Components of heritability in an Icelandic cohort

Transcription

1 Components of heritability in an Icelandic cohort Noah Zaitlen Harvard School of Public Health

2 Conflict of Interest Disclosure Four of the authors (Helgason, Gudbjartsson, Kong, Stefansson) are shareholders and/or employees of decode GeneIcs, a biotechnology company.

3 Outline Background Heritability: IBD vs IBS & Related vs Unrelated Parent of Origin Effects Confounding

4 (Maher 008 Nature; also see Manolio et al. 009 Nature) Maher 008 Nature; Manolio et al. 009 Nature

5 EsImaIng the heritability of genotyped SNPs h Chip Yang et al Nat Gen 010, Yang et al AJHG 010, Lee et al AJHG 011

6 Simultaneous esimaion of heritability h and chip heritability Heritability varies between cohorts Prevents confounding of h Chip h Chip Allows use of both related and unrelated individuals, reducing the standard error of and h Chip h

7 Beneficial properies of decode s data Very Large > 40,000 individuals genotyped Comes with a Genealogy Extensively Phenotyped Long Range- Phased Parent of Origin Phased

8 EsImaIng Heritability by IntuiIon

9 EsImaIng Heritability by a Single Type of RelaIonship Twins Parent- Child Half- Cousins Visscher et al GeneIcs Research 010

10 EsImaIng Heritability by a Single RelaIonship Rela%on Height Sample Size Correla%on Heritability sib great- uncle/ aunt first- cousin parent uncle/aunt grandparent couple n/a

11 EsImaIng Heritability by Many Types of RelaIonships P = Phenotypic Covariance Matrix K Genealogy = Genetic Relatedness Matrix σ g = Genetic Variance σ e = Environmental Variance I = Identity Matrix P = K Genealogy σ g + Iσ e h = σ g σ g +σ e Mixed model methodology for farm and ranch beef ca;le tes%ng programs. Quaas & Pollak Journal of Anim Sci. 1980

12 EsImaIng Heritability by Many Types of RelaIonships 0.5 P = K Genealogy σ g + Iσ e h = σ g σ g +σ e

13 EsImaIng Heritability by Many Types of RelaIonships 0.15 P = K Genealogy σ g + Iσ e h = σ g σ g +σ e

14 Instead of Genealogical esimate, we use long- range phasing to compute IBD based esimate IBD Es%ma%on Methods Require Phase Purcell et al AJHG 007 Gusev et al Genome Research 008 Browning et al AJHG 010 Stevens et al Plos GeneIcs 011 Long- Range Phasing Makes IBD Es%ma%on Easier Kong et al Nat Genet 008

15 EsImaIng Heritability by Many Types of RelaIonships (IBD) P = K IBD σ g + Iσ e h = σ g σ g +σ e Visscher et al Nat Rev Genet 008

16 EsImaIng Heritability by Many RelaIonships (IBD) Phenotype Sample Size Heritability Standard Error BMI % 1.80% Asthma % 1.96% TD % 1.74% Hyp In Preg % 1.93% HDL % 1.73% LDL % 6.19% Waist Hip Rat % 3.69% Prostate Can % 3.83% Breast Can %.5%

17 EsImaIng Heritability via IBS? Genotyped SNPs AGGTCTACAAGAATCCCTTA! ACCTGATGAAGTATGCCATT! TCGACATGTTCTTACGCTAT! TGCACTACTTCATAGGGTAA! Relatedness at Genotyped SNPs P = K IBS σ s + Iσ E h IBS? = σ s σ s +σ e Price et al Nat Gen 006, Kang et al Nat Gen 010, Yang et al Nat Gen 010

18 What are IBD and IBS matrices esimaing? IBS is an unbiased esimator of IBD K IBS = K IBD + N(0,s ) K is really a proxy for K Causal the IBS status of causal variants Large elements of K IBS (e.g. sibs, half- sibs) are good esimators of K IBD and hence K Causal Small elements of K IBS (e.g. unrelateds) are only good esimators of K Chip We can use this matrix to compute h Chip Using both related & unrelated individuals reduces the standard error of both h Chip & h

19 Simultaneous Heritability EsImaIon K = P = K σ Big Big + K σ Small Small + Iσ E SimulaIon Heritability EsImates true h Chip =18.7% true h = 80.0% h & h Chip h IBD h IBS EsImated 84.0% (4%) 0.8 (3%) 84.0 (%) 35.3 (3%)

20 At least half of the heritability of BMI can be described by genotyped SNPs Phenotype Sample Size h & h Chip h IBD h IBS BMI % (1.80%) Heritability EsImates.90% (1.7%) 4.0% (1.80%) 34.1% (1.69%) P = K σ Big Big + K σ Small Small + Iσ E Yang et al 011 Nat Gen EsImate 16.5% (.9%) for Chip SNPs

21 Liqle of the heritability of Hypertension in Pregnancy can be described by genotyped SNPs Phenotype Sample Size h & h Chip h IBD h IBS Hyp In Preg % (1.80%) Heritability EsImates.87% (1.7%) 6.68% (1.93%) 8.01% (1.03%) P = K σ Big Big + K σ Small Small + Iσ E

22 Simultaneous esimaion over more phenotypes Phenotype Sample Size h & h Chip h IBD h IBS Asthma % (.14%) HDL % (.94%) CAD % (4.9%) Prostate Cancer % (3.89%) 5.86% (1.53%) 7.93% (.51%) 1.11% (3.70%) 13.90% (3.85%) 3.94% (.09%) 4.18% (.9%) 5.09% (.84%) 31.7% (3.83%) 1.86% (1.30%) 34.67% (.00%) 17.96% (1.81%) 3.81% (.8%)

23 And even more phenotypes Height Prostate Cancer Breast Cancer Age at Menopause Age at Menarche LDL HDL TD Waist Hip RaIo CAD AddicIons...

24 Parent of Origin Effects Rampersaud et al Curr Diabetes Rev 008

25 Parent of Origin Effects Exist Kong et al Nature 009

26 POE IBD EsImaIon Father Mother Siblings

27 POE Heritability Models Standard heritability es%mate P = K IBD σ g + Iσ e Parent of origin heritability es%mate P = K SamePar σ Z + K DifPar σ O + Iσ e If POE exists the Same Parent matrix will have a different variance term than the Different Parent Matrix Maternal and paternal heritability es%mates P = K Maternal σ M + K Paternal σ P + K DifPar σ O + Iσ e If the maternal and paternal effects are different, then the corresponding variance terms will be different.

28 Minimal heritability of height is due to parent of origin effects X (P- Value) 7.4% (%) All 36.4% (1%) Same Parent 36.0% (%) Different Parent (0.909) 18.% (1%) Maternal Parent 18.% (1%) Paternal Parent 36.0% (%) Different Parent (0.94) N=0000

29 Minimal heritability of CAD is due to parent of origin effects X (P- Value) 5.6% (3%) All 14.0% (3%) Same Parent 11.5% (3%) Different Parent 0.36 (0.547) 5.% (%) Maternal Parent 8.9% (%) Paternal Parent 11.7% (3%) Different Parent.64 (0.13) N=0000

30 Significant Maternal ContribuIon to TD X (P- Value) 8.4% (%) All 10.7% (%) Same Parent 17.8 (%) Different Parent 3.57 (0.06) 9.5% (%) Maternal Parent 1.3% (%) Paternal Parent 17.4% (%) Different Parent (0.0001) N=0000

31 Confounding Shared Environment PopulaIon Substructure Difference in Mean (Browning and Browning) Difference in Variance Also creates problems for Eigenstrat (Abney & McPeek ASHG 008) Parent of Origin IBD & IBS Remove asymmetric relaionships (i.e. Siblings)

32 Acknowledgments HSPH Alkes Price Bogdan Pasaniuc Gaurav BhaIa Peter Krar BROAD Nick Paqerson decode Gene%cs Agnar Helgason Daniel Gudbjartsson AugusIne Kong Kari Stefansson Harvard School of Public Health

33 Impact of Environmental Sharing On Heritability EsImates Heritability esimates for 37 quanitaive or categorical age and gender adjusted phenotypes. Sibling pairs have a higher esimate for 161 of the 37 phenotypes (Binomial P- Value < 9e - 9 ) Sibling pairs share more of their environment that Parent- Offspring pairs.

34 Sib Vs Half- Sib

35 AssortaIve MaIng NicoIneDependence EducaIon_Number_Years Hip_circumference Freckles_yes_no Alcohol_dependence Coffee_per_day Body_Mass_Index 5_Hydroxy_Vitamin_D