Early Environmental Regulation of Gene Expression: How Early Experience Exerts a Sustained Influence on Neuronal Function

Transcription

1 Early Environmental Regulation of Gene Expression: How Early Experience Exerts a Sustained Influence on Neuronal Function Michael J Meaney Douglas Mental Health University Institute McGill University and Singapore Institute for Clinical Sciences michael.meaney@mcgill.ca Summary The experience of the child is biologically embedded and serves to influence health and capacity over the lifespan. Copyright 2013 Michael J. Meaney 1

2 Summary The experience of the child is biologically embedded and serves to influence health and capacity over the lifespan. This effect is apparent even at the level of the DNA of the individual; the activity of genes implicated in brain development and function are directly regulated by the social environment. Summary The experience of the child is biologically embedded and serves to influence health and capacity over the lifespan. This effect is apparent even at the level of the DNA of the individual; the activity of genes implicated in brain development and function are directly regulated by the social environment. This effect is potentially stable over time; the imprint of of childhood adversity on the genome is apparent at later ages, providing a biological basis for an enduring effect on health and capacity. Copyright 2013 Michael J. Meaney 2

3 The development of an individual is an active process of adaptation that occurs within a social and economic context: To resource (food, shelter, safety) availability. To social interactions (e.g., parental signals). The development of an individual is an active process of adaptation that occurs within a social and economic context: To resource (food, shelter, safety) availability. To social interactions. This influence is apparent in the epigenetic mechanisms that regulate genomic structure and function Copyright 2013 Michael J. Meaney 3

4 Developmental Origins of Adult Disease Early experience Abuse Family strife Emotional neglect Harsh discipline Health Risks Depression Drug abuse Anxiety Diabetes Heart disease Obesity How does family life influence health over the life span? Early experience Abuse Family strife Emotional neglect Harsh discipline Health Risks Depression Drug abuse Anxiety Diabetes Heart disease Obesity Individual differences in neural and endocrine responses to stress (defensive responses Copyright 2013 Michael J. Meaney 4

5 Poverty Early experience Abuse Family strife Emotional neglect Harsh discipline Health Risks Depression Drug abuse Anxiety Diabetes Heart disease Obesity Individual differences in neural and endocrine responses to stress Evolutionary biology - Maternal effects Environmental Parental Developmental condition signal outcome Nutrient Supply Mate Quality Violence Infection Population density Parental investment Defensive Strategies Foraging/Metabolism Reproductive Strategies Robert Hinde: Evolution has shaped the young to use parental signals as a forecast of the quality of the environment into which they have been born. For most species, there is no single, optimal phenotype. Copyright 2013 Michael J. Meaney 5

6 Adversity Early experience Abuse Family strife Emotional neglect Harsh discipline Health and Human Capacity Individual differences in neural and endocrine responses to stress Environmental regulation of phenotypic variation What is the biological basis for programming effects whereby environmental signals acting over perinatal development associate with stable changes in transcription and complex phenotypes (physiology, behaviour)? Copyright 2013 Michael J. Meaney 6

7 Summary Parental care affects the activity of genes in the brain that regulate stress responses, neural development and reproduction. This parental effect involves a form a plasticity at the level of the DNA. Epigenetics: Any functional change in the genome that does not involve an alteration of DNA sequence. If they ask you anything you don t know, just say its due to epigenetics. Copyright 2013 Michael J. Meaney 7

8 + - Prevents TF binding to DNA TF binding involves alteration of chromatin structure Nucleosome core particle: ribbon traces for the 146-bp DNA phosphodiester backbones (brown and turquoise) and eight histone protein chains (Luger et al. Nature 1997). Copyright 2013 Michael J. Meaney 8

9 + - Prevents TF binding to DNA TF binding involves alteration of chromatin structure Nucleosome core particle: ribbon traces for the 146-bp DNA phosphodiester backbones (brown and turquoise) and eight histone protein chains (Luger et al. Nature 1997). Acetyl group B. Turner. Chromatin structure and gene regulation Copyright 2013 Michael J. Meaney 9

10 + - Prevents TF binding to DNA TF binding involves alteration of chromatin structure Nucleosome core particle: ribbon traces for the 146-bp DNA phosphodiester backbones (brown and turquoise) and eight histone protein chains (Luger et al. Nature 1997). Copyright 2013 Michael J. Meaney 10

11 Genetic code is defined by the sequence of four nucleotides that produce proteins. C T A C G T A C T C G G A A T C T C G RNAs, proteins Epigenetic effects refer to modifications of the DNA that alter the activity of the gene, but not its function. C T A C G T A C T C G G A A T C T C G Copyright 2013 Michael J. Meaney 11

12 DNA Methylation can inhibit gene expression by blocking transcription factor binding MeCP2/ MBD2 Methylated DNA binding protein SIN3a HDAC SINHDAC MeCP2/ MBD2 HDAC: Histone deacetylase HDAC B. Turner. Chromatin structure and gene regulation Copyright 2013 Michael J. Meaney 12

13 + - Prevents TF binding to DNA TF binding involves alteration of chromatin structure Nucleosome core particle: ribbon traces for the 146-bp DNA phosphodiester backbones (brown and turquoise) and eight histone protein chains (Luger et al. Nature 1997). Multiple phenotypes from a common genotype Every cell in your body has the same nuclear genes, but? Copyright 2013 Michael J. Meaney 13

14 Maternal licking/grooming Environmental epigenetics hypothesis: Environmental events activate intracellular signals that remodel the epigenome, leading to sustained alterations in the structure and function of the genome, and thus stable effects on gene transcription. Parental signals as a source of phenotypic plasticity? Parental care Epigenetic marks Gene Phenotype expression Copyright 2013 Michael J. Meaney 14

15 Parental signals as a source of phenotypic plasticity? Parental care Epigenetic marks Gene Phenotype expression Maternal licking/grooming Source of tactile stimulation/nurturance: Enhances activity of endocrine systems (e.g., GH/IGF) that promote somatic growth, suppresses those (glucocorticoids) that inhibit growth Copyright 2013 Michael J. Meaney 15

16 Variations in maternal care 200 Frequency count % Licking/grooming Broad range of parental effects Stress responses Neural development Learning & memory Metabolism Reproduction (females) Copyright 2013 Michael J. Meaney 16

17 High LG Low LG Parental signals as a source of phenotypic plasticity? Parental care Epigenetic marks Gene Phenotype expression Copyright 2013 Michael J. Meaney 17

18 Broad range of parental effects Stress responses Neural development Learning & memory Metabolism Reproduction (females) Copyright 2013 Michael J. Meaney 18

19 Glucocorticoid Receptor Stress Hippocampus (-) CRF/AVP Hypothalamus Pituitary ACTH Adrenals Glucocorticoids CRF: corticotropin releasing factor. ACTH: adrenocorticotropin Individual differences in glucocorticoid receptor levels lead to altered pituitary-adrenal responses to stress High LG offspring Low LG offspring (-) (-) (-) (-) CRF ACTH Hypothalamus Pituitary CRF ACTH Hypothalamus Pituitary Adrenals Glucocorticoids Adrenals Glucocorticoids Copyright 2013 Michael J. Meaney 19

20 High LG offspring show more modest HPA stress responses Plasma ACTH (pg/ml) High LG Low LG Corticosterone (µg/dl) High LG Low LG 0 Pre S10 S20 P20 P40 P60 P120 0 Pre Disruption of hippocampal GR signaling eliminates this maternal effect Cross-fostering reveals evidence for direct, postnatal effects of maternal care High LG offspring Low LG offspring (-) (-) (-) (-) Hypothalamus Hypothalamus CRF Pituitary CRF Pituitary ACTH ACTH Adrenals Glucocorticoids Adrenals Glucocorticoids Copyright 2013 Michael J. Meaney 20

21 Hippocampal GR(1 7 ) mrna Hippocampal GR(1 7 ) mrna High LG Low LG Relative ODU DG CA1 CA2 CA3 Copyright 2013 Michael J. Meaney 21

22 DNA sites that regulate glucocorticoid receptor gene Variable exon 1 region Constant region GR Promoter Sequence ccc 1741 ctctgctagt gtgacacact t 1 cg 2 cgcaact c 3 cgcagttgg 4 cggg 5 cg 6 cgga ccacccctg 7 c 1801 ggctctgc 8 cg gctggctgtc accct 9 cgggg gctctggctg c 10 cgaccca 11 cg ggg 12 cgggct 1861 c 13 cgag 14 cggtt ccaagcct 15 cg gagtggg 16 cg gggg 17 cgggag ggagcctggg agaa NGFI-A NGFI-A regulates GR gene expression NGFI-A GR gene GR mrna Copyright 2013 Michael J. Meaney 22

23 NGFI-A 5 tgcgggggcgggg 3 c-methylation * Low LG High LG NGFI-A site NGFI-A 5 tgcgggggcgggg 3 5' CpG region of NGFI-A/RE 0.8 c-methylation Low/Low High/High Low/High High/Low Copyright 2013 Michael J. Meaney 23

24 DNA Methylation can inhibit gene expression by blocking transcription factors binding MeCP2/ MBD2 Methylated DNA binding protein MeCP2/ CH MBD2 3 SIN HDAC SINHDAC HDAC: Histone deacetylase HDAC B. Turner. Chromatin structure and gene regulation Copyright 2013 Michael J. Meaney 24

25 Increased methylation of the exon 1 7 GR promoter associates with decreased H3K9ac, reduced NGFI-A binding and GR expression Histone Acetylation NGFI-A Association GR Expression Antibody/Input GR IR (ROD-IOD) High Low High Low High Low Effects are reversed with intra-hippocampal infusion of HDAC inhibitor Glucocorticoid stress response Low/Veh Low/TSA High/Veh High/TSA 50 Corticosterone ( µg/dl) Low/Veh Basal Stress Stress + 40 Stress + 60 Stress + 90 High/TSA Low/TSA High/Veh Time (min) Copyright 2013 Michael J. Meaney 25

26 Offspring of Low LG mothers GGAGCCTGGGAGAACCAAGCCTCGGAGTGGGCGGGGGCGGGAG Lower levels of GR in hippocampus - Increased stress response Offspring of High LG mothers GGAGCCTGGGAGAACCAAGCCTCGGAGTGGGCGGGGGCGGGAG High levels of GR in hippocampus - Modest stress response Summary of in vivo and in vitro studies Tactile stimulation (maternal LG) (T 4 -T 3 ) 5-HT 5-HT7 receptor camp SP1 PKA CBP SP1 NGFI-A CBP CpGme Exon 1 7 promoter NGFI-A (egr-1, zif-268, krox-24) Copyright 2013 Michael J. Meaney 26

27 5-HT 5-HT7 rec SP1 camp PKA CBP SP1 NGFI-A CBP GR gene CH CH 3 3 C T A C G T A C T C G G A A T C T C G Do comparable processes occur in humans? Post-mortem studies of hippocampus. Samples from suicide victims/controls. QSBB (Gustavo Turecki) forensic phenotyping. Human exon 1F promoter (Turner & Muller, 2005) Copyright 2013 Michael J. Meaney 27

28 Human glucocorticoid receptor gene Variable exon 1 region Constant region A B CD E F G H I J Exon 1 F is the human ortholog of the rat exon 1 7 GR promoter (70% homology) and contains an NGFI-A consensus sequence. Human glucocorticoid receptor gene Variable exon 1 region Constant region A B C DE F G H I J GR mrna GR total Control Suicide GR 1-F variants 1.2 GR1 F Control Suicide Copyright 2013 Michael J. Meaney 28

29 Suicide vs abuse - GR expression GR total GR1 F GR mrna/gapdh (log conc.) * Control Suicide Suicide - Abuse + Abuse GR-1F mrna/gapdh (log conc.) * Control Suicide Suicide - Abuse + Abuse Suicide vs abuse - CpG methylation GR 1-F CpG Methylation (%) * Control Suicide Suicide - Abuse + Abuse Copyright 2013 Michael J. Meaney 29

30 Controls Maltreatment (-) (-) (-) (-) Hypothalamus CRF ACTH Pituitary CRF ACTH Hypothalamus Pituitary Adrenals Glucocorticoids Adrenals Glucocorticoids Childhood maltreatment associates with increased central CRF levels and greater HPA and autonomic responses to stress (DeBellis et al 1994; Heim et al 2000; Lee et al 2005) Childhood adversity and NR3C1 promoter methylation in DNA from periperhal samples Copyright 2013 Michael J. Meaney 30

31 How does family life influence health over the life span? Early experience Abuse Family strife Emotional neglect Harsh discipline Health Risks Depression Drug abuse Anxiety Diabetes Heart disease Obesity Individual differences in neural and endocrine responses to stress (defensive responses Childhood adversity and NR3C1 promoter methylation in DNA from periperhal samples Copyright 2013 Michael J. Meaney 31

32 Attachment at 18 months (Secure Vs Insecure) associates with epigenetic variation (6-8 yrs) 612 probes. 5% (p<0.05) 345 genes Secure: Insecure: Microtubule formation TBCD (23.89%: Body) ABR (21.35%: Body) LTP CEBPE (19.70%: TSS200) SHANK2 (9.4%: 1 st Exon) DRD4 (5.76%: Body) Synaptic density Reference 1: ADHDgene Database (I) 64 Copyright 2013 Michael J. Meaney 32

33 Reference 1: ADHDgene Database (II) 213 Genes in the ADHDgene database (24 Genes are hot genes) 36 Probes (25 Genes) of ADHD database genes are found in the 2907 DMPs list. ADRA1A ANK3 ARRB2 ATXN1 BAIAP2 BAIAP2 BAIAP2 BAIAP2 BAIAP2 BDNF CACNA1C CDH13 CHRNA4 CHRNA4 COMT DBH DRD4 EMP2 FGF10 GNAO1 HK1 HLA DRB1 ITGA11 MEIS2 MEIS2 NCKAP5 PTPRG PTPRG SH3BP5 SH3BP5 SLC6A3 UNC5B UNC5B ZNF423 ZNF423 ZNF423 Child attention problems and co-methylation Child attention problems (SDQ) associated with differential methylation of 1747 probes (957 genes). 30 probes (22 genes) associated with child attention problems (-0.3 < r >0.3) show comethylation (-0.6 < r >0.6). r s = -0.36, p=0.02 r s = 0.36, p=0.02 r s = -0.64, p<0.001 Copyright 2013 Michael J. Meaney 33

34 7 Genes(GO) + 94 Genes(Pathway) Probes-- Hierarchical clustering of pair-wise correlation Pair-wise Correlation 1 DMPs The Most highly correlated cluster (30 probes, Avg Corr=0.8) DMPs Co-methylation Clusters The partial mediating role of maternal psychopathology p = Maternal depression (36 months) p = Maternal emotional neglect p = 0.01 Child Maternal negative emotionality depression (36 (36 moths) months) Copyright 2013 Michael J. Meaney 34

35 The partial mediating role of maternal psychopathology p = Maternal depression (36 months) p = Maternal emotional neglect p = 0.01 (Parenting) Child Maternal negative emotionality depression (36 (36 moths) months) Do effective treatment programs that target mothers affect DNA methylation profiles in the children? Copyright 2013 Michael J. Meaney 35

36 90 Unique Samples Infinium 450K Array Blood Samples 27 years old Variables: methy_grp (0= control/no treatment ;1=intervention) ETXGROUP: 1 and 2 = different forms of no treatment versus 3 and 4 which represent prenatal intervention and combined pre and postnatal intervention, respectively CHILDGENDER 1=male 2=female Child Abuse at age 4 and age 15 Child abuse is physical, sexual or emotional mistreatment or neglect Principal Component Analysis Component Fstat p Gender (3.0%) x 10-8 Abuse/4 yrs (3%) x 10-2 Abuse/15yrs 1.67 ns Copyright 2013 Michael J. Meaney 36

37 Principal Component Analysis Component Fstat p Gender (3%) x 10-8 Abuse/4 yrs (3%) x 10-2 Abuse/15yrs 1.67 ns Treatment (8%) x 10-4 Conclusions The function of the genome is regulated by epigenetic signals that are subject to environmental regulation. These epigenetic signals reflect the quality of the dearly environment, and guide the development and function of the brain. These effects are potentially stable, but are subject to modification, potentially over the lifespan. Copyright 2013 Michael J. Meaney 37

38 Family Family Transgenerational influences Family Family Parentchild Parentchild Parentchild Parentchild Transgenerational influences Copyright 2013 Michael J. Meaney 38

39 Family Family Parentchild Parentchild Transgenerational influences Response to snake odours 4 Tongue-Flick Offspring are significantly larger and with longer tails 0 Control Perfume Snake Copyright 2013 Michael J. Meaney 39

40 Defense to snake predation in skink lizards Most frequent prey smaller shorter tails less reactive to snake cues If mother has been exposed to the scent of a predatory snake then offspring are larger, with longer tails and. Evolutionary biology - Maternal effects Environmental Parental Developmental condition signal outcome Nutrient Supply Mate Quality Violence Infection Population density Parental investment Defensive Strategies Foraging/Metabolism Reproductive Strategies Copyright 2013 Michael J. Meaney 40