Early Environmental Regulation of Gene Expression: How Early Experience Exerts a Sustained Influence on Neuronal Function
|
|
- Eustace Austin
- 6 years ago
- Views:
Transcription
1 Early Environmental Regulation of Gene Expression: How Early Experience Exerts a Sustained Influence on Neuronal Function Michael J Meaney Douglas Mental Health University Institute McGill University and Singapore Institute for Clinical Sciences michael.meaney@mcgill.ca Summary The experience of the child is biologically embedded and serves to influence health and capacity over the lifespan. Copyright 2013 Michael J. Meaney 1
2 Summary The experience of the child is biologically embedded and serves to influence health and capacity over the lifespan. This effect is apparent even at the level of the DNA of the individual; the activity of genes implicated in brain development and function are directly regulated by the social environment. Summary The experience of the child is biologically embedded and serves to influence health and capacity over the lifespan. This effect is apparent even at the level of the DNA of the individual; the activity of genes implicated in brain development and function are directly regulated by the social environment. This effect is potentially stable over time; the imprint of of childhood adversity on the genome is apparent at later ages, providing a biological basis for an enduring effect on health and capacity. Copyright 2013 Michael J. Meaney 2
3 The development of an individual is an active process of adaptation that occurs within a social and economic context: To resource (food, shelter, safety) availability. To social interactions (e.g., parental signals). The development of an individual is an active process of adaptation that occurs within a social and economic context: To resource (food, shelter, safety) availability. To social interactions. This influence is apparent in the epigenetic mechanisms that regulate genomic structure and function Copyright 2013 Michael J. Meaney 3
4 Developmental Origins of Adult Disease Early experience Abuse Family strife Emotional neglect Harsh discipline Health Risks Depression Drug abuse Anxiety Diabetes Heart disease Obesity How does family life influence health over the life span? Early experience Abuse Family strife Emotional neglect Harsh discipline Health Risks Depression Drug abuse Anxiety Diabetes Heart disease Obesity Individual differences in neural and endocrine responses to stress (defensive responses Copyright 2013 Michael J. Meaney 4
5 Poverty Early experience Abuse Family strife Emotional neglect Harsh discipline Health Risks Depression Drug abuse Anxiety Diabetes Heart disease Obesity Individual differences in neural and endocrine responses to stress Evolutionary biology - Maternal effects Environmental Parental Developmental condition signal outcome Nutrient Supply Mate Quality Violence Infection Population density Parental investment Defensive Strategies Foraging/Metabolism Reproductive Strategies Robert Hinde: Evolution has shaped the young to use parental signals as a forecast of the quality of the environment into which they have been born. For most species, there is no single, optimal phenotype. Copyright 2013 Michael J. Meaney 5
6 Adversity Early experience Abuse Family strife Emotional neglect Harsh discipline Health and Human Capacity Individual differences in neural and endocrine responses to stress Environmental regulation of phenotypic variation What is the biological basis for programming effects whereby environmental signals acting over perinatal development associate with stable changes in transcription and complex phenotypes (physiology, behaviour)? Copyright 2013 Michael J. Meaney 6
7 Summary Parental care affects the activity of genes in the brain that regulate stress responses, neural development and reproduction. This parental effect involves a form a plasticity at the level of the DNA. Epigenetics: Any functional change in the genome that does not involve an alteration of DNA sequence. If they ask you anything you don t know, just say its due to epigenetics. Copyright 2013 Michael J. Meaney 7
8 + - Prevents TF binding to DNA TF binding involves alteration of chromatin structure Nucleosome core particle: ribbon traces for the 146-bp DNA phosphodiester backbones (brown and turquoise) and eight histone protein chains (Luger et al. Nature 1997). Copyright 2013 Michael J. Meaney 8
9 + - Prevents TF binding to DNA TF binding involves alteration of chromatin structure Nucleosome core particle: ribbon traces for the 146-bp DNA phosphodiester backbones (brown and turquoise) and eight histone protein chains (Luger et al. Nature 1997). Acetyl group B. Turner. Chromatin structure and gene regulation Copyright 2013 Michael J. Meaney 9
10 + - Prevents TF binding to DNA TF binding involves alteration of chromatin structure Nucleosome core particle: ribbon traces for the 146-bp DNA phosphodiester backbones (brown and turquoise) and eight histone protein chains (Luger et al. Nature 1997). Copyright 2013 Michael J. Meaney 10
11 Genetic code is defined by the sequence of four nucleotides that produce proteins. C T A C G T A C T C G G A A T C T C G RNAs, proteins Epigenetic effects refer to modifications of the DNA that alter the activity of the gene, but not its function. C T A C G T A C T C G G A A T C T C G Copyright 2013 Michael J. Meaney 11
12 DNA Methylation can inhibit gene expression by blocking transcription factor binding MeCP2/ MBD2 Methylated DNA binding protein SIN3a HDAC SINHDAC MeCP2/ MBD2 HDAC: Histone deacetylase HDAC B. Turner. Chromatin structure and gene regulation Copyright 2013 Michael J. Meaney 12
13 + - Prevents TF binding to DNA TF binding involves alteration of chromatin structure Nucleosome core particle: ribbon traces for the 146-bp DNA phosphodiester backbones (brown and turquoise) and eight histone protein chains (Luger et al. Nature 1997). Multiple phenotypes from a common genotype Every cell in your body has the same nuclear genes, but? Copyright 2013 Michael J. Meaney 13
14 Maternal licking/grooming Environmental epigenetics hypothesis: Environmental events activate intracellular signals that remodel the epigenome, leading to sustained alterations in the structure and function of the genome, and thus stable effects on gene transcription. Parental signals as a source of phenotypic plasticity? Parental care Epigenetic marks Gene Phenotype expression Copyright 2013 Michael J. Meaney 14
15 Parental signals as a source of phenotypic plasticity? Parental care Epigenetic marks Gene Phenotype expression Maternal licking/grooming Source of tactile stimulation/nurturance: Enhances activity of endocrine systems (e.g., GH/IGF) that promote somatic growth, suppresses those (glucocorticoids) that inhibit growth Copyright 2013 Michael J. Meaney 15
16 Variations in maternal care 200 Frequency count % Licking/grooming Broad range of parental effects Stress responses Neural development Learning & memory Metabolism Reproduction (females) Copyright 2013 Michael J. Meaney 16
17 High LG Low LG Parental signals as a source of phenotypic plasticity? Parental care Epigenetic marks Gene Phenotype expression Copyright 2013 Michael J. Meaney 17
18 Broad range of parental effects Stress responses Neural development Learning & memory Metabolism Reproduction (females) Copyright 2013 Michael J. Meaney 18
19 Glucocorticoid Receptor Stress Hippocampus (-) CRF/AVP Hypothalamus Pituitary ACTH Adrenals Glucocorticoids CRF: corticotropin releasing factor. ACTH: adrenocorticotropin Individual differences in glucocorticoid receptor levels lead to altered pituitary-adrenal responses to stress High LG offspring Low LG offspring (-) (-) (-) (-) CRF ACTH Hypothalamus Pituitary CRF ACTH Hypothalamus Pituitary Adrenals Glucocorticoids Adrenals Glucocorticoids Copyright 2013 Michael J. Meaney 19
20 High LG offspring show more modest HPA stress responses Plasma ACTH (pg/ml) High LG Low LG Corticosterone (µg/dl) High LG Low LG 0 Pre S10 S20 P20 P40 P60 P120 0 Pre Disruption of hippocampal GR signaling eliminates this maternal effect Cross-fostering reveals evidence for direct, postnatal effects of maternal care High LG offspring Low LG offspring (-) (-) (-) (-) Hypothalamus Hypothalamus CRF Pituitary CRF Pituitary ACTH ACTH Adrenals Glucocorticoids Adrenals Glucocorticoids Copyright 2013 Michael J. Meaney 20
21 Hippocampal GR(1 7 ) mrna Hippocampal GR(1 7 ) mrna High LG Low LG Relative ODU DG CA1 CA2 CA3 Copyright 2013 Michael J. Meaney 21
22 DNA sites that regulate glucocorticoid receptor gene Variable exon 1 region Constant region GR Promoter Sequence ccc 1741 ctctgctagt gtgacacact t 1 cg 2 cgcaact c 3 cgcagttgg 4 cggg 5 cg 6 cgga ccacccctg 7 c 1801 ggctctgc 8 cg gctggctgtc accct 9 cgggg gctctggctg c 10 cgaccca 11 cg ggg 12 cgggct 1861 c 13 cgag 14 cggtt ccaagcct 15 cg gagtggg 16 cg gggg 17 cgggag ggagcctggg agaa NGFI-A NGFI-A regulates GR gene expression NGFI-A GR gene GR mrna Copyright 2013 Michael J. Meaney 22
23 NGFI-A 5 tgcgggggcgggg 3 c-methylation * Low LG High LG NGFI-A site NGFI-A 5 tgcgggggcgggg 3 5' CpG region of NGFI-A/RE 0.8 c-methylation Low/Low High/High Low/High High/Low Copyright 2013 Michael J. Meaney 23
24 DNA Methylation can inhibit gene expression by blocking transcription factors binding MeCP2/ MBD2 Methylated DNA binding protein MeCP2/ CH MBD2 3 SIN HDAC SINHDAC HDAC: Histone deacetylase HDAC B. Turner. Chromatin structure and gene regulation Copyright 2013 Michael J. Meaney 24
25 Increased methylation of the exon 1 7 GR promoter associates with decreased H3K9ac, reduced NGFI-A binding and GR expression Histone Acetylation NGFI-A Association GR Expression Antibody/Input GR IR (ROD-IOD) High Low High Low High Low Effects are reversed with intra-hippocampal infusion of HDAC inhibitor Glucocorticoid stress response Low/Veh Low/TSA High/Veh High/TSA 50 Corticosterone ( µg/dl) Low/Veh Basal Stress Stress + 40 Stress + 60 Stress + 90 High/TSA Low/TSA High/Veh Time (min) Copyright 2013 Michael J. Meaney 25
26 Offspring of Low LG mothers GGAGCCTGGGAGAACCAAGCCTCGGAGTGGGCGGGGGCGGGAG Lower levels of GR in hippocampus - Increased stress response Offspring of High LG mothers GGAGCCTGGGAGAACCAAGCCTCGGAGTGGGCGGGGGCGGGAG High levels of GR in hippocampus - Modest stress response Summary of in vivo and in vitro studies Tactile stimulation (maternal LG) (T 4 -T 3 ) 5-HT 5-HT7 receptor camp SP1 PKA CBP SP1 NGFI-A CBP CpGme Exon 1 7 promoter NGFI-A (egr-1, zif-268, krox-24) Copyright 2013 Michael J. Meaney 26
27 5-HT 5-HT7 rec SP1 camp PKA CBP SP1 NGFI-A CBP GR gene CH CH 3 3 C T A C G T A C T C G G A A T C T C G Do comparable processes occur in humans? Post-mortem studies of hippocampus. Samples from suicide victims/controls. QSBB (Gustavo Turecki) forensic phenotyping. Human exon 1F promoter (Turner & Muller, 2005) Copyright 2013 Michael J. Meaney 27
28 Human glucocorticoid receptor gene Variable exon 1 region Constant region A B CD E F G H I J Exon 1 F is the human ortholog of the rat exon 1 7 GR promoter (70% homology) and contains an NGFI-A consensus sequence. Human glucocorticoid receptor gene Variable exon 1 region Constant region A B C DE F G H I J GR mrna GR total Control Suicide GR 1-F variants 1.2 GR1 F Control Suicide Copyright 2013 Michael J. Meaney 28
29 Suicide vs abuse - GR expression GR total GR1 F GR mrna/gapdh (log conc.) * Control Suicide Suicide - Abuse + Abuse GR-1F mrna/gapdh (log conc.) * Control Suicide Suicide - Abuse + Abuse Suicide vs abuse - CpG methylation GR 1-F CpG Methylation (%) * Control Suicide Suicide - Abuse + Abuse Copyright 2013 Michael J. Meaney 29
30 Controls Maltreatment (-) (-) (-) (-) Hypothalamus CRF ACTH Pituitary CRF ACTH Hypothalamus Pituitary Adrenals Glucocorticoids Adrenals Glucocorticoids Childhood maltreatment associates with increased central CRF levels and greater HPA and autonomic responses to stress (DeBellis et al 1994; Heim et al 2000; Lee et al 2005) Childhood adversity and NR3C1 promoter methylation in DNA from periperhal samples Copyright 2013 Michael J. Meaney 30
31 How does family life influence health over the life span? Early experience Abuse Family strife Emotional neglect Harsh discipline Health Risks Depression Drug abuse Anxiety Diabetes Heart disease Obesity Individual differences in neural and endocrine responses to stress (defensive responses Childhood adversity and NR3C1 promoter methylation in DNA from periperhal samples Copyright 2013 Michael J. Meaney 31
32 Attachment at 18 months (Secure Vs Insecure) associates with epigenetic variation (6-8 yrs) 612 probes. 5% (p<0.05) 345 genes Secure: Insecure: Microtubule formation TBCD (23.89%: Body) ABR (21.35%: Body) LTP CEBPE (19.70%: TSS200) SHANK2 (9.4%: 1 st Exon) DRD4 (5.76%: Body) Synaptic density Reference 1: ADHDgene Database (I) 64 Copyright 2013 Michael J. Meaney 32
33 Reference 1: ADHDgene Database (II) 213 Genes in the ADHDgene database (24 Genes are hot genes) 36 Probes (25 Genes) of ADHD database genes are found in the 2907 DMPs list. ADRA1A ANK3 ARRB2 ATXN1 BAIAP2 BAIAP2 BAIAP2 BAIAP2 BAIAP2 BDNF CACNA1C CDH13 CHRNA4 CHRNA4 COMT DBH DRD4 EMP2 FGF10 GNAO1 HK1 HLA DRB1 ITGA11 MEIS2 MEIS2 NCKAP5 PTPRG PTPRG SH3BP5 SH3BP5 SLC6A3 UNC5B UNC5B ZNF423 ZNF423 ZNF423 Child attention problems and co-methylation Child attention problems (SDQ) associated with differential methylation of 1747 probes (957 genes). 30 probes (22 genes) associated with child attention problems (-0.3 < r >0.3) show comethylation (-0.6 < r >0.6). r s = -0.36, p=0.02 r s = 0.36, p=0.02 r s = -0.64, p<0.001 Copyright 2013 Michael J. Meaney 33
34 7 Genes(GO) + 94 Genes(Pathway) Probes-- Hierarchical clustering of pair-wise correlation Pair-wise Correlation 1 DMPs The Most highly correlated cluster (30 probes, Avg Corr=0.8) DMPs Co-methylation Clusters The partial mediating role of maternal psychopathology p = Maternal depression (36 months) p = Maternal emotional neglect p = 0.01 Child Maternal negative emotionality depression (36 (36 moths) months) Copyright 2013 Michael J. Meaney 34
35 The partial mediating role of maternal psychopathology p = Maternal depression (36 months) p = Maternal emotional neglect p = 0.01 (Parenting) Child Maternal negative emotionality depression (36 (36 moths) months) Do effective treatment programs that target mothers affect DNA methylation profiles in the children? Copyright 2013 Michael J. Meaney 35
36 90 Unique Samples Infinium 450K Array Blood Samples 27 years old Variables: methy_grp (0= control/no treatment ;1=intervention) ETXGROUP: 1 and 2 = different forms of no treatment versus 3 and 4 which represent prenatal intervention and combined pre and postnatal intervention, respectively CHILDGENDER 1=male 2=female Child Abuse at age 4 and age 15 Child abuse is physical, sexual or emotional mistreatment or neglect Principal Component Analysis Component Fstat p Gender (3.0%) x 10-8 Abuse/4 yrs (3%) x 10-2 Abuse/15yrs 1.67 ns Copyright 2013 Michael J. Meaney 36
37 Principal Component Analysis Component Fstat p Gender (3%) x 10-8 Abuse/4 yrs (3%) x 10-2 Abuse/15yrs 1.67 ns Treatment (8%) x 10-4 Conclusions The function of the genome is regulated by epigenetic signals that are subject to environmental regulation. These epigenetic signals reflect the quality of the dearly environment, and guide the development and function of the brain. These effects are potentially stable, but are subject to modification, potentially over the lifespan. Copyright 2013 Michael J. Meaney 37
38 Family Family Transgenerational influences Family Family Parentchild Parentchild Parentchild Parentchild Transgenerational influences Copyright 2013 Michael J. Meaney 38
39 Family Family Parentchild Parentchild Transgenerational influences Response to snake odours 4 Tongue-Flick Offspring are significantly larger and with longer tails 0 Control Perfume Snake Copyright 2013 Michael J. Meaney 39
40 Defense to snake predation in skink lizards Most frequent prey smaller shorter tails less reactive to snake cues If mother has been exposed to the scent of a predatory snake then offspring are larger, with longer tails and. Evolutionary biology - Maternal effects Environmental Parental Developmental condition signal outcome Nutrient Supply Mate Quality Violence Infection Population density Parental investment Defensive Strategies Foraging/Metabolism Reproductive Strategies Copyright 2013 Michael J. Meaney 40
Early Environmental Regulation of Gene Expression: How Early Experience Exerts a Sustained Influence on Neuronal Function
Early Environmental Regulation of Gene Expression: How Early Experience Exerts a Sustained Influence on Neuronal Function Michael J Meaney Douglas Mental Health University Institute McGill University and
More informationSunday 26 o C sunny. Tuesday -3 o C snow
Sunday 26 o C sunny Tuesday -3 o C snow Maternal regulation of neural development and cognitive function Dong Liu Tim Bredy (Queensland Brain Inst) Danielle Champagne (Lieden) Rose Bagot Tie-Yuan Zhang
More informationWhat is Epigenetics? Eva Jablonka. Five Mothers by Anna Zeligowski
What is Epigenetics? Eva Jablonka Five Mothers by Anna Zeligowski Epigenetics the branch of biology which studies the causal interactions between genes and their products which bring the phenotype into
More informationEpigenetics and trauma
Epigenetics and trauma Influence of trauma on mental health Patrick McGowan, PhD Biological Sciences, UTSC Cell and Systems Biology, Psychology University of Toronto patrick.mcgowan@utoronto.ca Leuven,
More informationEpigenetics and the Environmental Regulation of the Genome and Its Function
I ANRV398-PS61-19 ARI 14 September 2009 18:17 R E V I E W S E C N A D V A N Epigenetics and the Environmental Regulation of the Genome and Its Function Tie-Yuan Zhang and Michael J. Meaney Sackler Program
More informationEpigenetic Pathways Linking Parental Effects to Offspring Development. Dr. Frances A. Champagne Department of Psychology, Columbia University
Epigenetic Pathways Linking Parental Effects to Offspring Development Dr. Frances A. Champagne Department of Psychology, Columbia University Prenatal & Postnatal Experiences Individual differences in brain
More informationEpigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1
Epigenetics: The Future of Psychology & Neuroscience Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Nature versus Nurture Despite the belief that the Nature vs. Nurture
More informationEarly-life adversity and long-term neurobehavioral outcomes: epigenome as a bridge?
Vaiserman and Koliada Human Genomics (2017) 11:34 DOI 10.1186/s40246-017-0129-z REVIEW Early-life adversity and long-term neurobehavioral outcomes: epigenome as a bridge? Alexander M. Vaiserman * and Alexander
More informationThe molecular bases of the suicidal brain
The molecular bases of the suicidal brain Gustavo Turecki Abstract Suicide ranks among the leading causes of death around the world and takes a heavy emotional and public health toll on most societies.
More informationEpigenetic Inheritance
(2) The role of Epigenetic Inheritance Lamarck Revisited Lamarck was incorrect in thinking that the inheritance of acquired characters is the main mechanism of evolution (Natural Selection more common)
More informationDNA and Histone Methylation in Learning and Memory
EXPERIMENTAL BIOLOGY ANNUAL MEETING April 2010 DNA and Histone Methylation in Learning and Memory J. David Sweatt Dept of Neurobiology McKnight Brain Institute UAB School of Medicine The Molecular Basis
More informationEpigenetic Variation in Human Health and Disease
Epigenetic Variation in Human Health and Disease Michael S. Kobor Centre for Molecular Medicine and Therapeutics Department of Medical Genetics University of British Columbia www.cmmt.ubc.ca Understanding
More informationHow does adversity in childhood get under the skin
How does adversity in childhood get under the skin What can we learn from neuroscience and epigenetics? Eamon McCrory Professor of Developmental Neuroscience & Psychopathology, UCL Consultant Clinical
More informationEpigenetic processes are fundamental to development because they permit a
Early Life Nutrition and Epigenetic Markers Mark Hanson, PhD Epigenetic processes are fundamental to development because they permit a range of phenotypes to be formed from a genotype. Across many phyla
More informationAN INTRODUCTION TO EPIGENETICS DR CHLOE WONG
AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG MRC SGDP CENTRE, INSTITUTE OF PSYCHIATRY KING S COLLEGE LONDON Oct 2015 Lecture Overview WHY WHAT EPIGENETICS IN PSYCHIARTY Technology-driven genomics research
More informationTrauma and Stress: Neurobiology and the Impact on Development
Trauma and Stress: Neurobiology and the Impact on Development https://www.cbsnews.com/news/oprah winfrey treatingchildhood trauma ELIZABETH REEVE MD HEALTHPARTNERS MEDICAL GROUP Why is This Topic Important?
More informationBiochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure
Biochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure Frederick E. Domann, Ph.D. Associate Professor of Radiation Oncology The University of Iowa Iowa City,
More informationEpigenetic and Neurodevelopmental Perspectives on Variation in Parenting Behavior
Parenting Science and Practice ISSN: 1529-5192 (Print) 1532-7922 (Online) Journal homepage: http://www.tandfonline.com/loi/hpar20 Epigenetic and Neurodevelopmental Perspectives on Variation in Parenting
More informationAre you the way you are because of the
EPIGENETICS Are you the way you are because of the It s my fault!! Nurture Genes you inherited from your parents? Nature Experiences during your life? Similar DNA Asthma, Autism, TWINS Bipolar Disorders
More informationCURRENT DIRECTIONS IN PSYCHOLOGICAL SCIENCE
CURRENT DIRECTIONS IN PSYCHOLOGICAL SCIENCE Maternal Care and Individual Differences in Defensive Responses Carine Parent, Tie-Yuan Zhang, Christian Caldji, Rose Bagot, Frances A. Champagne, Jens Pruessner,
More informationSocioeconomic status and the brain: mechanistic insights from human and animal research
University of Pennsylvania ScholarlyCommons Neuroethics Publications Center for Neuroscience & Society 9-1-2010 Socioeconomic status and the brain: mechanistic insights from human and animal research Daniel
More informationNature and Nurture? The intergenerational risk of transmission for chronic illness. Michael Meaney
GCPH Seminar Series 6 Seminar 1 Tuesday 15 December 2009 Nature and Nurture? The intergenerational risk of transmission for chronic illness Michael Meaney Harry Burns, Chair: Okay, ladies and gentlemen
More informationTranscriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes
More informationThe Brain on Stress. How the social environment gets under the skin (Biological embedding over the lifecourse) Bruce S. McEwen, Ph.D.
The Brain on Stress How the social environment gets under the skin (Biological embedding over the lifecourse) Bruce S. McEwen, Ph.D. Alfred E. Mirsky Professor Head, Harold and Margaret Milliken Hatch
More informationIndex. F Fibrinogen, 2, 5 Fine tuning, 47 FK506 binding protein 5 (FKBP5), 23, 154 Functional magnetic resonance imaging (fmri), 51
A Adaptation chaotic/unpredictable environments, 38 child maltreatment, 37 childhood adversity, 32 childhood stress and unpredictability, 38 cognitive abilities, 40 contingency-based learning, 41 corticosteroid
More informationSearching for the Cause of Autism:
Searching for the Cause of Autism: How genetics and social experience may intersect Dr Lane Strathearn, MBBS FRACP PhD Professor, Department of Pediatrics, University of Iowa Physician Director, Center
More informationTrace Metals and Placental Methylation
Trace Metals and Placental Methylation Carmen J. Marsit, PhD Pharmacology & Toxicology Epidemiology Geisel School of Medicine at Dartmouth Developmental Origins Environmental Exposure Metabolic Cardiovascular
More informationChromatin Remodeling: A Novel Mechanism. of Psychotropic Drug Action
Molecular Pharmacology This article has Fast not been Forward. copyedited Published and formatted. The on final May version 25, 2006 may differ as doi:10.1124/mol.106.027078 from this version. Chromatin
More informationThe Resilient Revolution takes on
The Resilient Revolution takes on Attachment, Adverse Childhood Experiences(ACEs) and Neuroscience A Tale of Pathologies? Dr Derek Blincow Blackpool 2018 Grand Theory in Adversity and Child Development
More informationEpigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN
Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN Institute for Brain Disorders and Neural Regeneration F.M. Kirby Program in Neural
More informationBehavioral epigenetics and the developmental origins of child mental health disorders
Journal of Developmental Origins of Health and Disease (2012), 3(6), 395 408. & Cambridge University Press and the International Society for Developmental Origins of Health and Disease 2012 doi:10.1017/s2040174412000426
More informationA neurogenetics approach to understanding individual differences in brain, behavior, and risk for psychopathology
Molecular Psychiatry (2013) 18, 288 -- 299 All rights reserved 1359-4184/13 www.nature.com/mp EXPERT REVIEW A neurogenetics approach to understanding individual differences in brain, behavior, and risk
More informationEFFECTS OF STRESS ACROSS GENERATIONS: WHY SEX MATTERS
Commentary submitted to Biological Psychiatry EFFECTS OF STRESS ACROSS GENERATIONS: WHY SEX MATTERS Invited commentary on: Saavedra-Rodriguez L, Feig LA (2012): Chronic Social Instability Induces Anxiety
More informationPerinatal maternal alcohol consumption and methylation of the dopamine receptor DRD4 in the offspring: The Triple B study
Perinatal maternal alcohol consumption and methylation of the dopamine receptor DRD4 in the offspring: The Triple B study Elizabeth Elliott for the Triple B Research Consortium NSW, Australia: Peter Fransquet,
More information4/20/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Questions to Consider
Objectives Epigentics: You Might Be What Your Grandmother Ate Lynda Britton, Ph.D., MLS(ASCP) CM Professor LSU Health Shreveport Discuss epigenetics and its role in cancer, imprinting and X chromosome
More informationBehavioral epigenetics
Ann. N.Y. Acad. Sci. ISSN 0077-8923 ANNALS OF THE NEW YORK ACADEMY OF SCIENCES Issue: Annals Meeting Reports Barry M. Lester, 1 Edward Tronick, 2,3 Eric Nestler, 4 Ted Abel, 5 Barry Kosofsky, 6 Christopher
More informationJAI La Leche League Epigenetics and Breastfeeding: The Longterm Impact of Breastmilk on Health Disclosure Why am I interested in epigenetics?
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 JAI La Leche League Epigenetics and Breastfeeding: The Longterm Impact of Breastmilk on Health By Laurel Wilson, IBCLC, CLE, CCCE, CLD Author of The Greatest Pregnancy
More informationCOMT EFFECT ON AGGRESSION IN CHILDREN WITH & WITHOUT ADHD (British Cohort) blems (t-scores) Aggressive Behaviour Prob. n =
GENE-ENVIRONMENT ENVIRONMENT INTERDEPENDENCE By Michael Rutter 445oslo1109a 1 SOME BACKGROUND CONSIDERATIONS RE DISORDERS With rare exceptions, most mental disorders are multifactorial Heritability of
More informationCurrent Directions in the Study of Risk And Adversity in Early Childhood
Current Directions in the Study of Risk And Adversity in Early Childhood Annual Meeting of the North Carolina Psychiatric Association September 26, 2014 Charles H. Zeanah, M.D. Institute of Infant and
More informationFrom Genes to Behavior: Outline
Recap from last time A genes-eye-view of natural selection implies considering a trait s 1. effect on kin (inclusive fitness) 2. effect on mating success (sexual selection) Controversies remain about 1.
More informationJayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3
Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,
More informationEpigenetics 101 Why Grandmothers are Important
Epigenetics 101 Why Grandmothers are Important Dian Baker PhD, APRN, PNP dibaker@csus.edu Photo from: welcomebooks.com Learning Objectives Describe the basic concepts behind epigenetics Discuss why the
More informationFragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype
Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability
More informationEpigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
More information1/19/18. Questions to you by Alfredo & Bart. Epigenetic mechanisms regulate gene expression. Epigenetics & environmental exposures
Questions to you by Alfredo & Bart Epigenetics in Neurodegeneration: Contributor or Bystander? Prof. dr. Bart Rutten Neuroscience of Mental Illness Chair Department Psychiatry and Neuropsychology b.rutten@maastrichtuniversity.nl
More informationPreclinical and Clinical Evidence of DNA Methylation Changes in Response to Trauma and Chronic Stress.
Preclinical and Clinical Evidence of DNA Methylation Changes in Response to Trauma and Chronic Stress. Natalie Matosin, Max-Planck Institute of Psychiatry Cristiana Cruceanu, Max-Planck Institute of Psychiatry
More informationThe Effects of Fibroblast Growth Factor on Anxiety Induced by Maternal Care. Emily Lowry
Running head: FGF2, ANXIETY, AND MATERNAL CARE The Effects of Fibroblast Growth Factor on Anxiety Induced by Maternal Care By Emily Lowry A thesis submitted to the Faculty of Arts and Social Sciences in
More informationTranscriptional and Epigenetic Mechanisms of Addiction
Transcriptional and Epigenetic Mechanisms of Addiction Eric J. Nestler Mount Sinai School of Medicine New York, NY Dr. Ray Fuller There is every reason to be optimistic that in the future we will find
More informationStress and Emotion. Stressors are things that challenge homeostasis -- these challenges may be real or merely anticipated
Stress and Emotion 1 Stressors are things that challenge homeostasis -- these challenges may be real or merely anticipated Stress responses are what the body does about it 2 1 Two broad stressor categories
More informationGenetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
More informationDrug addicted mothers show reduced brain reward response to their infants: Can oxytocin reverse the trend?
Drug addicted mothers show reduced brain reward response to their infants: Can oxytocin reverse the trend? Dr. Lane Strathearn, MBBS FRACP PhD Stead Family Professor, Department of, University of Iowa
More informationHow social experiences influence the brain Frances A Champagne and James P Curley
How social experiences influence the brain Frances A Champagne and James P Curley Social experiences throughout life influence gene expression and behavior, however, early in development these influences
More informationAn epigenetic approach to understanding (and predicting?) environmental effects on gene expression
www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics
More informationSession 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology
Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Bhaskar Gollapudi, Ph.D The Dow Chemical Company Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches
More informationGene Expression DNA RNA. Protein. Metabolites, stress, environment
Gene Expression DNA RNA Protein Metabolites, stress, environment 1 EPIGENETICS The study of alterations in gene function that cannot be explained by changes in DNA sequence. Epigenetic gene regulatory
More informationEpigenetic Mechanisms
RCPA Lecture Epigenetic chanisms Jeff Craig Early Life Epigenetics Group, MCRI Dept. of Paediatrics Overview What is epigenetics? Chromatin The epigenetic code What is epigenetics? the interactions of
More informationThe Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.
The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D. What can happen to our gene(s) that would cause obesity? Modification via Epigenetic alterations C
More informationEpigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON
... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE
More informationEpigenetics and Chromatin Remodeling
Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory
More informationHow life events get under the skin : Implications for suicide prevention
How life events get under the skin : Implications for suicide prevention Gustavo Turecki MD PhD William Dawson Chair Douglas Hospital Research Centre McGill University Turecki et al Trends in Neurosciences
More informationMaternal care effects on the hippocampal transcriptome and anxiety-mediated behaviors in the offspring that are reversible in adulthood
Maternal care effects on the hippocampal transcriptome and anxiety-mediated behaviors in the offspring that are reversible in adulthood Ian C. G. Weaver*, Michael J. Meaney*, and Moshe Szyf *Douglas Hospital
More informationBrain Function and Chromatin Plasticity
Brain Function and Chromatin Plasticity The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Published Version Accessed
More informationEpigenetics, Behaviour, and Health
ORIGINAL ARTICLE Epigenetics, Behaviour, and Health Moshe Szyf, PhD and Michael J. Meaney, PhD The long-term effects of behaviour and environmental exposures, particularly during childhood, on health outcomes
More informationGenetic Contributors to Alcohol Use and Misuse in Young People
Genetic Contributors to Alcohol Use and Misuse in Young People Marianne BM van den Bree Professor of Psychological Medicine Institute of Psychological Medicine and Clinical Neurosciences MRC Centre for
More informationOverview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment
Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development
More informationMorphogens: What are they and why should we care?
Morphogens: What are they and why should we care? Historic, Theoretical Mechanism of Action Nucleoprotein: the specific trophic cellular material extracted from the cell nucleus. DNA and RNA which regulates
More informationCAREGIVER EXPERIENCES PRODUCE LASTING EPIGENETIC EFFECTS ON RAT HIPPOCAMPAL BDNF GENE ACTIVITY. Stephanie Matt
CAREGIVER EXPERIENCES PRODUCE LASTING EPIGENETIC EFFECTS ON RAT HIPPOCAMPAL BDNF GENE ACTIVITY by Stephanie Matt A thesis submitted to the Faculty of the University of Delaware in partial fulfillment of
More informationEukaryotic transcription (III)
Eukaryotic transcription (III) 1. Chromosome and chromatin structure Chromatin, chromatid, and chromosome chromatin Genomes exist as chromatins before or after cell division (interphase) but as chromatids
More informationEARLY BRAIN AND CHILDHOOD DEVELOPMENT
EARLY BRAIN AND CHILDHOOD DEVELOPMENT WILLIAM M BELLAS, DO, FAAP SANFORD CHILDREN S HOSPITAL DIVISION OF NEONATAL-PERINATAL MEDICINE CLINICAL ASSOCIATE PROFESSOR OF PEDIATRICS UND SCHOOL OF MEDICINE &
More informationMary Dozier University of Delaware
Mary Dozier University of Delaware Increase risk to nearly every negative outcome imaginable But probabilistic, not deterministic Increases risk, doesn t cause bad outcomes We can intervene But why so
More informationSocial and Emotional Influences on Physiological Stress in Infants, Children and Adolescents
Social and Emotional Influences on Physiological Stress in Infants, Children and Adolescents Emma K. Adam Program on Human Development and Social Policy School of Education and Social Policy Northwestern
More informationEpigenetics, Early Brain Development, and New Roles for Pediatricians. Colleen Kraft, M.D., FAAP President, American Academy of Pediatrics
Epigenetics, Early Brain Development, and New Roles for Pediatricians Colleen Kraft, M.D., FAAP President, American Academy of Pediatrics Faculty Disclosure Information: In the past 12 months, I have no
More information4/8/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Epigentics. Questions to Consider
Objectives Epigentics Lynda Britton, Ph.D., MLS(ASCP) CM Professor LSU Health Shreveport Discuss epigenetics and its role in cancer, imprinting and X chromosome inactivation. Describe the modifications/mechanisms
More informationThe Aboriginal Mental Health & Wellbeing Workforce Forum 2017 HOW CAN WE REDUCE THE RATES OF SUICIDE IN THE ABORIGINAL COMMUMITIES?
The Aboriginal Mental Health & Wellbeing Workforce Forum 2017 HOW CAN WE REDUCE THE RATES OF SUICIDE IN THE ABORIGINAL COMMUMITIES? The rate of suicide among young Indigenous men is the highest in the
More informationEpigenetic codes in cognition and behaviour
Available online at www.sciencedirect.com Behavioural Brain Research 192 (2008) 70 87 Review article Epigenetic codes in cognition and behaviour Johannes Gräff, Isabelle M. Mansuy Brain Research Institute,
More informationChromatin-Based Regulation of Gene Expression
Chromatin-Based Regulation of Gene Expression.George J. Quellhorst, Jr., PhD.Associate Director, R&D.Biological Content Development Topics to be Discussed Importance of Chromatin-Based Regulation Mechanism
More informationHistones modifications and variants
Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome
More informationThe Effects of Epigenetics on Stress Response
Themis: Research Journal of Justice Studies and Forensic Science Volume 4 Article 11 5-10-2016 The Effects of Epigenetics on Stress Response Kevin Suddarth Follow this and additional works at: http://scholarworks.sjsu.edu/themis
More informationThe Epigenome Tools 2: ChIP-Seq and Data Analysis
The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview
More informationStress and the aging brain
Stress and the aging brain Stress and the aging brain: What are the issues? Aging makes us less able to adjust to change Reactions of elderly to change generate stress Stress response involves acute reactions
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationBiological underpinnings of trauma and post-traumatic stress disorder: focusing on genetics and epigenetics
For reprint orders, please contact: reprints@futuremedicine.com Biological underpinnings of trauma and post-traumatic stress disorder: focusing on genetics and epigenetics Certain individuals are more
More information2007 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.
[Epigenetics 2:1, 22-28, January/February/March 2007]; 2007 Landes Bioscience Review Epigenetic Programming by Maternal Behavior and Pharmacological Intervention Nature Versus Nurture: Let s Call The Whole
More informationAn introduction to Epigenetics and Psychology
An introduction to Epigenetics and Psychology Dr Emma Meaburn e.meaburn@bbk.ac.uk Centre for Brain and Cognitive Development Department of Psychological Sciences Birkbeck, University of London Learning
More informationR. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS
R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A
More informationChromatin Structure & Gene activity part 2
Chromatin Structure & Gene activity part 2 Figure 13.30 Make sure that you understand it. It is good practice for identifying the purpose for various controls. Chromatin remodeling Acetylation helps to
More informationThe First R Relationships: How Love Builds Brains
The First R Relationships: How Love Builds Brains Jean Clinton BMus MD FRCP(C) McMaster University and Children s Hospital Department of Psychiatry and Behavioural Neurosciences Offord Centre for Child
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationWHATEVER IT TAKES! UNDERSTANDING ADVERSE CHILD EXPERIENCES. Nadine Burke Harris, MD, MPH CEO, Center for Youth Wellness March 1, 2013
WHATEVER IT TAKES! UNDERSTANDING ADVERSE CHILD EXPERIENCES Nadine Burke Harris, MD, MPH CEO, Center for Youth Wellness March 1, 2013 Effect of ACEs on Health, Learning & Behavior Background Brief overview
More informationImprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821
Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes
More informationEpigenetics: Basic Principals and role in health and disease
Epigenetics: Basic Principals and role in health and disease Cambridge Masterclass Workshop on Epigenetics in GI Health and Disease 3 rd September 2013 Matt Zilbauer Overview Basic principals of Epigenetics
More informationComorbidity Associated with FASD: A Behavioral Phenotype?
Comorbidity Associated with FASD: A Behavioral Phenotype? P.W. Kodituwakku, Ph.D. Departments of Pediatrics and Neurosciences School of Medicine University of New Mexico Significance of the study of comorbid
More informationSocial environmental effects on gene regulation
Cell. Mol. Life Sci. (2013) 70:4323 4339 DOI 10.1007/s00018-013-1357-6 Cellular and Molecular Life Sciences REVIEW Social environmental effects on gene regulation Jenny Tung Yoav Gilad Received: 12 February
More informationCh. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
More informationMATERNAL CARE, GENE EXPRESSION, AND THE TRANSMISSION OF INDIVIDUAL DIFFERENCES
Annu. Rev. Neurosci. 2001. 24:1161 192 Copyright c 2001 by Annual Reviews. All rights reserved MATERNAL CARE, GENE EXPRESSION, AND THE TRANSMISSION OF INDIVIDUAL DIFFERENCES IN STRESS REACTIVITYACROSS
More informationDifferent Types of Childhood Adverse Experiences and Mood Disorders
Different Types of Childhood Adverse Experiences and Mood Disorders 7 Alessandra Alciati Department of Psychiatry, Luigi Sacco University Hospital, Milan Italy 1. Introduction A growing body of studies
More informationDNA methylation and histone acetylation work in concert to regulate memory formation and synaptic plasticity
Available online at www.sciencedirect.com Neurobiology of Learning and Memory 89 (2008) 599 603 Brief Report DNA methylation and histone acetylation work in concert to regulate memory formation and synaptic
More informationTRAUMA AND TOXIC STRESS IN THE PEDIATRIC PATIENT:
TRAUMA AND TOXIC STRESS IN THE PEDIATRIC PATIENT: How to Appreciate, Assess and Address Heather C. Forkey, M.D. Foster Children Evaluation Service (FaCES) UMass Children s Medical Center Worcester MA Disclosure
More informationGoal: To identify the extent to which different aspects of psychopathology might be in some way inherited
Key Dates TH Mar 30 Unit 19; Term Paper Step 2 TU Apr 4 Begin Biological Perspectives, Unit IIIA and 20; Step 2 Assignment TH Apr 6 Unit 21 TU Apr 11 Unit 22; Biological Perspective Assignment TH Apr 13
More informationGene Regulation Part 2
Michael Cummings Chapter 9 Gene Regulation Part 2 David Reisman University of South Carolina Other topics in Chp 9 Part 2 Protein folding diseases Most diseases are caused by mutations in the DNA that
More information