Surface plasmon resonance (SPR) analysis
|
|
- Miles Gibson
- 5 years ago
- Views:
Transcription
1 Surface plasmon resonance (SPR) analysis Soluble CD8αα and was manufactured as described previously. 1,2 The C12C heterodimeric TCR was produced using an engineered disulfide bridge between the constant domains of the TCRα and TCRβ chains, which were expressed separately in BL21 Escherichia coli. Inclusion bodies were resuspended in 8M urea, 20mM Tris-HCl ph 8, 0.5mM Na-EDTA and 1mM DTT. The C12C TCR was refolded by flash dilution in a solution containing 5M urea, 100mM Tris ph8, 2mM Na-EDTA, 400mM L-Arginine-HCl, 0.5mM oxidised glutathione and 5mM reduced glutathione. The refolding solution was then dialysed to eliminate the urea, and the resulting protein solution was purified by gel filtration and HiTrap-Q anion exchange chromatography. Soluble biotinylated pmhci monomers were manufactured as described previously 3. Binding analysis was performed by SPR using a BIAcore 3000 TM equipped with a CM5 sensor chip 4. Biotinylated pmhci was immobilized to streptavidin, which was chemically linked to the chip surface; alternatively, soluble C12C TCR was immobilized by 12H8 mab capture on the chip surface. Solid phase analytes were injected at slow flow rates to ensure uniform distribution on the chip surface. For equilibrium analysis, ten serial dilutions of each fluid phase analyte were carefully prepared in duplicate or triplicate and injected over the relevant sensor chips (experimental and control) at 25 C. All proteins were prepared, purified and concentrated on the day of analysis to reduce the likelihood of aggregation affecting the results. Data were analyzed using BIAevaluation 3.1, Microsoft Excel and Origin 6.1. The equilibrium binding constant (K D ) values were calculated using a nonlinear curve fit (y = (P 1 x)/(p 2 + x)). REFERENCES 1. Wooldridge L, van den Berg HA, Glick M, et al. Interaction between the CD8 coreceptor and major histocompatibility complex class I stabilizes T cell receptor-antigen complexes at the cell surface. J Biol Chem. 2005;280(30): Gao GF, Gerth UC, Wyer JR, et al. Assembly and crystallization of the complex between the human T cell coreceptor CD8alpha homodimer and HLA-A2. Protein Sci. 1998;7(5): Price DA, Brenchley JM, Ruff LE, et al. Avidity for antigen shapes clonal dominance in CD8+ T cell populations specific for persistent DNA viruses. J Exp Med. 2005;202(10):
2 4. Wyer JR, Willcox BE, Gao GF, et al. T cell receptor and coreceptor CD8 alphaalpha bind peptide-mhc independently and with distinct kinetics. Immunity. 1999;10(2):
3 Figure S1. Surface plasmon resonance analyses of soluble CD8αα and cognate TCR binding to HLA-B*2705-wt and HLA-B*2705-D227K/T228A proteins refolded with the KK10 peptide A. SPR equilibrium binding of soluble CD8αα to HLA-A*0201-wt, HLA-B*2705-wt, and HLA- B*2705-D227K/T228A. The mean response for each concentration is plotted (n = 3). B. SPR equilibrium binding of a soluble KK10-specific TCR (C12C) to HLA-B*2705-wt and HLA- B*2705-D227K/T228A. The mean response for each concentration is plotted (n = 2). The equilibrium dissociation constant (K D ) values were calculated assuming 1:1 Langmuir binding and plotted using a nonlinear curve fit (y = (P 1 x)/(p 2 + x)). Experimental details are provided in Supplementary Materials and Methods. Figure S2. Genetic coding of KK10-specific TCRβ clonotypes Shown are the observed nucleotide sequences coding for the TRBV4-3/TRBJ1-3 clonotypes, together with the contributions from the TRBV (green), TRBD (orange), and TRBJ (blue) genes that would require the minimum number of nucleotide additions (black). Potential P-additions are underlined. The conserved amino acids in the CASSXGXXXNTIY motif are predominantly germline-encoded. The variable amino acid at position 5 (counting from C) was either a fully germline-encoded glutamine (in 5 of the 15 TRBV4-3/TRBJ1-3 clonotypes) or a proline, the
4 germline-encoding of which was largely dependent on P-additions from the 5 end of the TRBD genes. In many of the TRBV4-3/TRBJ1-3 clonotypes, the variable amino acid at position 7 could be either fully or partially TRBD gene-encoded. The multiple lines per nucleotide sequence display the multiple potential recombination events, i.e. different gene contributions and nucleotide additions, that could produce the observed nucleotide sequences with the minimum number of nucleotide additions. Figure S3. TRBV4-3/TRBJ1-3 clones have high antigen sensitivity levels for wt KK10 (A) wt KK10 sensitivity (EC50 for Cr 51 release) of KK10-specific CD8 + T-cell clones grouped according to TRBV/TRBJ usage. Each symbol represents one clone. (B) Similar results are shown with a threshold limit of antigen sensitivity set at 10-8 M to exclude poorly sensitive clones. Statistical analyses were conducted using the Mann-Whitney U-test with Bonferroni correction for multiple comparisons (P< was considered significant). ** and *** indicate P values <0.01 and <0.001, respectively. Figure S4. Activation of KK10-specific CD8 + T-cell clones by wt or Nef viruses Polyfunctional profiles are shown for one high and one low avidity KK10-specific CD8 + T-cell clone after incubation for 6 hours with primary HLA-B CD4 + T-cells presenting similar levels of p24 expression (i.e. 45% or 46%) at day 3 post-infection with wt or Nef viruses (E:T ratio 10:1).
5 Figure S5. Reactivity of KK10-specific CD8 + T-cell clones for wt or L 268 M peptides EC50 values for HLA B*2705-restricted KK10-specific CD8 + T-cell clones (n=11) were determined in standard chromium release assays using peptide (wt or L268M) titrations and a common antigen presenting HLA-B* B-cell line. Ten clones (C2A, E3A, G11C, G12C, E2C, F9A, G10A, G10H, H8B, H9B) displayed lower AgS levels in response to L 268 M compared to wt KK10; only clone C12C showed the inverse pattern.
6
7
8
9
10
SUPPLEMENTARY INFORMATION
Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice
More informationCrystallization-grade After D After V3 cocktail. Time (s) Time (s) Time (s) Time (s) Time (s) Time (s)
Ligand Type Name 6 Crystallization-grade After 447-52D After V3 cocktail Receptor CD4 Resonance Units 5 1 5 1 5 1 Broadly neutralizing antibodies 2G12 VRC26.9 Resonance Units Resonance Units 3 1 15 1 5
More informationSupplementary Material
Supplementary Material HLA-DM Captures Partially Empty HLA-DR Molecules for Catalyzed Peptide Removal Anne-Kathrin Anders, Melissa J. Call, Monika-Sarah E. D. Schulze, Kevin D. Fowler, David A. Schuert,
More informationSupplementary Table 1. Data collection and refinement statistics (molecular replacement).
Supplementary Table 1. Data collection and refinement statistics (molecular replacement). Data set statistics HLA A*0201- ALWGPDPAAA PPI TCR PPI TCR/A2- ALWGPDPAAA PPI TCR/A2- ALWGPDPAAA Space Group P2
More information<Supplemental information>
The Structural Basis of Endosomal Anchoring of KIF16B Kinesin Nichole R. Blatner, Michael I. Wilson, Cai Lei, Wanjin Hong, Diana Murray, Roger L. Williams, and Wonhwa Cho Protein
More informationAvidity for antigen shapes clonal dominance in CD8 T cell populations specific for persistent DNA viruses
Avidity for antigen shapes clonal dominance in CD8 T cell populations specific for persistent DNA viruses David A. Price, 1 Jason M. Brenchley, 1 Laura E. Ruff, 1 Michael R. Betts, 2 Brenna J. Hill, 1
More informationCD44
MR1-5-OP-RU CD24 CD24 CD44 MAIT cells 2.78 11.2 WT RORγt- GFP reporter 1 5 1 4 1 3 2.28 1 5 1 4 1 3 4.8 1.6 8.1 1 5 1 4 1 3 1 5 1 4 1 3 3.7 3.21 8.5 61.7 1 2 1 3 1 4 1 5 TCRβ 2 1 1 3 1 4 1 5 CD44 1 2 GFP
More informationT cell recognition. Statistics & Dynamics of Functional Sensitivity
T cell recognition Statistics & Dynamics of Functional Sensitivity C Molina-París LEEDS APPLIED MATHEMATICS G Lythe LEEDS APPLIED MATHEMATICS A K Sewell CARDIFF MEDICAL BIOCHEMISTRY & IMMUNOLOGY L Wooldridge
More informationT Cell Receptor Optimized Peptide Skewing of the T-Cell Repertoire Can Enhance Antigen Targeting
T Cell Receptor Optimized Peptide Skewing of the T-Cell Repertoire Can Enhance Antigen Targeting Julia Ekeruche-Makinde 1*, Mathew Clement 1*, David K Cole 1*, Emily S J Edwards 1, Kristin Ladell 1, John
More informationJournal of Immunological Methods
Journal of Immunological Methods 338 (2008) 31 39 Contents lists available at ScienceDirect Journal of Immunological Methods journal homepage: www.elsevier.com/locate/jim Research paper Detection of low
More informationSupplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints
Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide
More informationSupplementary Table 1. Functional avidities of survivin-specific T-cell clones against LML-peptide
Supplementary Table 1. Functional avidities of survivin-specific T-cell clones against LML-peptide pulsed T2 cells. clone avidity by 4-hour 51 Cr-release assay 50% lysis at E:T 10:1 [LML peptide, M] #24
More informationSUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION EXPERIMENTAL PROCEDURES Tryptic digestion protection experiments - PCSK9 with Ab-3D5 (1:1 molar ratio) in 50 mm Tris, ph 8.0, 150 mm NaCl was incubated overnight at 4 o C. The
More informationFile name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. Schematic of Ras biochemical coupled assay.
More informationPurification of Glucagon3 Interleukin-2 Fusion Protein Derived from E. coli
Purification of Glucagon3 Interleukin-2 Fusion Protein Derived from E. coli Hye Soon Won Dept. of Chem. Eng. Chungnam National University INTRODUCTION Human interleukin-2(hil-2) - known as T Cell Growth
More informationIncorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity.
Supplementary Figure 1 Incorporation of photo-caged lysine (pc-lys) at K273 of human LCK allows specific control of the enzyme activity. (a) Modeling of the kinase domain of LCK with ATP (left) or pc-lys
More informationData are contained in multiple tabs in Excel spreadsheets and in CSV files.
Contents Overview Curves Methods Measuring enzymatic activity (figure 2) Enzyme characterisation (Figure S1, S2) Enzyme kinetics (Table 3) Effect of ph on activity (figure 3B) Effect of metals and inhibitors
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity
Supplementary Figure 1 Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity (a, b) Fluorescent-based determination of the binding capacity of DNA-barcoded MHC multimers (+barcode)
More informationSupplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
More informationThe Adaptive Immune Response. T-cells
The Adaptive Immune Response T-cells T Lymphocytes T lymphocytes develop from precursors in the thymus. Mature T cells are found in the blood, where they constitute 60% to 70% of lymphocytes, and in T-cell
More informationSupplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone.
Supplementary Table 1. T-cell receptor sequences of HERV-K(HML-2)-specific CD8 + T cell clone. alpha beta ATGCTCCTGCTGCTCGTCCCAGTGCTCGAGGTGATTTTTACTCTGGGAGGAACCAGAGCC CAGTCGGTGACCCAGCTTGACAGCCACGTCTCTGTCTCTGAAGGAACCCCGGTGCTGCTG
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Nair S, Branagan AR, Liu J, Boddupalli CS, Mistry PK, Dhodapkar
More informationIn situ drug-receptor binding kinetics in single cells: a quantitative label-free study of anti-tumor drug resistance
Supplementary Information for In situ drug-receptor binding kinetics in single cells: a quantitative label-free study of anti-tumor drug resistance Wei Wang 1, Linliang Yin 2,3, Laura Gonzalez-Malerva
More informationAntigen Receptor Structures October 14, Ram Savan
Antigen Receptor Structures October 14, 2016 Ram Savan savanram@uw.edu 441 Lecture #8 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Today): Structural features of the BCR and TCR Janeway Chapter
More informationTricks with tetramers: how to get the most from multimeric peptide MHC
IMMUNOLOGY REVIEW ARTICLE Tricks with tetramers: how to get the most from multimeric peptide MHC Ó 2009 Blackwell Publishing Ltd, Immunology, 126, 147 164 147 L. Wooldridge et al. Linda Wooldridge, 1,
More informationEvidence for antigen-driven TCRβ chain convergence in the tumor infiltrating T cell repertoire
Evidence for antigen-driven TCRβ chain convergence in the tumor infiltrating T cell repertoire Geoffrey M. Lowman, PhD Senior Staff Scientist EACR - 02 July 2018 For Research Use Only. Not for use in diagnostic
More informationSupplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in
Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Fig. 2 Substitution Sequence Position variant Sequence original APNCYGNIPL original APNCYGNIPL
More informationLecture 6. Burr BIO 4353/6345 HIV/AIDS. Tetramer staining of T cells (CTL s) Andrew McMichael seminar: Background
Lecture 6 Burr BIO 4353/6345 HIV/AIDS Andrew McMichael seminar: Background Tetramer staining of T cells (CTL s) 1. Vβ 19: There are 52 T cell receptor (TCR) Vβ gene segments in germ line DNA (See following
More informationSUPPLEMENTAL DATA. Experimental Procedures
SUPPLEMENTAL DATA Experimental Procedures For surface plasmon resonance (SPR) measurements, the setup was similar to a previous study (1). In brief, a gold surface (Au SIA-Kit, GE Healthcare) was carboxylated
More informationIntroduction. and Department of Medical Oncology, Dana-Farber Cancer Institute, 77 Avenue Louis Pasteur, Boston, MA 02115, USA
doi:10.1016/j.jmb.2007.06.057 J. Mol. Biol. (2007) 372, 535 548 CTL Recognition of a Protective Immunodominant Influenza A Virus Nucleoprotein Epitope Utilizes a Highly Restricted Vβ but Diverse Vα Repertoire:
More informationAntigen Recognition by T cells
Antigen Recognition by T cells TCR only recognize foreign Ags displayed on cell surface These Ags can derive from pathogens, which replicate within cells or from pathogens or their products that cells
More informationHLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol
HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared
More informationSupplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood
Antibody-mediated depletion of CD19-CAR T cells Supplemental 1 Supplemental Materials Supplemental Figure 1. Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood cells were
More informationT cell development October 28, Dan Stetson
T cell development October 28, 2016 Dan Stetson stetson@uw.edu 441 Lecture #13 Slide 1 of 29 Three lectures on T cells (Chapters 8, 9) Part 1 (Today): T cell development in the thymus Chapter 8, pages
More informationIntegrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1
Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 CHRISTOPH RADER, 2 MIKHAIL POPKOV, JOHN A. NEVES, AND CARLOS F. BARBAS III 2 Department of Molecular Biology and The
More informationSupplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood
Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood tree illustrating CRF01_AE gp120 protein sequence relationships between 107 Envs sampled in the RV144 trial
More informationScott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION
Scott Abrams, Ph.D. Professor of Oncology, x4375 scott.abrams@roswellpark.org Kuby Immunology SEVENTH EDITION CHAPTER 11 T-Cell Activation, Differentiation, and Memory Copyright 2013 by W. H. Freeman and
More informationStructure and Function of Antigen Recognition Molecules
MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and
More informationRapid perforin upregulation directly ex vivo by CD8 + T cells is a defining characteristic of HIV elite controllers
Rapid perforin upregulation directly ex vivo by CD8 + T cells is a defining characteristic of HIV elite controllers Adam R. Hersperger Department of Microbiology University of Pennsylvania Evidence for
More informationBIOASSAYS IN PRODUCT DEVELOPMENT: An Immuno-Oncology Perspective
BIOASSAYS IN PRODUCT DEVELOPMENT: An Immuno-Oncology Perspective CASSS Bioassays May 09, 2017 Tara Stauffer 1 Overview Introduction: Cell-based bioassays in IO product development Immuno-Oncology (IO)
More informationImmune surveillance: The immune system can recognize and destroy nascent malignant cells
Immune surveillance: The immune system can recognize and destroy nascent malignant cells Control Escape APC T C T H B NKT NK Innate Tumor T cells are believed to play a major role in controlling tumor
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated
More informationLuminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2016 Contents Supporting Information Luminescent platforms for monitoring changes in the
More informationStalking influenza by vaccination with pre-fusion headless HA mini-stem
Stalking influenza by vaccination with pre-fusion headless HA mini-stem Sophie A Valkenburg a,b, V Vamsee Aditya Mallajosyula c, Olive TW Li b, Alex WH hin b, George arnell d, Nigel Temperton d, Raghavan
More informationa) The statement is true for X = 400, but false for X = 300; b) The statement is true for X = 300, but false for X = 200;
1. Consider the following statement. To produce one molecule of each possible kind of polypeptide chain, X amino acids in length, would require more atoms than exist in the universe. Given the size of
More informationNature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
More informationSupplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random
S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:
More informationHLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol
HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationNature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA.
Supplementary Figure 1 Fluorescent titration of probe CPDSA. Fluorescent titration of probe CPDSA (10 um) upon addition of GSH in HEPES (10 mm, ph = 7.4) containing 10% DMSO. Each spectrum was recorded
More informationThe CD8 T Cell Coreceptor Exhibits Disproportionate Biological Activity at Extremely Low Binding Affinities*
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 27, Issue of July 4, pp. 24285 24293, 2003 Printed in U.S.A. The CD8 T Cell Coreceptor Exhibits Disproportionate Biological Activity at Extremely Low Binding
More informationThe T cell receptor for MHC-associated peptide antigens
1 The T cell receptor for MHC-associated peptide antigens T lymphocytes have a dual specificity: they recognize polymporphic residues of self MHC molecules, and they also recognize residues of peptide
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Johnson DB, Balko JM, Compton ML, et al. Fulminant myocarditis
More informationA mechanism for glycoconjugate vaccine activation of the adaptive immune system and its implications for vaccine design
A mechanism for glycoconjugate vaccine activation of the adaptive immune system and its implications for vaccine design Fikri Y. Avci 1,2, Xiangming Li 3, Moriya Tsuji 3, Dennis L. Kasper 1,2* Supplementary
More informationIncomplete immune response to Coxsackie B viruses. associates with early autoimmunity against insulin
Incomplete immune response to Coxsackie B viruses associates with early autoimmunity against insulin Michelle P. Ashton 1, Anne Eugster 1, Denise Walther 1, Natalie Daehling 1, Stephanie Riethausen 2,
More informationSupplementary Information
Supplementary Information Two common structural motifs for TCR recognition by staphylococcal enterotoxins Karin Erica Johanna Rödström 1, Paulina Regenthal 1, Christopher Bahl 2, Alex Ford 2, David Baker
More informationT Cell Development II: Positive and Negative Selection
T Cell Development II: Positive and Negative Selection 8 88 The two phases of thymic development: - production of T cell receptors for antigen, by rearrangement of the TCR genes CD4 - selection of T cells
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 A β-strand positions consistently places the residues at CDR3β P6 and P7 within human and mouse TCR-peptide-MHC interfaces. (a) E8 TCR containing V β 13*06 carrying with an 11mer
More informationSignificance of the MHC
CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ
More informationand Jamie Rossjohn 1,2,4 *
Understanding the drivers of MHC restriction of T cell receptors Nicole L. La Gruta 1,2 *, Stephanie Gras 1,2, Stephen R. Daley 1, Paul G. Thomas 3 and Jamie Rossjohn 1,2,4 * Abstract T cell discrimination
More informationSupporting information (protein purification, kinetic characterization, product isolation, and characterization by NMR and mass spectrometry):
Supporting Information Mechanistic studies of a novel C-S lyase in ergothioneine biosynthesis: the involvement of a sulfenic acid intermediate Heng Song, 1 Wen Hu, 1,2 Nathchar Naowarojna, 1 Ampon Sae
More informationSignificance of the MHC
CHAPTER 8 Major Histocompatibility Complex (MHC) What is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) - MHC molecules were initially discovered during studies aimed
More informationWhite Blood Cells (WBCs)
YOUR ACTIVE IMMUNE DEFENSES 1 ADAPTIVE IMMUNE RESPONSE 2! Innate Immunity - invariant (generalized) - early, limited specificity - the first line of defense 1. Barriers - skin, tears 2. Phagocytes - neutrophils,
More informationHigh-Throughput Sequencing of Islet-Infiltrating Memory CD4 + T Cells Reveals a Similar Pattern of TCR Vb Usage in Prediabetic and Diabetic NOD Mice
High-Throughput Sequencing of Islet-Infiltrating Memory CD4 + T Cells Reveals a Similar Pattern of TCR Vb Usage in Prediabetic and Diabetic NOD Mice Idania Marrero 1 *, David E. Hamm 2, Joanna D. Davies
More informationInfluenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA ELISA Pair Set
Influenza A H7N9 (A/Anhui/1/2013) Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK40103 To achieve the best assay results, this manual must be read carefully before using this product and the assay
More informationImmunology - Lecture 2 Adaptive Immune System 1
Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers
More informationThe Different Folding Behavior of Insulin and Insulin-like Growth Factor 1 Is Mainly Controlled by Their B-Chain/Domain
1556 Biochemistry 2002, 41, 1556-1567 The Different Folding Behavior of Insulin and Insulin-like Growth Factor 1 Is Mainly Controlled by Their B-Chain/Domain Zhan-Yun Guo, Lu Shen, and You-Min Feng* State
More informationChemical Nature of the Amino Acids. Table of a-amino Acids Found in Proteins
Chemical Nature of the Amino Acids All peptides and polypeptides are polymers of alpha-amino acids. There are 20 a- amino acids that are relevant to the make-up of mammalian proteins (see below). Several
More informationMultiple-Choice Questions Answer ALL 20 multiple-choice questions on the Scantron Card in PENCIL
Multiple-Choice Questions Answer ALL 20 multiple-choice questions on the Scantron Card in PENCIL For Questions 1-10 choose ONE INCORRECT answer. 1. Which ONE of the following statements concerning the
More informationIntroduction. Introduction. Lymphocyte development (maturation)
Introduction Abbas Chapter 8: Lymphocyte Development and the Rearrangement and Expression of Antigen Receptor Genes Christina Ciaccio, MD Children s Mercy Hospital January 5, 2009 Lymphocyte development
More informationA TCRα framework centered codon shapes a biased T cell repertoire through direct MHC and CDR3β interactions
A TCRα framework centered codon shapes a biased T cell repertoire through direct MHC and CDR3β interactions Kristin Støen Gunnarsen, 1,2 Lene Støkken Høydahl, 1,2 Louise Fremgaard Risnes, 1 Shiva Dahal-Koirala,
More informationSupplementary Information
Supplementary Information Vedolizumab is associated with changes in innate rather than adaptive immunity in patients with inflammatory bowel disease Sebastian Zeissig, Elisa Rosati, C. Marie Dowds, Konrad
More informationRecombinant Trypsin, Animal Origin Free
Recombinant Trypsin, Animal Origin Free PRODUCT INFORMATION: BioGenomics r-trypsin powder is ready to use, animal origin free optimized for cell culture applications. It is derived by r-dna technology.
More informationChapter 8. Interaction between the phosphatidylinositol 3- kinase SH3 domain and a photocleavable cyclic peptide
Interaction between the phosphatidylinositol 3- kinase SH3 domain and a photocleavable cyclic peptide 129 Abstract The interaction of the PI3K SH3 domain with a cyclic photocleavable peptide and the linear
More informationthe HLA complex Hanna Mustaniemi,
the HLA complex Hanna Mustaniemi, 28.11.2007 The Major Histocompatibility Complex Major histocompatibility complex (MHC) is a gene region found in nearly all vertebrates encodes proteins with important
More informationHBsAg, HBsAg. Tris - HCl, 200 mmol/ L NaCl, ph ml Amp 100 mg/ L, 4-5 h, [pqe - scfv] Kana 25 mg/ L 2 YT,37, 111 pqe - scfv
Chinese Journal of Pathophysiology 2002,18 (9) :1069-1073 1069 [ ] 1000-4718 (2002) 09-1069 - 05 HBsAg 3 1, 2, 1, 2, 2, 2, 2, 1 ( 1, 510640 ; 2 458, 510602) [ ] :6 His, :,, 3 ;, :, (61108 1145) % ; (2130
More informationObjective: You will be able to explain how the subcomponents of
Objective: You will be able to explain how the subcomponents of nucleic acids determine the properties of that polymer. Do Now: Read the first two paragraphs from enduring understanding 4.A Essential knowledge:
More informationSection 1 Proteins and Proteomics
Section 1 Proteins and Proteomics Learning Objectives At the end of this assignment, you should be able to: 1. Draw the chemical structure of an amino acid and small peptide. 2. Describe the difference
More informationStructural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB
Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB Bindu L. Raveendra, 1,5 Ansgar B. Siemer, 2,6 Sathyanarayanan V. Puthanveettil, 1,3,7 Wayne A. Hendrickson,
More informationNature Genetics: doi: /ng Supplementary Figure 1. Workflow of CDR3 sequence assembly from RNA-seq data.
Supplementary Figure 1 Workflow of CDR3 sequence assembly from RNA-seq data. Paired-end short-read RNA-seq data were mapped to human reference genome hg19, and unmapped reads in the TCR regions were extracted
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
More informationHow T cells recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do? Monoclonal antibody approach
How T cells recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do By the early 1980s, much about T cell function was known, but the receptor genes had not been identified
More informationA second type of TCR TCR: An αβ heterodimer
How s recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do By the early 1980s, much about function was known, but the receptor genes had not been identified Recall
More informationInsulin SEC analysis. Insulin Samples:
EE1 Insulin SEC analysis Insulin Samples: Lispro, identical in structure to Insulin Human, except that it has lysine and proline at positions 8 and 9, respectively, of chain B, whereas this sequence is
More informationPrinciples of Adaptive Immunity
Principles of Adaptive Immunity Chapter 3 Parham Hans de Haard 17 th of May 2010 Agenda Recognition molecules of adaptive immune system Features adaptive immune system Immunoglobulins and T-cell receptors
More informationComparison of Biochemical Properties of the Original. and Newly Identified Oleate Hydratases from
Comparison of Biochemical Properties of the Original and Newly Identified Oleate Hydratases from Stenotrophomonas maltophilia Woo-Ri Kang, a Min-Ju Seo, a Kyung-Chul Shin, a Jin-Byung Park, b Deok-Kun
More informationSignificance of the MHC
CHAPTER 8 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ
More informationAgilent Technologies Prep LC Columns
Agilent Technologies Prep LC Columns Agilent Technologies Prep LC Columns Agilent Technologies has always taken seriously its responsibility to ensure your success. That s why all our instruments and supplies
More informationSupplementary Figure 1. Comparative analysis of thermal denaturation of enzymatically
Supplementary Figures Supplementary Figure 1. Comparative analysis of thermal denaturation of enzymatically synthesized polyubiquitin chains of different length. a, Differential scanning calorimetry traces
More informationA rt i c l e s Nature America, Inc. All rights reserved.
Structural basis for the killing of human beta cells by CD8 + T cells in type 1 diabetes Anna M Bulek 1,9, David K Cole 1,9, Ania Skowera 2,3,9, Garry Dolton 1, Stephanie Gras 4, Florian Madura 1, Anna
More informationMHC Tetramers and Monomers for Immuno-Oncology and Autoimmunity Drug Discovery
MHC Tetramers and Monomers for Immuno-Oncology and Autoimmunity Drug Discovery Your Partner in Drug Discovery and Research MHC Tetramer Background T-Cell Receptors recognize and bind to complexes composed
More informationSensoLyte Generic MMP Assay Kit *Colorimetric*
SensoLyte Generic MMP Assay Kit *Colorimetric* Revision#1.2 Catalog # Kit Size Last updated: May2017 AS-72095 100 Assays (96-well plate) Optimized Performance: This kit is optimized to detect MMP activity
More informationMajor Histocompatibility Complex (MHC) and T Cell Receptors
Major Histocompatibility Complex (MHC) and T Cell Receptors Historical Background Genes in the MHC were first identified as being important genes in rejection of transplanted tissues Genes within the MHC
More informationImmunocore Ltd isbtc Washington 30 th October 2009
Ltd isbtc Washington 30 th October 2009 Bent Jakobsen Chief Scientific Officer Breaking immune tolerance to cancer The immune system has more cytotoxic potential and versatility than can be achieved with
More informationAnti-coreceptor antibodies profoundly affect staining with peptide-mhc class I and class II tetramers
Eur. J. Immunol. 2006. 36: 1847 1855 Molecular immunology 1847 Molecular immunology Anti-coreceptor antibodies profoundly affect staining with peptide-mhc class I and class II tetramers Linda Wooldridge*
More informationTranscript-indexed ATAC-seq for immune profiling
Transcript-indexed ATAC-seq for immune profiling Technical Journal Club 22 nd of May 2018 Christina Müller Nature Methods, Vol.10 No.12, 2013 Nature Biotechnology, Vol.32 No.7, 2014 Nature Medicine, Vol.24,
More informationOxisResearch A Division of OXIS Health Products, Inc.
OxisResearch A Division of OXIS Health Products, Inc. BIOXYTECH pl GPx Enzyme Immunoassay Assay for Human Plasma Glutathione Peroxidase For Research Use Only. Not For Use In Diagnostic Procedures. Catalog
More informationBiology Open (2014) 000, 1 10 doi: /bio
(2014) 000, 1 10 doi:10.1242/bio.201410041 Supplementary Material Michael Brauchle et al. doi: 10.1242/bio.201410041 Fig. S1. Alignment of GFP, sfgfp, egfp, eyfp, mcherry and mruby2. Sequence-based alignment
More informationCOURSE: Medical Microbiology, MBIM 650/720 - Fall TOPIC: Antigen Processing, MHC Restriction, & Role of Thymus Lecture 12
COURSE: Medical Microbiology, MBIM 650/720 - Fall 2008 TOPIC: Antigen Processing, MHC Restriction, & Role of Thymus Lecture 12 FACULTY: Dr. Mayer Office: Bldg. #1, Rm B32 Phone: 733-3281 Email: MAYER@MED.SC.EDU
More informationRAISON D ETRE OF THE IMMUNE SYSTEM:
RAISON D ETRE OF THE IMMUNE SYSTEM: To Distinguish Self from Non-Self Thereby Protecting Us From Our Hostile Environment. Innate Immunity Adaptive Immunity Innate immunity: (Antigen - nonspecific) defense
More information