A Novel Type of Splicing Enhancer Regulating Adenovirus Pre-mRNA Splicing

Transcription

1 A Novel Type of Splicing Enhancer Regulating Adenovirus Pre-mRNA Splicing Oliver Mühlemann, Bai-Gong Yue, Svend Petersen-Mahrt and Göran Akusjärvi Mol. Cell. Biol. 2000, 20(7):2317. DOI: /MCB REFERENCES CONTENT ALERTS Updated information and services can be found at: These include: This article cites 19 articles, 9 of which can be accessed free at: Receive: RSS Feeds, etocs, free alerts (when new articles cite this article), more» Downloaded from on March 5, 2014 by PENN STATE UNIV Information about commercial reprint orders: To subscribe to to another ASM Journal go to:

2 MOLECULAR AND CELLULAR BIOLOGY, Apr. 2000, p Vol. 20, No /00/$ Copyright 2000, American Society for Microbiology. All Rights Reserved. A Novel Type of Splicing Enhancer Regulating Adenovirus Pre-mRNA Splicing OLIVER MÜHLEMANN, BAI-GONG YUE, SVEND PETERSEN-MAHRT, AND GÖRAN AKUSJÄRVI* Department of Medical Biochemistry and Microbiology, BMC, Uppsala University, S Uppsala, Sweden Received 25 August 1999/Returned for modification 5 October 1999/Accepted 30 December 1999 Splicing of the adenovirus IIIa pre-mrna is subjected to a temporal regulation, such that efficient IIIa 3 splice site usage is confined to the late phase of the infectious cycle. Here we show that IIIa pre-mrna splicing is activated more than 200-fold in nuclear extracts prepared from late adenovirus-infected cells (Ad-NE) compared to uninfected HeLa cell nuclear extracts (HeLa-NE). In contrast, splicing of the -globin pre-mrna is repressed in Ad-NE. We constructed hybrid pre-mrnas between IIIa and -globin in order to identify the minimal IIIa sequence element conferring enhanced splicing in Ad-NE. Using this approach, we show that the IIIa branch site/pyrimidine tract functions as a Janus element: it blocks splicing in HeLa-NE and functions as a splicing enhancer in Ad-NE. Therefore, we named this sequence the IIIa virus infection-dependent splicing enhancer (3VDE). This element is essential for regulated IIIa pre-mrna splicing in Ad-NE and sufficient to confer an enhanced splicing phenotype to the -globin pre-mrna in Ad-NE. We further show that the increase in IIIa splicing observed in Ad-NE is not accompanied by a similar increase in U2AF binding to the IIIa pyrimidine tract. This finding suggests that splicing activation by the 3VDE may operate without efficient U2AF interaction with the pre-mrna. Importantly, this report represents the first description of a splicing enhancer that has evolved to function selectively in the context of a virus infection, a finding that adds a new level at which viruses may subvert the host cell RNA biosynthetic machinery to facilitate their own replication. * Corresponding author. Mailing address: Department of Medical Biochemistry and Microbiology, BMC, Uppsala University, Box 582, S Uppsala, Sweden. Phone: Fax: goran.akusjarvi@imim.uu.se. Present address: Institute of Cell Biology, University of Berne, 3012 Bern, Switzerland. Permanent address: Henan Bioproduct Institute, Zhengzhou , People s Republic of China. Present address: MRC LMB, Cambridge CB2 2QH, England. The temporal, developmental, and tissue-specific regulation of alternative pre-mrna splicing is an important feature of gene control employed by metazoan cells (reviewed in reference 22). Yet, how alternative splice site choice is regulated is in most cases still unknown; specific trans-acting factors and corresponding cis-acting sequence elements have been identified only for a few pre-mrnas. In a growing number of systems, members of the SR protein family (24) seem to be involved in regulation of alternative splicing, often by enhancing recognition of suboptimal splice sites through binding to exonic splicing enhancers (for reviews, see references 3, 14, and 21). Adenovirus gene expression is to a large extent regulated at the level of alternative pre-mrna splicing (reviewed in reference 6). We are using the adenovirus major late region 1 (L1) as a model pre-mrna to study the mechanisms controlling alternative splice site usage in adenovirus-infected cells. In the L1 unit, a common 5 splice site can be joined to two alternative 3 splice sites, resulting in the formation of the so-called 52,55K (proximal 3 splice site) and IIIa (distal 3 splice site) mrnas. Early during virus infection, the 52,55K 3 splice site is used exclusively, whereas the IIIa splice site becomes the preferred site late during virus infection (reviewed in reference 6). We have previously shown that IIIa splicing is negatively regulated by hyperphosphorylated SR proteins that bind to a 49-nucleotide-long intronic repressor element, the 3RE, located immediately upstream of the IIIa branch site (8). SR protein binding to the 3RE results in inhibition of IIIa splicing by preventing U2 snrnp recruitment to the spliceosome. In late virus-infected cells, the inhibitory effect of the 3RE on IIIa splicing is alleviated by a virus-induced dephosphorylation of SR proteins, rendering them nonfunctional as repressor proteins of IIIa splicing (9). Importantly, in our previous experiments we did not address whether SR protein dephosphorylation is sufficient to fully explain the enhanced IIIa splicing phenotype observed late during virus infection. It is noteworthy that the IIIa 3 splice site contains a short atypical pyrimidine tract that binds U2AF 65 inefficiently in vitro (17). This observation led us to consider the possibility that inactivation of the repressive activity of SR proteins on IIIa splicing might not be sufficient to explain the high IIIa splicing activity observed in late virusinfected cells. We therefore set out to search for additional IIIa sequence elements that contribute to the enhanced splicing phenotype of the IIIa pre-mrna in nuclear extract prepared from adenovirus-infected cells (Ad-NE). For these experiments we made use of the observation that -globin splicing is repressed in Ad-NE (17). Here we show that replacing the -globin branch site/polypyrimidine tract with the branch site and atypical pyrimidine tract from the IIIa pre-mrna is sufficient to convert -globin from a transcript that is repressed in splicing to a pre-mrna that is activated in Ad-NE. We refer to this sequence element as the IIIa virus infection-dependent splicing enhancer element (3VDE), since it functions as a splicing enhancer only in the context of the virus-infected extract. Collectively, our results show that the 3RE and the 3VDE are the critical elements controlling IIIa splicing in Ad-NE, with the 3VDE making the most significant contribution. We further show that enhanced splicing of the IIIa pre-mrna in Ad-NE is not mimicked by an increase in U2AF 65 interaction with the IIIa 3 splice site. This observation suggests that IIIa 2317

3 2318 MÜHLEMANN ET AL. MOL. CELL. BIOL. splicing may operate by a novel mechanism that does not require efficient U2AF recruitment to the IIIa 3 splice site. MATERIALS AND METHODS Plasmids and transcript synthesis. Plasmids IIIa, glob (the rabbit -globin first intron [5]), glob (3RE, 3VDE), glob (3RE), glob (3VDE), and IIIa (-3RE) have previously been described (8). Plasmids glob (IIIa-bp), glob (IIIa-py), IIIa (-3VDE), and IIIa (-3RE, 3VDE) were constructed by PCR cloning using appropriately positioned restriction endonuclease cleavage sites and designed primers. Plasmids IIIa-1G and IIIa-2G were reconstructed using synthetic double-stranded oligonucleotides. The nucleotide sequence of 3VDE is AGUACU AAGC_GGUGAUGUUUCUGAUCAG, and the corresponding -globin sequence is GUGCUGAC_UUCUCUCCCCUGGGCUGUUUUCAUUUUCUC AG. The branch sites are shown in bold, and the underlines show the break points used to construct hybrid transcripts glob (IIIa-bp) and glob (IIIa-py), respectively. All plasmid sequences were verified by DNA sequencing. Plasmid maps and sequences are available on request or at GA.html. Radiolabeled pre-mrnas were generated by T7 RNA polymerase transcription from PCR-amplified templates (16). A common forward primer, oligonucleotide T7-exon 1 (5 -ATTAATACGACTCACTATAGAATACAAGCTTGGG- 3 ; T7 promoter shown in boldface) was used in all PCRs. Reverse primers oligonucleotide -globin (5 -GAACCTCTGGGTCCATG-3 ) and oligonucleotide IIIa (5 -CCCGCACCGCCGGGTCC-3 ) yielded templates containing a 34-nucleotide-long second exon. In Fig. 1 (lanes 1 and 2), a reverse primer containing a second exon U1-enhancer (12, 23) (oligonucleotide IIIa-U1 [5 -G TACTCACCCCCAGCGCCGCCGCCCGCACC-3 ; bold indicates the U1 snrna binding site]) was used. In vitro splicing reactions. Nuclear extract preparation from uninfected (HeLa-NE) or late adenovirus-infected HeLa spinner cells was as previously described (10, 16). Splicing reaction mixtures were incubated at 30 C for 90 to 160 min in a total volume of 25 l containing 5 to 25 fmol of transcript, 40% nuclear extract, 2.6% polyvinyl alcohol, 12% glycerol, 12 mm HEPES (ph 7.9), 60 mm KCl, 2 mm ATP, 20 mm creatine phosphate, 0.3 mm dithiothreitol, and 2.5 mm MgCl 2. The optimal MgCl 2 concentration for IIIa splicing is 2.5 mm (O. Mühlemann, unpublished observation), and the splicing efficiency is two- to threefold lower in 3.2 mm MgCl 2 (the standard concentration used in most laboratories). Splicing of -globin is unaffected by MgCl 2 concentrations between 2 and 5 mm (unpublished observation). Following incubation, RNA was analyzed on denaturing 8% polyacrylamide gels. Dried gels were subjected to PhosphorImager quantification as previously described (10, 18). All splicing reactions were performed multiple times with at least three different batches of HeLa-NE and Ad-NE, and average values and standard deviations are shown. Prespliceosome formation. Standard splicing reactions were set up as described above except that polyvinyl alcohol was omitted and the amount of 32 P-labeled RNA was doubled. From the reactions, incubated at 30 C, aliquots were removed at different time points, mixed with heparin (final concentration, 0.5 g/ l) and resolved on a 4% (84:1 acrylamide/diacrylylpiperazine) native polyacrylamide gel, which was cast in a buffer containing 50 mm Tris-glycine and 5% glycerol. In the running buffer, glycerol was omitted. U2 snrna depletion. Oligonucleotide-directed RNase H cleavage of U2 snrnp in Ad-NE was done exactly as described elsewhere (13). An aliquot of the cleaved extract was used to verify, by Northern blotting, that the RNase H treatment effectively destroyed the designated U snrna, the remaining of the extract was used for splicing assay. Oligonucleotide E15 (2) directed against the 5 end of U2 snrna was used in the depletion reaction. Mock depletion of Ad-NE was performed in the absence of oligonucleotide. Western blot. One, 3, and 10 l of HeLa-NE (9 mg/ml) and Ad-NE (9 mg/ml) were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 12% gel under reducing conditions and transferred to a nitrocellulose membrane using a semidry transfer apparatus. Filters were treated as previously described (18). U2AF 65 was detected using monoclonal antibody mc3 (4) and visualized by chemiluminescence according to the protocol of the manufacturer (Amersham). UV cross-linking. Approximately 100 fmol of 32 P-labeled transcript IIIa (-3RE) (contains the IIIa pyrimidine tract) and IIIa (-3RE, -3VDE) (contains the -globin polypyrimidine tract) were incubated in HeLa-NE and Ad-NE under splicing conditions for 15 min at 30 C and then cross-linked by UV irradiation (output, 1,200 W/cm 2 ; distance, 1 cm) for 15 min on ice. RNA was digested with 10 g of RNase A (Pharmacia) at 37 C for 60 min. U2AF 65 was immunoprecipitated with protein A-Sepharose (Pharmacia)-bound monoclonal antibody mc3 (4) for 1hatroom temperature. The precipitate was washed three times and resolved by SDS-PAGE on a 12% gel under reducing conditions. Labeled proteins were visualized by autoradiography. RESULTS A viral splicing enhancer activates IIIa splicing in Ad-NE. In most of our previous work we have used transcripts with an artificial exonic splicing enhancer attached to the 3 end of the FIG. 1. Enhancement of IIIa splicing in Ad-NE. IIIa transcripts, either containing an artificial second exon enhancer (IIIa-U1) or not (IIIa), were spliced in HeLa-NE or Ad-NE. Positions of pre-mrnas and splicing products are indicated to the left for IIIa-U1 and to the right for IIIa. Fold activation of splicing in Ad-NE relative to HeLa-NE is shown for each transcript at the bottom. IIIa transcript (12). Thus, appending the strong adenovirus major late first leader 5 splice site (we refer to this as a U1 enhancer [23]) to the IIIa second exon results in a more than 50-fold stimulation of IIIa splicing in HeLa-NE (Fig. 1, compare lanes 1 and 3). This observation has been instrumental in our previous work, since IIIa transcripts without the U1 enhancer show very little, if any, splicing activity in most HeLa-NE preparations, even under conditions optimized for IIIa splicing (Fig. 1, lane 3, and data not shown). Since the U1 enhancer increases the basal level of IIIa splicing in HeLa-NE, splicing of the IIIa-U1 transcript in Ad-NE results in only a modest (2.5-fold) activation (Fig. 1, lanes 1 and 2; reference 16). In contrast, the IIIa transcript is spliced efficiently in Ad-NE irrespective of the presence or absence of the U1 enhancer (Fig. 1, compare lanes 2 and 4). This result suggests that a virus infection-specific splicing enhancer that is nonfunctional in HeLa-NE activates IIIa pre-mrna splicing in Ad- NE. To obtain a more sensitive assay, all subsequent experiments were done with splicing substrates lacking the U1 enhancer. Identification of the minimal IIIa sequence element conferring enhanced splicing in Ad-NE. To identify the IIIa sequence

4 VOL. 20, 2000 SEQUENCE ELEMENTS REGULATING IIIa PRE-mRNA SPLICING 2319 FIG. 2. Mapping of the IIIa virus infection-dependent splicing enhancer, conferring an enhanced splicing phenotype in Ad-NE. (A) Schematic representation of the IIIa and -globin (glob) hybrid pre-mrnas used to map the 3VDE. Sequences originating from IIIa are shaded, the 3VDE is in black, and the 3RE is shown as a striped box. -Globin sequences are shown as open boxes (exons) and thin lines (introns). Positions of the IIIa and -globin branch sites are marked (F and, respectively). (B) The indicated pre-mrnas were spliced in HeLa-NE or Ad-NE, and products were resolved by gel electrophoresis and visualized by autoradiography. Positions of pre-mrna and splicing products are shown for IIIa (shaded boxes) and -globin and hybrid transcripts (open boxes). (C) PhosphorImager quantitation of splicing efficiencies of hybrid transcripts in HeLa-NE (open bars) and Ad-NE (shaded bars). All experiments were done multiple times using at least three different batches of HeLa-NE and Ad-NE. Average splicing efficiencies and standard deviations are shown. element(s) required for activated splicing in Ad-NE, we replaced short sequences in the rabbit -globin pre-mrna with the corresponding sequence from IIIa (Fig. 2A). The idea was to localize the minimal IIIa element conferring an enhanced splicing phenotype to -globin in Ad-NE. We have previously shown that the 3RE inhibits IIIa 3 splice site usage by binding the SR protein family of splicing factors (8). In agreement with this result, transfer of the 3RE to the -globin pre-mrna [transcript glob (3RE)] resulted in an approximately fivefold inhibition of -globin splicing in HeLa-NE (Fig. 2B, compare lanes 9 and 5). We previously showed that SR proteins in late adenovirus-infected cells are functionally inactivated as splicing repressor proteins (9). The observation that the glob (3RE) transcript was still slightly inhibited in Ad-NE (Fig. 2B, compare lanes 5 and 6) is significant, because it suggests that inactivation of SR protein binding to the 3RE is not sufficient to explain the enhanced splicing phenotype of the IIIa pre-mrna in Ad-NE. To further define the element(s) responsible for enhanced IIIa splicing in Ad-NE, we tested additional IIIa-globin hybrid transcripts. As shown in Fig. 2B, in HeLa-NE the 3VDE (lane 7) reduced -globin splicing more than the 3RE (lane 5). Transfer of both the 3RE and the 3VDE completely abolished -globin splicing in HeLa-NE (lane 3). Importantly, both transcripts glob (3RE, 3VDE) and glob (3VDE) were activated in Ad-NE (lanes 4 and 8) compared to HeLa-NE (lanes 3 and 7), although the total splicing activity, particularly of transcript glob (3RE, 3VDE), was very low in Ad-NE compared to the wild-type IIIa transcript (lanes 2). However, it is noteworthy that the glob (3VDE) transcript reached as much as 70% of the splicing efficiency of IIIa (compare lanes 2 and 8). Taken together, these experiments show that the 28-nucleotide long 3VDE encodes the IIIa sequence element, which when transferred to -globin is sufficient to confer an enhanced splicing phenotype to this pre-mrna in Ad-NE. The observation that glob (3VDE) and especially glob (3RE, 3VDE) splicing was lower compared to the wild-type IIIa pre-mrna in Ad-NE (Fig. 2B) suggests that the 3VDE has evolved to function optimally only in combination with other auxiliary sequence elements in the IIIa pre-mrna. In an attempt to dissect further the 3VDE, we exchanged the -globin polypyrimidine tract with the last 18 nucleotides of the IIIa intron, creating a -globin pre-mrna with the atypical IIIa pyrimidine tract [transcript glob (IIIa-py) (Fig. 3A)]. In transcript glob (IIIa-bp), we replaced the -globin branch site with the corresponding sequence from IIIa (Fig. 3A). As shown in Fig. 3B, splicing of glob (IIIa-bp) in Ad-NE was not enhanced compared to HeLa-NE (lanes 5 and 6), indicating that the IIIa branch site is not the critical element conferring an enhanced splicing phenotype in Ad-NE. In the case of the glob (IIIa-py) transcript, no splicing was detected in HeLa-NE (lane 7), whereas we consistently observed a weak signal in Ad-NE (lane 8). Although formation of spliced product and splicing intermediates was very inefficient with transcript glob (IIIa-py), formation of A complex, the signature for ATPdependent recruitment of U2 snrnp to the branch site (reviewed in reference 15), was significantly increased in Ad-NE compared to HeLa-NE (Fig. 3D). This result suggests that the IIIa pyrimidine tract is indeed the element responsible for enhanced 3 splice site recognition in Ad-NE, but that steps subsequent to A-complex formation are very inefficient with the glob (IIIa-py) transcript. Note that A-complex formation on glob (IIIa-py) was higher than on glob (3VDE) and glob (IIIa-bp) in Ad-NE (Fig. 3D), yet formation of spliced product was dramatically lower with glob (IIIa-py) (Fig. 3C, compare

5 2320 MÜHLEMANN ET AL. MOL. CELL. BIOL. FIG. 3. The IIIa pyrimidine tract is critical for the enhancer activity of the 3VDE. (A) Schematic representation of the IIIa and -globin (glob) hybrid transcripts used. (B) The indicated pre-mrnas were incubated under splicing conditions in HeLa-NE or Ad-NE, and products were resolved by gel electrophoresis and visualized by autoradiography. (C) PhosphorImager quantitation of splicing efficiencies of the hybrid transcripts in HeLa-NE (open bars) and Ad-NE (shaded bars). All experiments were done multiple times using at least three different batches of HeLa-NE and Ad-NE. Average splicing efficiencies and standard deviations are shown. (D) The IIIa pyrimidine tract is sufficient to enhance A-complex formation in Ad-NE. The indicated transcripts were incubated under splicing conditions in HeLa-NE or Ad-NE. Aliquots were withdrawn at the indicated time points and analyzed for spliceosomal complex formation by native gel electrophoresis.

6 VOL. 20, 2000 SEQUENCE ELEMENTS REGULATING IIIa PRE-mRNA SPLICING 2321 lanes 4, 6, and 8), suggesting that spliceosome assembly was stalled at the A complex on the glob (IIIa-py) transcript. Mutational analysis of the 3VDE. To further demonstrate that the IIIa pyrimidine tract is indeed the critical enhancer element activating IIIa splicing in Ad-NE, we crippled the IIIa pyrimidine tract by mutating selected pyrimidines within 3VDE (Fig. 4). Such mutations have previously been analyzed (17). However, in that study IIIa transcripts activated by an artificial U1 enhancer were used. Thus, questioning the significance of the results obtained for splicing under conditions were the 3VDE functions as the splicing enhancer. We therefore reinvestigated the effect of IIIa pyrimidine tract mutations on IIIa splicing in the absence of the artificial U1 enhancer. As shown in Fig. 4, substituting the UC pair at positions -9 and -8 with GG completely abolished IIIa splicing in Ad-NE. Mutating residue -10 from U to G caused a 10-fold reduction in IIIa splicing in Ad-NE. Collectively these results underscore our conclusion that the IIIa pyrimidine tract is a critical element required for high IIIa splicing in Ad-NE. Note that the low level of wild-type IIIa splicing in HeLa-NE was reduced to nondetectable levels on transcripts IIIa-1G and IIIa-2G (Fig. 4), making it impossible to quantitate the effect of the pyrimidine mutations on IIIa splicing in HeLa-NE. Collectively, our results suggest that the atypical IIIa pyrimidine tract is the critical element within the 3VDE promoting efficient initiation of spliceosome assembly in Ad-NE. However, for efficient splicing catalysis, the native IIIa branch site appears to be required. This further emphasizes that both elements, the IIIa branch site and pyrimidine tract, together act as the 3VDE. U2 snrnp is essential for IIIa pre-mrna splicing in Ad- NE. The observation that the IIIa pyrimidine tract did not function together with the -globin branch site in generating a spliced mrna raised the question of whether U2 snrnp was necessary for 3VDE function. Hypothetically, the 3VDE may promote splicing in Ad-NE by a U2 snrnp-independent mechanism. To test this possibility, we functionally inactivated U2 snrnp in Ad-NE by oligonucleotide-directed RNase H cleavage of the 5 end of U2 snrna (12). As shown in Fig. 5, incubation of Ad-NE with increasing amounts of an U2-specific oligonucleotide, during RNase H treatment, abolished IIIa splicing (lanes 3 and 4), whereas mock treatment did not adversely affect IIIa splicing (lane 2). This result demonstrates that U2 snrnp is, indeed, required for IIIa splicing in Ad-NE. We do not know why the IIIa pyrimidine tract does not promote efficient IIIa splicing in combination with the -globin branch site (Fig. 3B). However, we note that the IIIa branch site show an almost perfect complementarity to the U2 snrna 5 end (11), whereas the -globin branch site U2 snrna potential interaction is much weaker. Potentially the branch site U2 snrna complementarity is more critical for efficient U2 snrnp recruitment in Ad-NE than in HeLa-NE. The 3VDE is required for activated IIIa splicing in Ad-NE. Next, we asked whether the 3RE and the 3VDE also are essential for enhanced IIIa pre-mrna splicing in Ad-NE. In these experiments, we replaced IIIa sequence elements with the corresponding sequences from -globin. As shown in Fig. 6, IIIa (-3RE) was spliced in Ad-NE almost as efficiently as the wild-type IIIa transcript (lanes 2 and 4). However, since removal of the 3RE alleviates repression of IIIa splicing by SR proteins (9), the basal level of IIIa (-3RE) splicing in HeLa-NE is increased compared to the wild-type IIIa transcript (compare lanes 1 and 3), which results in a significant decrease in the fold activation in Ad-NE. This finding supports our previous conclusion that viral inhibition of SR protein activity makes an important contribution to IIIa 3 splice site activa- FIG. 4. Mutational analysis of the 3VDE showing that the IIIa pyrimidine tract is the enhancer element. (A) Sequence of the 3VDE. The IIIa pyrimidine tract is shown highlighted (transcript IIIa), and changes in mutants IIIa-1G and IIIa-2G are indicated. Asterisks indicate positions of the two alternative IIIa branch sites (11). (B) The indicated pre-mrnas were incubated under splicing conditions in HeLa-NE or Ad-NE, and products were resolved by gel electrophoresis and visualized by autoradiography. (C) PhosphorImager quantitation of splicing efficiencies of IIIa transcripts with mutated pyrimidine tracts in HeLa-NE (open bars) and Ad-NE (shaded bars). All experiments were done multiple times using at least three different batches of HeLa-NE and Ad-NE. Average splicing efficiencies and standard deviations are shown.

7 2322 MÜHLEMANN ET AL. MOL. CELL. BIOL. FIG. 5. Oligonucleotide-directed RNase H cleavage of the 5 end of U2 snrna showing that a functional U2 snrnp is required for IIIa splicing in Ad-NE. Ad-NE untreated or treated with or without (Mock) increasing amounts of oligonucleotide E15 (2) were incubated under splicing conditions, and products were resolved by gel electrophoresis and visualized by autoradiography. tion, by suppressing IIIa splicing in HeLa-NE. The results also show that the 3RE is not the most significant element controlling IIIa splicing in Ad-NE. Interestingly, the IIIa (-3VDE) transcript was spliced almost as efficiently as -globin in HeLa-NE (lanes 5 and 9). Furthermore, the IIIa (-3VDE) transcript was only moderately activated in Ad-NE (lane 6). This residual activation can be attributed to the reduced repressive activity of SR proteins in Ad-NE (9). Accordingly, the double mutant IIIa (-3RE, -3VDE) showed an even higher basal splicing activity in HeLa-NE, but its splicing was slightly repressed in Ad-NE (lanes 7 and 8). Thus, replacing the 3RE and the 3VDE in the IIIa pre-mrna with the corresponding sequences from -globin was sufficient to convert IIIa from a pre-mrna that is enhanced in Ad-NE compared to HeLa-NE, to a transcript which, similar to -globin, is repressed in Ad- NE. Collectively, our results demonstrate that the 3VDE is the major element controlling IIIa 3 splice site activity, with the 3RE making a smaller but important contribution. U2AF pre-mrna interaction is reduced in Ad-NE. U2AF is an essential splicing factor required for processing of prototypical pre-mrnas (19). U2AF binds to the polypyrimidine tract at the 3 splice site and aids in the recruitment of U2 snrnp to the branch site (20). We have previously reported an inverse correlation between recombinant U2AF 65 binding to a 3 splice site and the splicing efficiency in Ad-NE (17). Thus, splicing of pre-mrnas that bind U2AF 65 efficiently is repressed in Ad-NE, whereas pre-mrnas with atypical pyrimidine tracts, such as IIIa, which bind U2AF 65 inefficiently, are enhanced in Ad-NE. As shown above (Fig. 3), the IIIa pyrimidine tract appears to play a major role in controlling IIIa 3 splice site activation. Since the steady-state amount of U2AF 65 does not change during virus infection (Fig. 7A; reference 10), we conclude that the inhibition of splicing of prototypical premrnas in Ad-NE does not result from reduced amounts of U2AF 65 in late virus-infected cells. Since we used a recombinant Gst-U2AF 65 protein in our original binding study (17), a change in the RNA binding activity of the endogenous pool of U2AF 65 in HeLa-NE and Ad-NE would not have been detected. Here we used a UV cross-linking assay, followed by U2AF 65 immunoprecipitation to study the binding affinity of U2AF in HeLa-NE and Ad-NE to the IIIa and -globin polypyrimidine tracts. As shown in Fig. 7B, U2AF 65 interacts weakly with the IIIa pyrimidine tract in HeLa-NE, a result that is in agreement with the low IIIa splicing activity in HeLa-NE (Fig. 1). Surprisingly, in Ad-NE where IIIa splicing is activated considerably (see above), U2AF 65 interaction with the IIIa pyrimidine tract was not enhanced, indicating that the increase in IIIa splicing does not result from an improved recruitment of U2AF 65 to the 3VDE. This finding was unexpected because it suggests that U2AF 65 recruitment to the 3VDE is not critical for enhanced IIIa splicing in Ad-NE. However, we cannot exclude that U2AF 65 interacts with the 3VDE in an alternative way that precludes it from cross-linking to the RNA. Interestingly, U2AF 65 binding to the -globin polypyrimidine tract is slightly weakened in Ad-NE (Fig. 7B). This reduced binding is accompanied by a similar reduction in splicing (Fig. 2 and 3). In this assay we detect additional RNA binding proteins that are immunoprecipitated (directly or indirectly) by monoclonal mc3. We do not know the identity or significance of these coimmunoprecipitated proteins for activated IIIa splicing. DISCUSSION Viruses typically inhibit host cell gene expression to gain full access to the biosynthetic machinery of the cell. Thus, many viruses inhibit host cell RNA processing and RNA transport (7). Since RNA splicing is a prerequisite for nuclear-to-cytoplasmic export of most cellular mrnas, a virus-induced suppression of host cell RNA splicing may be an important regulatory mechanism by which viruses inhibit host cell gene expression. Some viruses, such as herpes simplex virus, vaccinia virus, and most RNA viruses, contain genes essentially lacking introns. Such viruses could potentially completely shut off host cell RNA splicing without a significant impact on virus-specific gene expression. Most DNA viruses, like adenovirus, still depend on a functional splicing machinery for expression of viral genes. Thus, all adenovirus genes except pix (1) contain introns. Therefore, adenovirus, instead of abolishing RNA splicing in infected cells, appears to redirect the specificity of the splicing machinery late during the infectious cycle, such that splicing of generic pre-mrnas is reduced and splicing of certain viral mrnas is enhanced. We have previously shown that adenovirus reduces the functional activity of the classical SR proteins through a virusinduced dephosphorylation (9). However, inactivation of the SR family of splicing factors poses a significant problem. It is well established that SR proteins are essential for generic premrna splicing (for reviews, see references 3, 14, and 21). Why are late-specific adenovirus pre-mrnas spliced more efficiently under conditions where the functional activity of SR proteins is reduced? The results presented here appears to

8 VOL. 20, 2000 SEQUENCE ELEMENTS REGULATING IIIa PRE-mRNA SPLICING 2323 FIG. 6. The 3VDE functions as a Janus element: it abrogates IIIa splicing in HeLa-NE and enhances IIIa splicing in Ad-NE. (A) Schematic representation of the IIIa and -globin hybrid transcripts used. (B) The indicated pre-mrnas were incubated in HeLa-NE or Ad-NE, and splicing products were resolved by gel electrophoresis and visualized by autoradiography. (C) PhosphorImager quantitation of splicing efficiencies of the hybrid transcripts in HeLa-NE (open bars) and Ad-NE (shaded bars). All experiments were done multiple times using at least three different batches of HeLa-NE and Ad-NE. Average splicing efficiencies and standard deviations are shown. provide an important piece to the puzzle. We show that the adenovirus IIIa branch site/polypyrimidine tract functions as a virus infection-dependent splicing enhancer, the 3VDE. This sequence element is essential for regulated IIIa pre-mrna splicing and sufficient to convert -globin from a transcript that is repressed to a pre-mrna that, similar to the IIIa premrna, is enhanced in Ad-NE (Fig. 2, compare lanes 7 and 8 with lanes 9 and 10). Interestingly, the 3VDE is inhibitory for splicing in HeLa-NE, probably because the 3VDE contains a weak pyrimidine tract which does not efficiently bind the general splicing factor U2AF (Fig. 7B). Thus, replacing the 3VDE with the branch site/polypyrimidine tract from -globin increases basal IIIa splicing dramatically in HeLa-NE and thereby essentially abolishes its activation in Ad-NE (Fig. 6). Similarly, transfer of the 3VDE to -globin drastically inhibits -globin splicing in HeLa-NE (Fig. 2, compare lanes 9 and 7) and converts -globin to a pre-mrna that now is enhanced in FIG. 7. U2AF65 binding to pyrimidine tracts in Ad-NE. (A) Western blot analysis of the steady-state amounts of U2AF65 in HeLa-NE (lanes 1 to 3) and Ad-NE (lanes 4 to 6). The blot was probed with monoclonal antibody mc3 (4), which is specific for U2AF65. (B) 32P-labeled transcripts IIIa (-3RE) (lanes 1 and 3) or IIIa (-3RE, -3VDE) (lanes 2 and 4) were incubated in HeLa-NE or Ad-NE. Proteins bound to the RNAs were UV cross-linked, digested with RNase A, and immunoprecipitated with mc3. The immunoprecipitate was separated on an SDS 12% polyacrylamide gel, and labeled proteins were visualized by autoradiography.

9 2324 MÜHLEMANN ET AL. MOL. CELL. BIOL. Ad-NE (Fig. 2, compare lanes 7 and 8). Collectively, these results show that the 3VDE functions as a Janus element, it inhibits splicing in HeLa-NE and functions as a splicing activator element in Ad-NE. Although the 3VDE functions as the primary element causing elevated IIIa mrna splicing in Ad-NE, our results also show that the previously characterized 3RE (8) makes a smaller but important contribution to the tight control of IIIa pre-mrna splicing. Thus, transfer of both the 3RE and 3VDE to -globin inhibits globin splicing more effectively than each element separately (Fig. 2B). Similarly, removal of both elements from the IIIa pre-mrna increases IIIa splicing in HeLa-NE more than removal of each element individually (Fig. 6). Our results show that the 3RE and the 3VDE are the critical viral elements controlling the splicing phenotype of a pre-mrna in Ad-NE. However, our results also indicate that the 3RE and 3VDE have evolved to function efficiently in combination with other auxiliary splicing signals in the IIIa pre-mrna. This is illustrated by transcript glob (3VDE), which is activated in Ad-NE, although only to about 50 to 70% of the splicing efficiency the IIIa pre-mrna (Fig. 2 and 3). More remarkably, the glob (3RE, 3VDE) transcript regains only approximately 10% of the splicing efficiency of the wildtype IIIa pre-mrna in Ad-NE (Fig. 2). However, the important point is that this transcript is spliced more efficiently in Ad-NE compared to HeLa-NE (Fig. 2). The identity of these auxiliary signals is currently under investigation. The surprising finding that transcripts IIIa (-3RE, -3VDE) and IIIa (-3VDE) were spliced more efficiently in Ad-NE compared to the wild-type IIIa transcript raises the question whether inadvertent expression of the IIIa protein may be negative for virus multiplication. The IIIa protein is characterized as a structural component of the viral capsid. So why is IIIa splicing subjected to such a tight control during virus infection? Experiments are in progress to determine whether unregulated IIIa protein expression has negative effects on virus multiplication. The observation that a virus infection-dependent splicing enhancer controls IIIa pre-mrna splicing may have a wider significance. Other viruses may have evolved similar strategies to be able to efficiently produce viral mrnas under conditions where host cell gene expression is limited through viral inactivation of key cellular splicing factors. In late adenovirusinfected cells, the activity of the SR family of splicing factors is severely reduced by a virus-induced dephosphorylation (9). Since hyperphosphorylated SR proteins are essential for generic pre-mrna splicing, such a posttranslational modification would be expected to reduce host cell pre-mrna splicing. Our results further suggest that the 3VDE may provide a mechanism by which adenovirus can sustain an efficient splicing of the IIIa pre-mrna, even under conditions of limiting concentrations of functional SR proteins. This hypothesis makes several predictions that currently are under investigation. For example, other adenovirus pre-mrnas that show an enhanced splicing late during infection should have evolved similar infection-dependent splicing enhancers. As shown in Fig. 5, U2 snrnp is required for IIIa splicing in Ad-NE. Thus, the enhanced IIIa splicing observed in Ad-NE may result from a viral factor and/or an alternative cellular factor that substitute for the general splicing factor U2AF to promote U2 snrnp recruitment to the IIIa 3 splice site. As shown in Fig. 7B, the increase in IIIa splicing in Ad-NE is not accompanied by an increase in U2AF 65 binding to the IIIa 3 splice site, suggesting that the 3VDE may function as a splicing enhancer in the absence of efficient U2AF 65 recruitment. Interestingly, the steady-state amounts of U2AF 65 are identical in HeLa-NE and Ad-NE (Fig. 7A), yet the RNA binding capacity to the -globin 3 splice site is slightly reduced in Ad-NE (Fig. 7B). This result suggests that RNA binding by U2AF 65 is reduced by a virus-induced posttranslational modification. Based on our previous work (9), we would expect this modification to be a virus-induced dephosphorylation. However, it remains to be shown that U2AF 65 is a phosphoprotein. Collectively, our data suggest that the 3VDE may operate through an alternative, potentially U2AF-independent mechanism. Although such a model is attractive, preliminary experiments suggest a more complex regulation, since the IIIa premrna is not spliced in U2AF-depleted Ad-NE (unpublished observation). Thus, a significance of U2AF for IIIa 3 splice site activity cannot be excluded. Potentially, other viral or cellular splicing factor(s), essential for IIIa splicing, also are lost from the nuclear extract during U2AF depletion. Alternatively, the results may suggest that U2AF is still required for IIIa splicing in Ad-NE, although it does not make direct contact with the RNA. Perhaps it becomes tethered to the 3VDE by interacting with another factor that makes the direct contact with the IIIa pyrimidine tract. Experiments are in progress to resolve questions of this type. Irrespective of the mechanistic details of how the 3VDE functions, the results presented here are novel and important, because they demonstrate the existence of a regulatory element that has evolved to function as a splicing enhancer only in the context of a virus infection. We propose that other mammalian viruses have evolved similar virus infection-dependent splicing enhancers to take control of the RNA biosynthetic machinery in the infected cell. ACKNOWLEDGMENTS O.M. and B.Y. contributed equally to this work. We thank Maria Carmo-Fonseca for monoclonal antibody mc3 and Jan-Peter Kreivi for much intellectual help and critical comments on the manuscript. This work was supported by the Swedish Cancer Society. REFERENCES 1. Aleström, P., G. Akusjärvi, M. Perricaudet, M. B. Mathews, D. Klessig, and U. Pettersson The gene for polypeptide IX of adenovirus type 2 and its unspliced messenger RNA. Cell 19: Black, D. L., B. Chabot, and J. A. Steitz U2 as well as U1 small nuclear ribonucleoproteins are involved in premessenger RNA splicing. Cell 42: Fu, X. D The superfamily of arginine/serine-rich splicing factors. RNA 1: Gama-Carvalho, M., R. D. Krauss, L. Chiang, J. Valcarcel, M. R. Green, and M. Carmo-Fonseca Targeting of U2AF65 to sites of active splicing in the nucleus. J. Cell Biol. 137: Hornig, H., M. Aebi, and C. Weissmann Effect of mutations at the lariat branch acceptor site on -globin pre-mrna splicing in vitro. Nature 324: Imperiale, M. J., G. Akusjärvi, and K. N. Leppard Post-transcriptional control of adenovirus gene expression. Curr. Top. Microbiol. Immunol. 199: Izaurralde, E., M. Kann, N. Pante, B. Sodeik, and T. Hohn Viruses, microorganisms and scientists meet the nuclear pore. EMBO J. 18: Kanopka, A., O. Mühlemann, and G. Akusjärvi Inhibition by SR proteins of splicing of a regulated adenovirus pre-mrna. Nature 381: Kanopka, A., O. Mühlemann, S. Petersen-Mahrt, C. Estmer, C. Öhrmalm, and G. Akusjärvi Regulation of adenovirus alternative RNA splicing by dephosphorylation of SR proteins. Nature 393: Kreivi, J.-P., and G. Akusjärvi Regulation of adenovirus alternative RNA splicing at the level of commitment complex formation. Nucleic Acids Res. 22: Kreivi, J.-P., K. Zerivitz, and G. Akusjärvi Sequences involved in the control of adenovirus L1 alternative RNA splicing. Nucleic Acids Res. 19: Kreivi, J.-P., K. Zerivitz, and G. Akusjärvi A U1 snrna binding site improves the efficiency if in vitro pre-mrna splicing. Nucleic Acids Res. 19:6956.

10 VOL. 20, 2000 SEQUENCE ELEMENTS REGULATING IIIa PRE-mRNA SPLICING Lamond, A. I., and B. S. Sproat Isolation and characterization of ribonucleoprotein complexes, p In S. J. Higgins and B. D. Hames (ed.), RNA processing, a practical approach, vol IRL Press, Oxford, England. 14. Manley, J. L., and R. Tacke SR proteins and splicing control. Genes Dev. 10: Moore, M. J., C. C. Query, and P. A. Sharp Splicing of precursors to messenger RNAs by the spliceosome, p In R. F. Gesteland and J. F. Atkins (ed.), The RNA world, 1st ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 16. Mühlemann, O., and G. Akusjärvi Preparation of splicing-competent nuclear extracts from adenovirus-infected cells, p In W. S. M. Wold (ed.), Adenovirus methods and protocols, vol. 21. Humana Press Inc., Totowa, N.J. 17. Mühlemann, O., J.-P. Kreivi, and G. Akusjärvi Enhanced splicing of nonconsensus 3 splice sites late during adenovirus infection. J. Virol. 69: Petersen-Mahrt, S. K., C. Estmer, C. Öhrmalm, D. A. Matthews, W. C. Russell, and G. Akusjärvi The splicing factor-associated protein, p32, regulates RNA splicing by inhibiting ASF/SF2 RNA binding and phosphorylation. EMBO J. 18: Ruskin, B., P. D. Zamore, and M. R. Green A factor, U2AF, is required for U2 snrnp binding and splicing complex assembly. Cell 52: Valcarcel, J., R. K. Gaur, R. Singh, and M. R. Green Interaction of U2AF(65) RS region with pre-mrna of branch point and promotion base pairing with U2 snrna. Science 273: Valcarcel, J., and M. R. Green The SR protein family: pleiotropic functions in pre-mrna splicing. Trends Biochem. Sci. 21: Valcarcel, J., R. Singh, and M. R. Green Mechanisms of regulated pre-mrna splicing, p In A. I. Lamond (ed.), Pre-mRNA processing, vol. 1. R. G. Landes Company, Austin, Tex. 23. Yue, B. G., and G. Akusjärvi A downstream splicing enhancer is essential for in vitro pre-mrna splicing. FEBS Lett. 451: Zahler, A. M., W. S. Lane, J. A. Stolk, and M. B. Roth SR proteins: a conserved family of pre-mrna splicing factors. Genes Dev. 6: Downloaded from on March 5, 2014 by PENN STATE UNIV