Severe congenital neutropenia

Transcription

1 Dr. Rolf Kostmann

2 Severe congenital neutropenia

3 Severe Congenital Neutropenia Absolute neutrophil counts (ANC) at diagnosis are below 200 per mm 3 or may even be absent in the peripheral blood Severe bacterial infections usually start during early infancy Typical infections include omphalitis, skin or liver abscesses, pneumonia, gingivitis or aphthous stomatitis and otitis media

4 S E V E R E C H R O N I C N E U T R O P E N I A I n t e r n a t i o n a l R e g i s t r y Incidence of SCN in Germany Incidence of severe congenital neutropenia in Germany as observed between 1985 to 2005 by the SCNIR: 1 case in newborns Corresponding to approximately 4 cases in 1 Mio. children October 2006

5 Severe congenital neutropenia G-CSF Treatment

6 THE SEVERE CHRONIC NEUTROPENIA INTERNATIONAL REGISTRY (SCNIR) B Alter, MA Bonilla, L Boxer, J Donadieu, C Fier, M Freedman, G Kannourakis, P Newburger, S Kinsey, L Reeves, J Winkelstein, C Zeidler Co-Directors: David C Dale and Karl Welte Seattle WA, USA; Hannover, Germany European Local Liaison Physicians

7 Course of Neutrophils in Patients with Severe Congenital Neutropenia Median Absolute Neutrophil Count (ANC) by Years of G-CSF Treatment 3 Median ANC [x 1000/µl] 2,5 2 1,5 1 0, n=305 n=283 n=229 n=210 n=174 n=169 n=141 n=133 n=109 n=78 n=45 G-CSF Treatment [Years]

8 Rosenberg, et al., Blood 2006

9 Rosenberg, et al., Blood 2006

10 The Severe Chronic Neutropenia International Registry (SCNIR) - Europe Cornelia Zeidler, Beate Schwinzer, Gusal Pracht and the European Local Liason Physicians Homepage: scnir@mh-hannover.de

11 S E V E R E C H R O N I C N E U T R O P E N I A I n t e r n a t i o n a l R e g i s t r y Demographics Country Pts. Country Pts. Total 428 Morocco 1 Austria 13 The Netherlands 13 Belgium 25 Norway 14 Czech Republic 4 Poland 5 Germany 157 Portugal 1 United Kingdom 63 Russia 1 Greece 10 Serbia-Montenegro 2 Ireland 11 Spain 19 Israel 11 Sweden 27 Italy 36 Switzerland 6 Luxembourg 2 Turkey 6 October 2006

12 S E V E R E C H R O N I C N E U T R O P E N I A I n t e r n a t i o n a l R e g i s t r y Incidence of AML/MDS (Europe) (Severe Congenital Neutropenia) 0.30 SCN-Register 09/06 CN Inzidenz AML/MDS P years Total AML/MDS.18, SE=.05 Events/N 22/ 248 October 2006

13 Cum. Incidence Incidence of AML/MDS in Congenital Neutropenia by Mean Dose P= Age Mean dose < 5 µg/kg/d.25, SE=.08 Events/N 9/ 70 Mean dose >= 5 µg/kg/d.41, SE=.15 Events/N 9/ 54

14 Genetic Aberrations in 42 Patients with Congenital Neutropenia + MDS/ML Abnormality tested positive Neutrophil elastase mutation 9 8 (89%) G-CSF receptor mutation (86%) Monosomy (51%) Ras mutation 25 6 (24%) Trisomy /24%)

15 G-CSFR mutations in CN patients

16 Adopted from Germeshausen et al., Blood 2006

17 Adopted from Germeshausen et al., Blood 2006

18 Heterogeneity in the Acquisition of G-CSF Receptor Gene Mutations Patient group no CSF3R CSF3R total nonsense nonsense mutation mutation CN without Mo7/MDS/leukemia 82 (66%) 43 (34%) 125 CN with Mo7/MDS/leukemia 5 (22%) 18 (78%) 23 - CN / Monosomy CN / MDS CN / AML CN / ALL CN / CMML total CN 87(59%) 61 (41%) 148 Reference: Germeshausen, Ballmaier, Welte: Incidence of CSF3R mutations in severe congenital neutropenia and relevance for leukemogenesis results of a long-term Survey. Blood, prepublished online Sept 19, 2006

19 CN patients with MDS/AML HSCT before 2001 versus after Cum. Survival after 2001 after 2001-censored 0 Months before 2001 before 2001-censored Before 2001 (n=29) After 2001 (n=11) Censored: 11 ( 37,93 %) Events: 18 Censored: 9 (81,82%) Events: 2 Survival Time Survival Time Mean: 27,73 months Mean: 26,36 months

20 Survival after HSCT from HLA-identical donors CN patients with MDS/AML versus no malignancy Cum. Survival Status at HSCT No MDS/AML No MDS/AML-censored MDS/AML MDS/AML-censored 0 Months MDS/AML (n=7) No MDS/AML (n=12) Censored: 4 ( 57,14 %) Events: 3 Censored: 12 (100%) Events: 0 Survival Time Mean: 38,63

21 SCN patient G-CSF response Continue G-CSF, BMA 1x/year G-CSF G-CSF receptor mutation Cytogenetic abnormalities or /and MDS morphology MFD No response Transplantation Gradually Increase G-CSF dose to 100µg / Kg /day No response SZT

22 Severe congenital neutropenia: Pathomechanisms

23 ELA2 mutations Congenital neutropenia Exon 1 Exon 2 Exon 3 Exon 4 Exon Cyclic neutropenia

24 ELA2 mutations in Congenital Neutropenia Tested Positive % CN CN/AML Zeidler, C., et al., ESID Poster

25 S E V E R E C H R O N I C N E U T R O P E N I A I n t e r n a t i o n a l R e g i s t r y G-CSF Dose & ELA-2 Mutations Congenital Neutropenia G-CSF dose [mcg/kg/qd] Ela mutation N* Mean Std. Deviation Median Range Ela , , , ,13 Ela , , , ,76 Total 53 13, , , ,76 *only patients receiving G-CSF for more than 1 year are included October 2006

26 = S97L ELA2 MUT = WT ELA2

27 ELA2 missense mutation inherited from a non-affected father ANC [10 /L] 9 G-CSF JA EA FA MA wild type -237 bp heterozygous G4570A -370 bp -237 bp G-CSF -133 bp -133 bp days Germeshausen et al. 2001, Br J Haematol. 115(1):222-4

28 ELA2 mrna expression

29 Decreased Neutrophil Elastase Activity in CN and CyN 1,40 1,20 Specific Human Neutrophil Elastase (HNE) Activity U HNE / mg protein 1,00 0,80 0,60 0,40 0,20 0,00 CN CyN healthy ELA2 genotype: mut wt donors G-CSF treated healthy donors

30 Köllner, et al., Blood 2006

31 Secretion Plasma Membrane mechanism? Lysosomes Golgi? Mannose-rich glycosylation ER mt NE protein

32 Are ELA2 mutations the cause of congenital neutropenia? Autosomal dominant inheritance of CN is associated with ELA2 mutations. Mutations segregate with CN in families with multiple affected individuals. 5 out of 5 children of a sperm donor for 4 different mothers suffered from CN with ELA2 mutations (Boxer et al., JP 2006)

33 Is ELA2 mutation the cause of congenital neutropenia? ELA2 mutations alone seem not to be the single cause of congenital neutropenia, because: Certain ELA2 mutations occur in cyclic and congenital neutropenia Elastase protein expression is severly downregulated in all patients independent whether patients revealed ELA2 mutations or not Knockout mice and mice expressing ELA2 mutations derived from CN patients have normal granulopoiesis

34 S E V E R E C H R O N I C N E U T R O P E N I A I n t e r n a t i o n a l R e g i s t r y Neutrophils ELA-Mutations & Blood Counts in SCN Monocytes Erythrocytes Platelets G-CSF treatment [years] October 2006

35 New genetic defects in severe congenital neutropenia LLP October 7th Budapest

36 Families with severe congenital neutropenia??

37 Clinical Presentation Patient Infections ANC Other features Treatment 1 Omphalitis Pneumonia Splenomegaly G-CSF 2 None (Early diagnosis) G-CSF 3 Pneumonia Skin abscess Oral ulcers Growth failure G-CSF 4 Pneumonia Otitis Skin abscess Splenomegaly Tricuspid insufficiency G-CSF

38 p D1S442 (143.1Mb) 234 genes q D1S2624 (153.4Mb) Chromosome 1

39 Absent HAX1 protein in SCN SCNI SCNII SCNIII Co Pa Co Pa Co Pa 48.8 KDa anti HAX KDa 25.9 KDa anti GAPDH

40 HAX1 mutations in SCN G C T C A T G G G G C C W44X II.7 II.8 STOP(W44X) R86X Q190X T A G T A T G A G A T STOP(R86X) T T C C C A G G T T T T C C T A G G T T STOP(Q190X) Klein, Ch., et al., Nature Genetics (Jan 2007)

41 Summary of SCN patients with HAX1 mutations Klein, Ch., et al., Nature Genetics (in press) Nr Ethnic group Clinical features HAX ELA2 CSFR3 1 Kurdish Omphalitis, pneumonia, lymphadenitis W44X WT WT 2 Kurdish Oral ulcers, otitis, pneumonia, septicemia W44X WT WT 3 Kurdish Pneumonia, skin abscess, stomatitis W44X WT WT 4 Kurdish Pneumonia, otitis, skin abscess W44X WT WT 5 Kurdish Lymphadenitis, skin abscess, otitis W44X WT 2405C>T 6 Kurdish Skin abscess, bronchitis W44X WT WT 7 Turkish Pneumonia, skin abscess, bronchitis W44X WT WT 8 Turkish Pneumonia, pharyngitis W44X WT 2423C>T 9 Turkish Septicemia, skin abscess W44X WT WT 10 Kurdish None W44X WT WT 11 Turkish Unclassified W44X WT WT 12 Iran Skin abscess, pneumonia, oral ulcers W44X WT WT 13 Iran Omphalitis, skin abscess, oral ulcers, UTI W44X WT WT 14 Iran Skin abscess, pneumonia, oral ulcers R86X WT WT 15 Turkish Unclassified W44X WT WT 16 Turkish Gingivitis, pneumonia, otitis W44X WT WT 17 Lebanese Otitis, enteritis, bronchitis W44X WT WT 18 Turkish Omphalitis, bronchitis W44X WT WT 19 Lebanese Pneumonia, skin abscess, septicemia W44X WT 2423C>T, 2399C>T 20 Turkish Otitis W44X WT WT 21 Swedish Skin abscess, otitis, gingivitis, septicemia Q190X WT WT 22 Swedish Otitis, skin abscess, gingivitis, septicemia Q190X WT WT 23 Swedish Skin abscess, paronychia Q190X WT WT

42 Bcl-2 family Pro-Survival Bcl-2 Bcl-X L Bcl-w Mcl-1 A1/Bfl-1 Hax-1 BH4 BH3 BH1 BH2 TM Pro-Apoptosis Bax-subfamily Bax BH3 BH1 BH2 TM Bak Bok/Mtd BH3-subfamily Bik/Nbk Hrk/DP5 Noxa Bad Puma BH3

43 Kroemer G and Martin SJ 2005

44 Apoptosis in HAX-1 deficient neutrophil granulocytes Control Patient H 2 O 2 Annexin-V TNFα HD 1 HD 2 P Propidium Iodide Time (min)

45 Mitochondrial membrane potential (ΔΨ m ) in granulocytes 0 min HD1 P2 P4 JC-1 monomer 15 min 120 min % cells with low ΔΨ m HD 1 HD 2 P 2 P Time (min) JC-1 aggregate

46 S E V E R E C H R O N I C N E U T R O P E N I A I n t e r n a t i o n a l R e g i s t r y Hax1-Mutations & Blood Counts in SCN Neutrophils Monocytes Erythrocytes Platelets G-CSF treatment [years] October 2006

47 Summary Autosomal recessive SCN can be caused by autosomal recessive mutations in HAX1 HAX1 is critical for stabilization of inner mitochondrial membrane potential in hematopoietic and non-hematopoietic cells Deficiency of ubiquitously expressed HAX1 causes increased apoptosis of neutrophils and neutropenia HAX1 is mutated in the original pedigree described by R. Kostmann in 1950/1956

48 Acknowledgements (Hax-1 mutations) Christoph Klein Giridharan Appaswamy Inga Sandrock Chozhavendan Rathinam Kaan Boztug Georg Bohn Manuela Germeshausen Conni Zeidler Beate Schwinzer Karl Welte (Hannover) Magda Grudzien Uli Salzer Bodo Grimbacher (Freiburg) Alejandro A. Schäffer (Bethesda, US) Nima Rezaei (Teheran, Iran) Göran Carlsson Malin Melin Jan Palmblad Jan-Inge Henter Bengt Fadeel Niklas Dahl (Swedish SCN consortium)

49 Dis order Ge netic defect recessive (R-CN) dominant (D-CN) Neutropenia plus : Congenital neutropenia with ELA 2 mutations ELA Preleukemic syndrome Congenital neutropenia with Hax-1 mut ations HAX IgG levels elevated Congenital neutropenia with GFI- 1 mutation GFI B-/T-cell deficien cy, W HIM syndrome CXCR4 - + Myelo kathexis, IgG d efic., W arts Shwachman-Diamond syndrome SBDS + - Exocrine pancreas insufficiency Glycogen storagedisease, type Ib Glucose-6- Phosphat- Translocase + - Hypoglycemia, lactic acidosis Hyper IgM CD40-L x-linked - IgG, IgA, Ig E d eficien cy Barth syndrome (3-meth ylg lutacon ic aciduria) Taz 1 X-linked Dilatative cardiomyopathy, skelet al myopath y, short stature, Congenital neutropenia with W ASP mutation WASP X-linked - monocytopenia platel ets no rmal Herman sky-pudlacksyndrome AP3B1 + - Partial albin ism, short statur e, IgG d ef., platel et d ysfunction Congenital neutropenia with p14 (MAPBPIP) mutation p Partial albin ism, short statur e, IgG d eficiency Griscelli syndrom e Rab27a + - Hemophagocytosis Chediak-Higashi syndro me LYST (CHS1) + - Albinism, T/NK defect, chemot axis d efect

50 ELA-2 and Hax-1 mutations: Are there common downstream defects? Analysis of transcription factors involved during distinct promyelocytic stage of myelopoiesis pluripotent stem cell CFU-GEMM CFU-GM myeloblast promyelocyte maturation arrest

51 Severe Congenital Neutropenia ELA2 Mutation HAX1 Mutation

52 ELA2 vs Hax1 Mutations Neutrophils in CN Patients Neutrophils Neutrophils G-CSF treatment [years] n = 6 n = 30 n = 6 >Ela + = 4 n = 8

53 S E V E R E C H R O N I C N E U T R O P E N I A I n t e r n a t i o n a l R e g i s t r y G-CSF Dosis und Hax-1 Mutations G-CSF dose [mcg/kg/qd] Congenital Neutropenia Mutation N* Mean Std. Deviation Median Range Hax ,1671 1, ,8350 4,39 Ela , , , ,76 Not tested , , , ,76 *only patients receiving G-CSF for more than 1 year are included October 2006

54 Expression of LEF-1 mrna in CN patients Microarray analysis HAX1: SCN 1, 6, 9 ELA2: SCN 2, 3, 5, 8 LEF

55 Lymphoid Enhancer Factor-1 (LEF-1) Is a unique member of the LEF-1/TCFs (T-cell factors) family of high mobility group (HMG) domain containing transcription factors LEF-1 is considered to be a member of the canonical Wnt signaling and is also associated with Wnt independent stimuli (e.g. TGFβ, Notch) LEF-1 is an architectural transcription factor (DNA bending and helical phasing of transcription binding sites of target genes) Hematopoiesis: LEF-1 is active in pre-b cells and in early thymic progenitors

56 LEF-1 is dynamically expressed during normal granulopoiesis but not in CN ctrl CN LEF-1/ β-actin mrna ratio, AU 0 myelocytes metamyelocytes BM granulocytes blasts myeloblasts promyelocytes Laser-assisted single cell picking of BM slides, real-time qrt-pcr analysis

57 LEF-1 expression is normal in other neutropenias target gene/β-actin mrna Ratio, AU LEF-1 TCF-3 TCF ** ** 0 0 CN CNCyN IN MN ctrl CN CN CyN IN MN ctrl CN CNCyN IN MN ctrl G-CSF CN CN CyN MN ctrl G-CSF DAPI G-CSF G-CSF anti-lef-1 target genes CN: congenital neutropenia; CyN: cyclic neutropenia; IN: idiopathic neutropenia; MN: metabolic neutropenia Skokowa J. et al., Nature Medicine, Oct. 2006

58 LEF-1 target genes expression is affected in CN CD33 + cells cyclin D1 c-myc target gene/β-actin mrna Ratio * * 0 CN CN CyN IN MN ctrl G-CSF target gene/β-actin mrna Ratio * * 0 CN CN CyN IN MN ctrl G-CSF survivin target gene/β-actin mrna Ratio ** * 0 CN CN CyN IN MN ctrl G-CSF target genes

59 Restoration of defective LEF-1 expression promotes granulocytic differentiation of CD34 + progenitors of CN patients time, days CD15 expression, % positive cells CD11b expression, % positive cells * * * * 0 mock ctrl lv LEF-1 lv * * time, days ** LEF-1/β-actin mrna ratio, AU mock control lv LEF-1 lv mock ctrl lv LEF-1 lv

60 Anti-proliferative and pro-apoptotic effects of LEF-1 inhibition in CD34 + progenitors of healthy individuals I target gene/β-actin mrna Ratio, AU ** LEF-1 TCF-3 TCF-4 alef-1 shrna control 64 kda LEF-1 48 kda ß-actin mock ctrl shrna gl4 anti-lef-1 shrna 975 target gene/β-actin mrna Ratio, AU * cyclin D1 survivin c-myc * *

61 Anti-proliferative and pro-apoptotic effects of LEF-1 inhibition in CD34 + progenitors of healthy individuals II No proliferation Elevated apoptosis cell number, 10 4 /ml mock ctrl shrna gl4 anti-lef-1 shrna time, days * * * RFP ctrl shrna gl4 anti-lef-1 shrna ,2 % 57 % Annexin V FITC

62 LEF-1 up-regulates granulocyte-specific transcription factor C/EBPα by binding to its promoter C/EBPα/β-actin mrna Ratio, AU * * * CN CN CyN IN MN ctrl C/EBPα/β-actin mrna Ratio, AU G-CSF + G-CSF * * mock ctrl lv LEF-1 lv G-CSF ChIP Assay C/EBPα gene promoter Input No Ab Isotype anti-lef-1 LEF-1 C/EBPα C/EBPα -559bp -538bp CD34 + cells GTTCTGGCTTTGAAAGAGAAT C/EBPα CD33 + cells

63 Molecular mecanism of maturation arrest of granulocytic precursors in CN Hax-1 mutations LEF-1 Differentiation Proliferation Apoptosis

64 LEF-1 in myelopoiesis enhancer

65 Summary LEF-1 transcription factor mediates proliferation, survival and differentiation of myeloid progenitors in a stage-specific manner LEF-1 loss of function in arrested promyelocytes is a crucial event in the pathogenesis of CN and is not found in other neutropenias LEF-1 restoration overcomes the maturation arrest in CN LEF-1 positively regulates granulocyte-specific transcription factor C/EBPα LEF-1 regulation of myelopoiesis is ß-catenin independent manner

66 Acknowlegement LEF-1 Julia Skokowa Murat Uenalan Gunnar Cario Martin Stanulla Axel Schambach Christopher Baum Michaela Scherr ELA2 and G-CSFR Manuela Germeshausen Matthias Ballmaier Carmela Beger Inga Köllner SCNIR Cornelia Zeidler, Beate Schwinzer, Gusal Pracht European LLPs

67