information

How T cells recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do? Monoclonal antibody approach

How T cells recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do? Monoclonal antibody approach How T cells recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do By the early 1980s, much about T cell function was known, but the receptor genes had not been identified

More information

A second type of TCR TCR: An αβ heterodimer

A second type of TCR TCR: An αβ heterodimer How s recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do By the early 1980s, much about function was known, but the receptor genes had not been identified Recall

More information

Insulin SEC analysis. Insulin Samples:

Insulin SEC analysis. Insulin Samples: EE1 Insulin SEC analysis Insulin Samples: Lispro, identical in structure to Insulin Human, except that it has lysine and proline at positions 8 and 9, respectively, of chain B, whereas this sequence is

More information

Principles of Adaptive Immunity

Principles of Adaptive Immunity Principles of Adaptive Immunity Chapter 3 Parham Hans de Haard 17 th of May 2010 Agenda Recognition molecules of adaptive immune system Features adaptive immune system Immunoglobulins and T-cell receptors

More information

Comparison of Biochemical Properties of the Original. and Newly Identified Oleate Hydratases from

Comparison of Biochemical Properties of the Original. and Newly Identified Oleate Hydratases from Comparison of Biochemical Properties of the Original and Newly Identified Oleate Hydratases from Stenotrophomonas maltophilia Woo-Ri Kang, a Min-Ju Seo, a Kyung-Chul Shin, a Jin-Byung Park, b Deok-Kun

More information

Significance of the MHC

Significance of the MHC CHAPTER 8 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ

More information

Agilent Technologies Prep LC Columns

Agilent Technologies Prep LC Columns Agilent Technologies Prep LC Columns Agilent Technologies Prep LC Columns Agilent Technologies has always taken seriously its responsibility to ensure your success. That s why all our instruments and supplies

More information

Supplementary Figure 1. Comparative analysis of thermal denaturation of enzymatically

Supplementary Figure 1. Comparative analysis of thermal denaturation of enzymatically Supplementary Figures Supplementary Figure 1. Comparative analysis of thermal denaturation of enzymatically synthesized polyubiquitin chains of different length. a, Differential scanning calorimetry traces

More information

A rt i c l e s Nature America, Inc. All rights reserved.

A rt i c l e s Nature America, Inc. All rights reserved. Structural basis for the killing of human beta cells by CD8 + T cells in type 1 diabetes Anna M Bulek 1,9, David K Cole 1,9, Ania Skowera 2,3,9, Garry Dolton 1, Stephanie Gras 4, Florian Madura 1, Anna

More information

MHC Tetramers and Monomers for Immuno-Oncology and Autoimmunity Drug Discovery

MHC Tetramers and Monomers for Immuno-Oncology and Autoimmunity Drug Discovery MHC Tetramers and Monomers for Immuno-Oncology and Autoimmunity Drug Discovery Your Partner in Drug Discovery and Research MHC Tetramer Background T-Cell Receptors recognize and bind to complexes composed

More information

SensoLyte Generic MMP Assay Kit *Colorimetric*

SensoLyte Generic MMP Assay Kit *Colorimetric* SensoLyte Generic MMP Assay Kit *Colorimetric* Revision#1.2 Catalog # Kit Size Last updated: May2017 AS-72095 100 Assays (96-well plate) Optimized Performance: This kit is optimized to detect MMP activity

More information

Major Histocompatibility Complex (MHC) and T Cell Receptors

Major Histocompatibility Complex (MHC) and T Cell Receptors Major Histocompatibility Complex (MHC) and T Cell Receptors Historical Background Genes in the MHC were first identified as being important genes in rejection of transplanted tissues Genes within the MHC

More information

Immunocore Ltd isbtc Washington 30 th October 2009

Immunocore Ltd isbtc Washington 30 th October 2009 Ltd isbtc Washington 30 th October 2009 Bent Jakobsen Chief Scientific Officer Breaking immune tolerance to cancer The immune system has more cytotoxic potential and versatility than can be achieved with

More information

Anti-coreceptor antibodies profoundly affect staining with peptide-mhc class I and class II tetramers

Anti-coreceptor antibodies profoundly affect staining with peptide-mhc class I and class II tetramers Eur. J. Immunol. 2006. 36: 1847 1855 Molecular immunology 1847 Molecular immunology Anti-coreceptor antibodies profoundly affect staining with peptide-mhc class I and class II tetramers Linda Wooldridge*

More information

Transcript-indexed ATAC-seq for immune profiling

Transcript-indexed ATAC-seq for immune profiling Transcript-indexed ATAC-seq for immune profiling Technical Journal Club 22 nd of May 2018 Christina Müller Nature Methods, Vol.10 No.12, 2013 Nature Biotechnology, Vol.32 No.7, 2014 Nature Medicine, Vol.24,

More information

OxisResearch A Division of OXIS Health Products, Inc.

OxisResearch A Division of OXIS Health Products, Inc. OxisResearch A Division of OXIS Health Products, Inc. BIOXYTECH pl GPx Enzyme Immunoassay Assay for Human Plasma Glutathione Peroxidase For Research Use Only. Not For Use In Diagnostic Procedures. Catalog

More information

Biology Open (2014) 000, 1 10 doi: /bio

Biology Open (2014) 000, 1 10 doi: /bio (2014) 000, 1 10 doi:10.1242/bio.201410041 Supplementary Material Michael Brauchle et al. doi: 10.1242/bio.201410041 Fig. S1. Alignment of GFP, sfgfp, egfp, eyfp, mcherry and mruby2. Sequence-based alignment

More information

COURSE: Medical Microbiology, MBIM 650/720 - Fall TOPIC: Antigen Processing, MHC Restriction, & Role of Thymus Lecture 12

COURSE: Medical Microbiology, MBIM 650/720 - Fall TOPIC: Antigen Processing, MHC Restriction, & Role of Thymus Lecture 12 COURSE: Medical Microbiology, MBIM 650/720 - Fall 2008 TOPIC: Antigen Processing, MHC Restriction, & Role of Thymus Lecture 12 FACULTY: Dr. Mayer Office: Bldg. #1, Rm B32 Phone: 733-3281 Email: MAYER@MED.SC.EDU

More information

RAISON D ETRE OF THE IMMUNE SYSTEM:

RAISON D ETRE OF THE IMMUNE SYSTEM: RAISON D ETRE OF THE IMMUNE SYSTEM: To Distinguish Self from Non-Self Thereby Protecting Us From Our Hostile Environment. Innate Immunity Adaptive Immunity Innate immunity: (Antigen - nonspecific) defense

More information