Chlamydia pneumoniae Eradication from Carotid Plaques. Results of an Open, Randomised Treatment Study

Size: px

Start display at page:

Download "Chlamydia pneumoniae Eradication from Carotid Plaques. Results of an Open, Randomised Treatment Study"

Scott Snow
5 years ago
Views:

1 Eur J Vasc Endovasc Surg 18, (1999) Article No. ejvs Chlamydia pneumoniae Eradication from Carotid Plaques. Results of an Open, Randomised Treatment Study G. Melissano 1, F. Blasi 2, G. Esposito, P. Tarsia 2, L. Dordoni 1, C. Arosio 2, Y. Tshomba 1, L. Fagetti 2, L. Allegra 2 and R. Chiesa 1 1 Department of Vascular Surgery, Scientific Institute (IRCCS) H. San Raffaele, Milano, Italy; 2 Institute of Respiratory Diseases, University of Milan, IRCCS Ospedale Maggiore, Milano, Italy Objective: to determine the effect of specific antibiotic treatment with roxithromycin in the eradication of Chlamydia pneumoniae from carotid artery plaques. Design: prospective open randomised treatment study. Patients and methods: we analysed 32 patients (16 females, mean age 70.1±14.7 years) who underwent surgery for the removal of atherosclerotic plaques from carotid arteries. During surgery samples of lingual vein and superior thyroid artery were also taken. Before surgery, patients were randomised to receive either roxithromycin 150 mg twice daily or no treatment. Sixteen patients were treated with antibiotic for a mean of 26 days (range days). The two groups of patients were comparable in terms of age, sex, risk factors, and seroprevalence for C. pneumoniae. We applied a seminested polymerase chain reaction (PCR) technique to the carotid plaques, lingual vein, and thyroid artery samples. Blood samples were obtained from the patients for the determination of C. pneumoniae IgG, IgA, and IgM antibody titres by a microimmunofluorescence technique. Results: in twelve out of sixteen non-treated patients we found evidence of C. pneumoniae DNA in the carotid plaques. Conversely, C. pneumoniae DNA was detected in only five out of sixteen treated patients (p=0.034, Chi-squared test). In all cases PCR was negative for the lingual vein and thyroid artery samples. Conclusions: Roxithromycin seems effective in reducing the bacterial burden of C. pneumoniae within atherosclerotic plaques, although extended follow-up is needed to determine whether antibiotic treatment benefits long-term patient outcome. Key Words: Chlamydia pneumoniae; Atherosclerosis; Antibiotic treatment. Introduction Please address all correspondence to: F. Blasi, Isituto di Tisiologia e Malattie dell Apparato Respiratorio, Università degli Studi di Milano, Pad. Litta, IRCCS Ospedale Maggiore di Milano, via F. Sforza, 35, I Milano, Italy. During this decade chronic infection has emerged as a putative causal factor in the development of atherosclerosis. Most studies have evaluated the association between current or previous infections with cytomegalovirus, Helicobacter pylori, and Chlamydia pneumoniae. 1 6 The presence of C. pneumoniae in coronary and carotid artery plaques, and in abdominal aortic aneurysms has been demonstrated by means of immunocytochemical, molecular biology, culture, and electron microscope techniques. 3 6 Recent studies 7,8 reproduced early atherosclerotic arterial wall degeneration (fatty streaks and complex spindle-cell lesions) in a rabbit model infected with C. pneumoniae, and in a similar animal model Muhlestein 9 demonstrated that weekly treatment with azithromycin after infectious exposure prevents accelerated intimal thickening. An intervention trial suggests that an increased anti-c. pneumoniae anti- body titre may be a predictor for further adverse cardiovascular events in male survivors of myocardial infarction and that administration of a macrolide leads to a reduction of the cardiovascular risk. 10 A persistent infection may contribute to the development of atherosclerosis by stimulating local re- sponses, all the more so since C. pneumoniae is capable of inducing the endothelial production of tissue factors, which determine the stimulation of the co- agulation cascade and platelet adhesion and local thrombosis. 11 Furthermore, C. pneumoniae induces macrophage foam-cell formation. 12 We recently dem- onstrated an association between C. pneumoniae infection and acute myocardial infarction, supporting /99/ $12.00/ Harcourt Publishers Ltd.

2 356 G. Melissano et al. the hypothesis that C. pneumoniae infection may cause for 1 minute. DNA was amplified in 50-μl volumes instability within atherosclerotic plaques. 13 Chiu et al. 2 containing 50 μmol of dntp, 0.5 μmol of each primer found that atherosclerotic plaques with thrombosis (HL-1 and HR-1), 1 unit Taq polymerase, 5 mmol were more likely to have C. pneumoniae than plaques MgCl 2, 1 mmol Tris HCl, 50 mmol KCl ph 8.3. The without thrombosis. second PCR reaction was performed starting with The aim of the present study was to determine 2 μl of the first amplificate as follows: samples were whether specific antibiotic treatment was capable of pretreated at 94 C for 5 minutes, and amplified for eradicating C. pneumoniae from carotid plaques. 35 cycles. Each cycle consisted of the following: de- naturation at 94 C for 1 minute, annealing at 48 C for 1 minute and primer extension at 72 C for 1 minute. DNA was amplified in 50-μl volumes containing Subjects and Methods 200 μmol of dntp, 0.5 μmol of each primer (HR-1 and HM-1), 1 unit Taq polymerase, 3 mmol MgCl 2, 1 mmol Between November 1997 and April 1998 we analysed Tris-HCl, 50 mmol KCl ph 8.3. The amplifications 32 patients (16 females, mean age 70.1±14.7 years) were performed in an automated thermocycler (Robowho underwent carotid endarterectomy (CEA). All cycler, Stratagene, U.S.A.). The presence of Taqpatients gave their informed consent prior to en- polymerase inhibitors in the specimens was tested. rolment. Patients were randomised to receive before In a single test-tube, 10 μl of biopsy-extracted DNA surgery either roxithromycin 150 mg twice daily or and 10 μl of DNA extracted from the positive control no treatment. Sixteen patients were treated with anti- were denatured by heat (94 C for 3 minutes) and biotic for a mean of 26 days (range days). The then in ice. Next, 10 μl were drawn to be added to two groups of patients were comparable in terms the 40 μl mixtrure for the first amplification of the of age, sex, risk factors and seroprevalence for C. PCR. The first amplification was then run, followed pneumoniae. During surgery, samples of carotid by the second step in accordance with the study plaques, lingual vein and a superior thyroid artery protocol. branch were taken. The amplification reaction was tested by means of We applied a polymerase chain reaction (PCR) for gel electrophoresis by running 10 μl of amplificate on the detection of bacterial DNA to the carotid plaques, a 3% agarose gel. The absence of an amplification lingual vein, and superior thyroid artery specimens. band indicates the presence of inhibitors in the speci- DNA was isolated by homogenisation using TriPure men. At admission, on the day of surgery, and after 4 Isolation Reagent (Boehringer Mannheim, Germany) weeks, blood samples were obtained from the patients according to the manufacturer s instructions. Briefly, for the determination of C. pneumoniae IgG, IgA, and for each 50 mg of tissue 1 ml of TriPure Isolation IgM antibody titres by a microimmunofluorescence Reagent was added to a propylene centrifuge tube at test 13 using a kit purchased from Labsystems, room temperature. After homogenisation 0.2 ml of Helsinki, Finland. chloroform (for each 1 ml of TriPure reagent) was added. After shaking vigorously for 15 seconds, the sample tube was left at room temperature for 10 minutes and then centrifuged at g for 15 min- Results utes at 4 C. DNA was retrieved by ethanol extraction from both In the treated group 12/16 patients were seropositive the interphase and the red organic phase obtained for C. pneumoniae on admission, and 9/16 were sero- after the centrifugation described above. Following positive in the non-treated group (p=0.45, Chisquared each extraction the presence of genetic material was test). In 12/16 non-treated patients we found detected by means of spectrophotometry. evidence of C. pneumoniae DNA in the carotid plaques. We applied a PCR using two sets of primers described Conversely, C. pneumoniae DNA was detected in only by Campbell: 15 HL-1, GTTGTTCATGAA- 5/16 treated patients (p=0.034, Chi-squared test). No GGCCTACT; HM-1, GTGTCATTCGCCAAGGTTAA; evidence of C. pneumoniae DNA was found in any of and HR-1, TGCATAACCTACGGTGTGTT. The first the lingual vein and thyroid artery samples. PCR reaction was modified as follows: samples were Among the 12 non-treated patients with presence of pretreated at 94 C for 5 minutes, and amplified for C. pneumoniae DNA, serology results were consistent 35 cycles. Each cycle consisted of the following: with chronic infection in 8/12 cases, negative in denaturation at 94 C for 1 minute, annealing at 3/12, and the serum samples were missing in 1/12 55 C for 1 minute and primer extension at 72 C patients. Out of the four non-treated patients with

3 C. pneumoniae Eradication from Carotid Plaques 357 Table 1. Clinical characteristics, serology on admission and molecular biology findings in the 16 treated patients. Pt Sex Age Risk factors and concomitant diseases Serology on admission C. pneumoniae DNA IgG IgA IgM 1 F 54 Hypertension, diabetes, dyslipidaemia <1:16 <1:16 <1:16 Positive 2 F 64 Dyslipidaemia 1:256 <1:16 <1:16 Negative 3 M 64 Smoking, hypertension, dyslipidaemia, CHD <1:16 <1:16 <1:16 Negative 4 F 67 Smoking, hypertension, dyslipidaemia <1:16 <1:16 <1:16 Negative 5 M 68 Smoking, hypertension, dyslipidaemia, CHD, stroke 1:512 <1:16 <1:16 Negative 6 M 73 Smoking, hypertension, dyslipidaemia 1:256 <1:16 <1:16 Negative 7 M 76 COPD, smoking, hypertension 1:64 <1:16 <1:16 Negative 8 F 77 CHD, obesity 1:256 <1:16 <1:16 Positive 9 F 77 Hypertension, dyslipidaemia <1:16 <1:16 <1:16 Negative 10 F 77 Hypertension, dyslipidaemia 1:64 1:32 <1:16 Positive 11 F 81 Hypertension, CHD 1:512 <1:16 <1:16 Positive 12 M 82 Smoking, CHD, obesity, stroke 1:64 1:128 <1:16 Negative 13 M 82 Smoking, hypertension, stroke 1:64 <1:16 <1:16 Negative 14 F 82 Hypertension 1:256 <1:16 <1:16 Negative 15 F 83 Hypertension, dyslipidaemia, stroke 1:64 <1:16 <1:16 Negative 16 F 86 COPD, dyslipidaemia, obesity 1:64 1:32 <1:16 Positive Pt=Patient; COPD=chronic obstructive pulmonary disease; CHD=coronary heart disease. Table 2. Clinical characteristics, serology on admission and molecular biology findings in the 16 non-treated patients. Pt Sex Age Risk factors and concomitant diseases Serology on admission C. pneumoniae DNA IgG IgA IgM 1 F 42 COPD, hypertension, diabetes 1:128 <1:16 <1:16 Positive 2 M 62 Smoking, hypertension, CHD 1:256 <1:16 <1:16 Positive 3 F 62 Hypertension, dyslipidaemia, obesity <1:16 <1:16 <1:16 Positive 4 F 66 Hypertension, stroke <1:16 <1:16 <1:16 Positive 5 F 70 Smoking, stroke 1:128 <1:16 <1:16 Positive 6 M 70 COPD, CHD, obesity, stroke 1:64 1:32 <1:16 Positive 7 M 70 Hypertension, CHD 1:64 <1:16 <1:16 Positive 8 M 71 Hypertension, dyslipidaemia <1:16 <1:16 <1:16 Negative 9 F 73 Smoking, hypertension <1:16 <1:16 <1:16 Positive 10 M 73 COPD, smoking, CHD <1:16 <1:16 <1:16 Negative 11 F 74 Smoking, hypertension, dyslipidaemia 1:16 1:32 <1:16 Positive 12 M 74 Dyslipidaemia, hypertension NA NA NA Positive 13 M 77 Hypertension, obesity 1:256 1:64 <1:16 Positive 14 F 77 Hypertension, CHD, stroke 1:64 <1:16 <1:16 Positive 15 F 78 Hypertension, dyslipidaemia 1:64 <1:16 <1:16 Negative 16 M 82 Smoking, hypertension, stroke <1:16 <1:16 <1:16 Negative Pt=Patient; NA=not available; COPD=chronic obstructive pulmonary disease; CHD=coronary heart disease. no evidence of C. pneumoniae genetic material, sero- 4 weeks following surgery). In all cases PCR was logy was negative in three cases and positive in one negative on lingual vein or thyroid artery samples. case. In the five treated patients with PCR positivity Table 1 and Table 2 summarises clinical characteristics, for C. pneumoniae, pre-treatment serology results were serology at admission, and molecular biofor consistent with chronic infection in four cases, neg- logy results of treated and non-treated patients, ative in one case. Among the 11 treated patients respectively. for whom C. pneumoniae was not detected by PCR, PCR was repeated twice on each specimen. In 29/ serology on admission was negative in three cases 32 cases both PCR test results were unequivocal. and positive in eight cases. When the test results were not unequivocal we considered No significant variations in antibody titres were the sample to be negative. There was no recorded in the two groups over the entire study evidence of Taq-polymerase inhibitors in the biopsy period (on admission, on the day of surgery, and at samples. We tested for a possible correlation between

4 358 G. Melissano et al. C. pneumoniae positivity (as determined both by sero- the limit of detection of the PCR technique ( logy and PCR) and a more severe form of arterial elementary bodies), roxithromycin appears capable stenosis (>70%). In terms of serology, the difference of penetrating within plaque lesions and acting on in number of severe forms of stenosis between C. the micro-organism. pneumoniae-positive (9/21) and C. pneumoniae-neg- In summary, the results of our study indicate that ative (2/10) patients was not statistically significant roxithromycin is effective in reducing the bacterial (p=0.4). Conversely, in terms of PCR results, among burden of Chlamydia pneumoniae within atherosclerotic the non-treated patients a more severe form of stenosis plaques, although extended follow-up is was observed in C. pneumoniae-dna-positive needed to determine whether antibiotic treatment patients (11/12) compared to C. pneumoniae-dnanegative benefits long-term patient outcome. (1/4) subjects (p=0.046, Chi-squared test). We excluded the treated group from the analysis, since the determination of PCR positivity was performed following antibiotic treatment. Acknowledgement Funding: This study was partially supported by IRCCS Ospedale Maggiore di Milano Grant No 260/01. Discussion Among the infective agents suggested as possible References causal factors in the development of atherosclerosis, 1Hendricks MGR, Salimens MMM, Vanboven CPA et al. High C. pneumoniae is the most extensively studied. Ser- prevalence of latently present cytomegalovirus in arterial wall ologic, immunocytochemical, cultural, molecular bio- of patients suffering from grade III atherosclerosis. Am J Pathol logy and electron microscope studies indicate that the 1990; 136: Chiu B, Viira E, Tucker W et al. Chlamydia pneumoniae, cytoinvolvement of this micro-organism is very likely. 3 6 megalovirus, and herpes simplex virus in atherosclerosis of Several authors have therefore recently tested carotid artery. Circulation 1997; 96: whether specific antibiotic treatment is capable of 3Blasi F, Denti F, Erba M et al. Detection of Chlamydia pneumoniae and not of Helicobacter pylori in atherosclerotic plaques of aortic altering the natural history of cardiovascular diseases aneurysms. J Clin Microbiol 1996; 34: both in animal and human models. 9,10 4Campbell LA, O Brien ER, Cappuccio AL et al. Detection of The major finding of the study is that the rate of Chlamydia pneumoniae TWAR in human coronary atherectomy tissues. JID 1995; 172: C. pneumoniae-dna detection by PCR performed on 5Ramirez JA, Ahkee S, Summersgill JT et al. Isolation of Chlamydia pneumoniae from coronary artery of a patient with coronary surgical specimens was significantly higher among the non-treated patients compared to subjects treaed atherosclerosis. Ann Intern Med 1996; 125: Jackson LA, Campbell LA, Kuo CC et al. Isolation of Chlamydia with roxithromycin. The failure to detect C. pneu- pneumoniae from a carotid endarterectomy specimen. JID 1997; moniae DNA in atherosclerosis-free tissue (lingual 176: vein and thyroid artery) supports the specificity of 7Fong IW, Chiu B, Viira E et al. A rabbit model for Chlamydia pneumoniae infection. J Clin Microbiol 1997; 35: detection of this agent in atheromas. The sero- 8Laitinen K, Laurila A, Pyhala L et al. Chlamydia pneumoniae positivity to C. pneumoniae on admission was com- infection induces inflammatory changes in the aortas of rabbits. parable among the treated and non-treated groups, Infect Immun 1997; 65: Muhlestein JB, Anderson JL, Hammond EH et al. Infection suggesting good patient randomisation. A further with Chlamydia pneumoniae accelerates the development of finding of the study was that there was a satisfactory atherosclerosis and treatment with azithromycin prevents it in correlation between serology and PCR results among a rabbit model. Circulation 1998; 97: Gupta S, Leatham EW, Carrington D et al. Elevated Chlamydia non-treated patients. This is in contrast to previous pneumoniae antibodies, cardiovascular events, and azithromycin studies which have failed to associate antibody titres in male survivors of myocardial infarction. Circulation 1997; 96: with the presence of C. pneumoniae DNA in coronary Fryer RH, Schwobe EP, Woods ML et al. Chlamydia species and carotid atherosclerotic plaques. 2,16 infect human vascular endothelial cells and induce procoagulant Treatment with specific antibiotic therapy ap- activity. J Invest Med 1997; 45: parently eradicates C. pneumoniae from atherosclerotic 12 Kalayoglu MV, Byrne GI. Induction of macrophage foam cell formation by Chlamydia pneumoniae. J Infect Dis 1998; 177: plaques, as indicated by the fact that among treated 13 Blasi F, Cosentini R, Raccanelli R et al. A possible association patients PCR positivity to C. pneumoniae was sigfarction in patients than 65 years of age. Chest 1997; 112: of Chlamydia pneumoniae infection and acute myocardial in- nificantly lower compared to non-treated patients. 14 AHA. Guidelines for carotid endarterectomy. A multidisciplinary Although we cannot rule out that antibiotic treatment consensus statement from the ad hoc Committee. Circulation merely brought the bacterial burden to levels beneath 1995; 91:

5 C. pneumoniae Eradication from Carotid Plaques Campbell LA, Melgosa MP, Hamilton DJ et al. Detection pneumoniae in atherosclerotic lesions of coronary arteries. J Infect of Chlamydia pneumoniae by polymerase chain reaction. J Clin Dis 1993; 167: Microbiol 1992; 30: Kuo CC, Shor A, Campbell LA et al. Demonstration of Chlamydia Accepted 28 April 1999

Circulating Chlamydia pneumoniae DNA as a Predictor of Coronary Artery Disease

Circulating Chlamydia pneumoniae DNA as a Predictor of Coronary Artery Disease Journal of the American College of Cardiology Vol. 34, No. 5, 1999 1999 by the American College of Cardiology ISSN 0735-1097/99/$20.00 Published by Elsevier Science Inc. PII S0735-1097(99)00391-5 Circulating