Epigenetic Pathways Linking Parental Effects to Offspring Development. Dr. Frances A. Champagne Department of Psychology, Columbia University

Transcription

1 Epigenetic Pathways Linking Parental Effects to Offspring Development Dr. Frances A. Champagne Department of Psychology, Columbia University

2 Prenatal & Postnatal Experiences Individual differences in brain and behavior can be induced by variations in early environmental experiences

3 How does variation in prenatal and postnatal experience lead to variation in the developing brain? Can these developmental effects persist across generations? What is the adaptive significance of these within- and across-generation effects?

4 prenatal & postnatal experiences long-term changes in gene expression altered neurodevelopment behavioral variation

5 Experiences occurring during fetal development can have long-term effects Brain and body are developing rapidly providing a window of opportunity for variation

6 Programming of Fetal Stress Response maternal Stress fetal risk of prematurity lower birth weight increased stress response risk of depression & anxiety

7 Placenta buffers Fetal Exposure to Stress maternal fetal cortisol corticosterone x Approximately 80% of maternal cortisol is metabolized 11β-HSD-2

8 11-β HSD-2 mrna Prenatal Stress is Associated with Decreased 11-β HSD-2 mrna in the Placenta * control stress placenta cortex hypo

9 Through what mechanism can perinatal experiences induce long-term changes in gene expression in the brain? epigenetic modifications

10 DNA is wrapped around a cluster of proteins called histones Champagne et al., (2009) Current Opinion in Neurobiology

11 Gene expression requires unwrapping of DNA Champagne et al., (2009) Current Opinion in Neurobiology

12 When methyl chemical groups attach to the DNA there is reduced accessibility to genes Champagne et al., (2009) Current Opinion in Neurobiology

13 Methylation is a stable modification to DNA which can be transmitted to daughter cells cell methylation DNA

14 prenatal & postnatal experiences epigenetic variation long-term changes in gene expression altered neurodevelopment variations in stress, cognition, social, reproductive behavior

15 percent DNA methylation DNA Methylation within the 11-β HSD-2 Gene Promoter (Placenta) 50 control * stress * * * * * * CpG site Jensen-Peña CL, Monk C, Champagne FA (2012). PLoS ONE 7(6):e39791.

16 DNA Methyltransferases DNA Methytransferase DNMT1 DNMT3a Major Activity Maintenance methylation of CpGs De novo methylation of CpGs Phenotype of loss-of-function mutations - genome wide loss of methylation - embryonic lethality - abnormal expression of imprinted genes - postnatal lethality - failure to establish methylation imprints in male and female germ cells DNMT3b De novo methylation of CpGs - embryonic lethality - vascular and liver defects

17 DNMT3a gene expression DNMT3a Gene Expression control stress ** hypo cortex placenta Jensen-Peña CL, Monk C, Champagne FA (2012). PLoS ONE 7(6):e39791.

18 Gestational Stress Gestational stress induces persistent decreases in postnatal maternal care Epigenetic Changes Within the Placenta Altered Gene Expression in Placenta & Brain Altered Postnatal Mother-Infant Interactions Heighted Stress Responsivity in Adulthood

19 BPA in the environment Bisphenol-A

20 Sex-Dependent & Dose-Dependent Effect of BPA on Estrogen Receptor Gene Expression Estrogen Receptor Alpha Estrogen Receptor Beta

21 Sex-Dependent & Dose-Dependent Effect of BPA on DNMT Gene Expression

22 Dose-Dependent Effect of BPA on Postnatal Maternal Behavior Pup Licking/Grooming Nursing

23

24 Postnatal Maternal Care Variation in Brain & Behavior

25

26 Frequency Distribution of Maternal Licking & Grooming of Dams 300 LOW LG HIGH LG % time spent licking/grooming pups

27 stress responsivity response to reward natural variations in maternal care High vs. Low levels of licking/grooming stimulation of pups cognition social behavior

28 % Licking/Grooming of Female Offspring Mother & Offspring LG Behavior *** low mid high Licking/Grooming Status of Mother Champagne et al. Physiology & Behavior (2003)

29 HIGH LG LOW LG medial preoptic area of the hypothalamus Oxytocin Receptor Density Estrogen Sensitivity Estrogen Receptor Alpha mrna Francis et al. J Neuroendocrinol (2000); Champagne et al. PNAS (2001); Champagne et al. Endocrinology (2003); Champagne et al. Endocrinology (2006)

30 Gene Expression During Development

31 ER Methylation in Response to Rearing Environment Offspring reared by Low LG Dam cccctctgctagtgtgacacacttcgc M gcaactccgcagttggcgggcgcgg M M accacccctgcggctctgccggctgg M ctgtcaccctcgggggctctggctgc M cgacccacgggcgggctccgagcg M M gttccaagcctcggagtgggcgggg M M gcg ggaggg agcctggg agaa Offspring reared by High LG Dam cccctctgctagtgtgacacacttcgc gcaactccgcagttggcgggcgcgg accacccctgcggctctgccggctgg M ctgtcaccctcgggggctctggctgc M cgacccacgggcgggctccgagcg gttccaagcctcggagtgggcgggg gcg ggaggg agcctggg agaa Champagne et al. Endocrinology (2006)

32 DNA Methylation During Development

33 Frequency of LG is associated with preference for pups by juveniles * Genetic manipulations of estrogen receptor alpha alters these outcomes

34 Correlation between mother, offspring, and grand-offspring LG

35 Champagne et al. Frontiers in Neuroendocrinology (2008)

36 Can social experiences later on in life alter the trajectory predicted by the effects of earlier experiences? Mother s Phenotype Juvenile Environment Offspring Phenotype Grand-Offspring Phenotype LOW LOW LOW LOW LOW LOW HIGH HIGH HIGH HIGH HIGH HIGH Champagne & Meaney Behavioral Neuroscience (2007)

37

38 Can fathers also influence the development of their offspring? Typical studies focus on species that have exclusive paternal care of offspring or species that are bi-parental in offspring care (very rare)

39 Males Transmit the Effects of Social Instability Across Generations anxiety-like phenotype social deficits stress exposed S F0 S F0 S F1 C S F1 S F1 C S F1 SC F2 SC F2 S F2 C S F2 CS F2 C CS F2 CS F3 CS F3 CCS F3 CCS F3 Saavedra-Rodriguez & Feig (2012) Biological Psychiatry

40 How can fathers influence the development of their offspring? Paternal Influences via Maternal Care 1) Effects of paternally-expressed genes on mother-infant interactions 2) Evidence that the social experiences of males can influence the maternal investment provided to their offspring

41 TISSUE SPECIFICITY OF EPIGENETIC MODIFICATIONS Medial Preoptic Area Ventral Medial Hypothalamus

42 High LG Low LG ventral medial hypothalamus Estrogen Receptor Alpha-IR decreased sexual receptivity increased sexual receptivity

43 Adult Female Sexual Behavior as a Function of Early Life Maternal Care Cameron et al., (2008) Plos ONE

44 Reproductive Strategies tactile stimulation high low high levels of investment in fewer offspring low levels of investment in many offspring

45 What factors induce epigenetic changes? neglect stress abuse Epigenetic Variation nurturing smoking drug use pesticides nutrition hormones

46 Plasticity vs. Stability

47 Thanks Columbia University James P. Curley Rahia Mashoodh Cate Jensen Emily Jordan Zoe Donaldson Marija Kundakovic Kathryn Gudsnuk Columbia Center for Children s Environmental Health Rachel Miller Frederica P. Perera Columbia University Catherine Monk Ben Tycko Canadian Institutes of Health Research NIH Director's New Innovator Award Centers for Children's Environmental Health & Disease Prevention Research