Molecular aspects of HNPCC and identification of mutation carriers Niessen, Renee

Transcription

1 University of Groningen Molecular aspects of HNPCC and identification of mutation carriers Niessen, Renee IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2007 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Niessen, R. C. (2007). Molecular aspects of HNPCC and identification of mutation carriers s.n. Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). Takedown policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): For technical reasons the number of authors shown on this cover page is limited to 10 maximum. Download date:

2 Germline hypermethylation of the MLH1 promoter region as the cause of HNPCC Renée C. Niessen 1, Robert M.W. Hofstra 1,KristaKooi 1, Jianghua Ou 1, Ana Ferreira 1, Maran J.W. Berends 1, Harry Hollema 2, Jan H. Kleibeuker 3,RolfH.Sijmons 1 Departments of Genetics 1, Pathology 2, and Gastroenterology 3, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands manuscript in preparation

3 ABSTRACT Background: It has been suggested that the detection of MLH1 promoter hypermethylation in colorectal cancer justifies the diagnosis of a sporadic rather than an inherited defect of the DNA mismatch repair system (HNPCC). Recently, however, eight colorectal cancer patients were reported with germline hypermethylation of the MLH1 promoter. In this study we wanted to investigate the prevalence of MLH1 promoter hypermethylation in lymphocytes in a series of HNPCC suspected patients and study the characteristics of tumours of patients with hypermethylation of the MLH1 promoter in lymphocytes. Methods: Forty MMR gene mutationnegative patients were included. Twentyfive of these patients had a tumour with loss of MLH1 expression and 15 patients had not been investigated for MLH1 protein expression, but had a microsatellite instable (MSI) tumour. DNA isolated from lymphocytes and where possible from tumour material, was investigated for hypermethylation using methylation specific PCR (and sequencing) after sodium bisulfite modification, and subsequently by denaturing gradient gel electrophoresis of the PCR products. Furthermore, a tumour suppressor gene methylation profile was investigated in these tumours with a methylation specific multiplex ligation dependent probe amplification kit. Results: In one patient we found hypermethylation of the MLH1 promoter in lymphocytes, skin fibroblasts, mouth wash and colon cancer. The family history for HNPCC associated tumours was negative. The tumour of this patient showed MSI, loss of MLH1 staining and loss of heterozygosity for MLH1. Further DNA analysis showed that the siblings, the mother, and a lymphoma of the deceased father showed no MLH1 promoter methylation. The tumour harboured a mutation in codon 12 of KRAS and methylation of two tumour suppressor genes (RARB and PTEN), suggesting that both methylation and microsatellite instability play a role in tumour development. Conclusion: MLH1 promoter hypermethylation attributes to a small percentage of HNPCC suspected patients. Therefore, in patients with MLH1 hypermethylation in the tumour, methylation analysis in lymphocytes should be considered. INTRODUCTION Hereditary nonpolyposis colorectal cancer (HNPCC), or Lynch syndrome, is an autosomal dominantly inherited cancer syndrome characterised by the occurrence of earlyonset cancers of the colorectum, and a range of other tumours, including tumours of the endometrium, ovary, small intestine and upper urinary tract. 1,2 This cancer syndrome is caused by germline 94

4 Germline MLH1 promoter hypermethylation mutations in the mismatch repair (MMR) genes (predominantly in MLH1, MSH2 and MSH6), followed by somatic inactivation of the second allele. The DNA of almost all HNPCCassociated tumours shows microsatellite instability (MSI) and most tumours exhibit loss of MMR protein expression. 36 Approximately 10 15% of sporadic colorectal cancers (CRCs) also show MSI with concurrent absent staining for the MLH1 protein. 5,7,8 The major cause of this phenomenon is somatic hypermethylation of CpG dinucleotides in the promoter region of MLH1, what results in transcriptional silencing. 5,9 Recently, eight patients with colorectal cancer were reported in whom the promoter region of MLH1 was hypermethylated, not only in DNA isolated from tumour material, but also in DNA isolated from lymphocytes and other tissues, suggesting a germline or earlypostzygotic defect An overview of the clinical characteristics of these patients is presented in Table 1. Like a conventional pathogenic germline MMR gene mutation, the MLH1 promoter hypermethylation detected in these patients appears to be associated with high risks for HNPCCassociated cancers. The prevalences of germline MLH1 promoter hypermethylation varied in these studies from %. To gain further insight in the prevalence of germline MLH1 promoter hypermethylation, we investigated its occurrence in a series of HNPCC suspected patients. Furthermore, we molecularly characterised the tumours of patients with somatic and germline MLH1 promoter hypermethylation. MATERIALS AND METHODS Patient inclusion Forty HNPCC suspected cancer patients were included in this study. These patients were selected from a database in which study data on 344 HNPCC (suspected) families were collected. The index patients from these 344 families had been diagnosed with either earlyonset CRC or endometrial cancer, or with multiple HNPCC associated tumours. They had been included in a previous study with the aim of formulating criteria to select HNPCC suspected patients for mutation analysis. 14,15 The 40 patients were selected from this database as they were likely candidates to have (germline) MLH1 promoter hypermethylation: none of them carried a germline mutation in MLH1, MSH2 or MSH6; 25 had a tumour in which immunohistochemical analysis (IHC) had shown loss of the MLH1 protein, and the other 15 patients were selected because they had an MSIhigh tumour, which had not yet been investigated by IHC. The patient characteristics of the included patients are summarised in Table 2. Tumours of two known MLH1 mutation carriers and a sample of paraffinembedded 95

5 Table 1. Reports of eight patients with hypermethylation of the MLH1 promoter region in lymphocytes Author, selection criteria Patient Tumours Age* LOH MSI IHC MLH1 Gazolli, HNPCC suspected cases (which met AC I, AC II, HNPCClike criteria, or Bethesda criteria: 14 tumours MSIhigh without germline mutation in MLH1, MSH2, ormsh6,tested. Suter, individuals tested: 18 with hyperplastic polyposis, 11 with CRC, and 65 with a family history for CRC, but without germline mutation in MLH1, MSH2 or APC. Hitchins, HNPCC suspected families without germline mutation in MLH1 or MSH2 (70 met the AC II, 70 the revised Bethesda criteria, 20 were HNPCC suspected). Miyakura, CRC patients: 29 fulfilled the AC II, 28 with positive 1stdegree family history for CRC, 30 with early CRC or multiple HNPCC associated tumours. No mutation analysis in the MMR genes had been performed beforehand. Family history MLH1 methylation family members P1 CRC 25 a? ND TT, male VT, female ST, male H166, female H403, male H450, female H628, male CRC CRC DC 3x AV CRC EC ME BC a NA 2/3 a a ND NA a NA NA NA NA S: MM/70, M: EC/55, SM: OC/40 M: CRC/ 64 One child inherited the affected allele without methylation No MLH1 methylation in 2 children CRC 39 No MLH1 methylation in parents and 3 siblings CRC EC a ND CRC 28 ND ND GF: GC No MLH1 methylation in PBL of sister CRC 23 ND ND ND GM: PC ND CRC CRC ND ND Additional information Presence of the epimutation in a low proportion of spermatozoa In individual TT and VT one allele was never hypermethylated, the other hypermethylated allele showed occasionally hypomethylation Some mosaicism in the methylation patterns was observed between alleles, with some alleles showing partial methylation. No methylation at APC, BLM1, BRCA1, BRCA2, CDH1, CDH13, CDKN2A, HIC1, RASSF1A and TMEFF2 A: aunt, AC I and II: Amsterdam Criteria I and II, AV: ampulla of Vater, BC, breast cancer, CRC: colorectal cancer, DC: duodenal cancer, EC: endometrial cancer, F: father, GC: gastric cancer, GF: grandfather, GM: grandmother, LOH: loss of heterozygosity, M: mother, ME: melanoma, MM: multiple myeloma, MSI: microsatellite instability, NA: not available, ND: not done, NHL: NonHodgkin lymphoma, OC: ovarian carcinoma, PBL: peripheral blood lymphocytes, a PC: pancreatic cancer, P1 = patient 1 (sex unknown), S= sister, SM: sister of mother, : Loss of the non methylated allele, *: Age of onset ND GF: GC A: BC A: BC ND 96

6 Germline MLH1 promoter hypermethylation Table 2. Patient characteristics (n = 40) CRC < 50 years 22 (55 %) EC < 50 years 4 (10 %) Multiple HNPCC associated tumours 15 (38 %) Positive 1stdegree family history for HNPCC associated tumours 11 (28 %) Amsterdam Criteria II positive family 2 (5 %) Loss of MLH1 protein expression in the tumour 25 (63 %) MSIhigh tumour (with loss of MLH1 protein expression) 15 (38 %) MSIhigh tumour (without IHC data) 15 (38 %) MSIlow tumour (with loss of MLH1 protein expression) 8 (20 %) CRC: colorectal cancer, EC: endometrial cancer, HNPCC: hereditary nonpolyposis colorectal cancer syndrome, IHC: immunohistochemistry, MSI: microsatellite instability normal colon epithelium were also selected from the larger study population for tumour profiling. All patients had given their informed consent and the study was approved by the Medical Ethical Committee of the University Medical Center Groningen, The Netherlands. Immunohistochemistry Immunohistochemistry for the MLH1 protein was performed as previously described. 16 Protein expression in normal tissue adjacent to the tumour served as positive internal control. The sections were scored as either negative (i.e., absence of detectable nuclear staining of tumour cells) or positive for MLH1 staining. Scoring of the staining was performed without knowledge of the MSI or mutation status. Microsatellite instability analysis MSI analysis was performed as described previously using the 5 consensus markers: two mononucleotide repeats (BAT25, BAT26) and three dinucleotide repeats (D2S123, D5S346, D17S250). 16,17 Tumours were classified as MSIhigh when two or more markers showed MSI and as MSIlow when one or no marker showed MSI. As a limited number of markers was analysed, the classification microsatellitestable was not used. DNA isolation Genomic DNA was extracted from lymphocytes using standard methods. The Qiagen DNA mini kit (Qiagen, Venlo, The Netherlands) was used for DNA isolation from paraffin embedded tissue, from skin fibroblasts and a mouth wash. 97

7 Mutation analysis in the MMR genes All patients had been screened for mutations in MLH1, MSH2 and MSH6 previously, using the following techniques: denaturing gradient gel electrophoresis (DGGE), direct sequencing and multiplex ligation dependent probe amplification, as described previously. 18,19 DNA Methylation analysis Extracted DNA was treated with bisulfite using the EZ DNA MethylationGold Kit (Zymo Research, Orange, CA, USA). To amplify the MLH1promoter region from 337 to 154. Polymerase chain reactions (PCR ) were performed in a total reaction volume of 50 μl containing 2 μl bisulfite treated DNA solution, 15 pmol of each primer (Eurogentec, Serain, Belgium), 0.2 μl rtaq polymerase (5000 U/ml, Amersham Pharmacia Biotech Inc., Biscataway, NY, USA), 0.2 mm dntps (Amersham Pharmacia Biotech Inc., Biscataway, NY, USA) and 5 μl 10x PCR buffer (Amersham Biosciences, Roosendaal, Netherlands). The primer sequences are: 5 [40GC] TATTTTTGTTTTTATTGGTTGGATA3 and 5 [CCGGGCCC]AATACCAATCAAATTTCTCAACTCT3. A standard cycling regime was performed using the following conditions: initial denaturation for 5 minutes at 94 C, followed by 40 cycles of 1 minute at 94 C, 1 minute at 61 C and 1 minute at 72 C, and finally 5 minutes elongation at 72 C. PCR products were checked on a 2% agarose gel. Methylated and unmethylated PCR products were separated with denaturing gradient gel electrophoresis (DGGE). For DGGE analysis, samples were applied onto a 1mmthick 9% polyacrylamide (PAA) gel (acrylamide:bisacrylamide = 37.5:1) containing a denaturating gradient of 15% 50% ureaformamide (100% ureaformamide contains 7 mol/l urea and 40% deionized formamide). Electrophoresis was performed in 0.5 x TAE (1 x TAE = 40 mm Tris, HAC ph 8.0; 20 mm NaAc; 1 mm Na 2 EDTA), at 120 V/19 cm, for 16 hours at 55 C usingan INGENYphorU system (Ingeny International, Goes, The Netherlands). The gel pattern was visualised by ethidiumbromide staining for 10 minutes and UV transillumination of the gel. Samples which showed methylation were amplified again from bisulfite treated genomic DNA from lymphocytes with primers 5 TATTTTAGTAGAGGTATATAAGTTYGG and 5 CCTTCAACCAATCACCTCAATACC3, covering the promoter region from 370 to 48, and cycle sequenced in both directions with dye labelled nucleotides (Big Dye Terminator v3.1 Sequencing Kit, Applied Biosystems, Foster City, USA) to investigate the extent of the methylation. This fragment included the Cregion, in which the methylation status invariably correlates with lack of MLH1 expression

8 Germline MLH1 promoter hypermethylation Methylation analysis in other genes To investigate the presence of methylation of promoter regions of 25 tumour suppressor genes, a methylation specific multiplex ligation dependent probe amplification (MSMLPA) reaction (MRCHolland, Amsterdam, The Netherlands) was performed on lymphocyte and tumour DNA from patient Y110 (the patient with germline MLH1 promoter hypermethylation) and on tumour DNA from the patients which proved to have somatic MLH1 promoter hypermethylation. The samples were compared to four MSIhigh tumours which were shown not to exhibit MLH1 promoter hypermethylation, two MSIhigh tumours from patients with a germline MLH1 mutation, and a DNA sample extracted from paraffin embedded normal colon epithelium. Tumour samples which were not of good enough quality for the DGGE analysis were also investigated with MSMLPA. Similar to ordinary MLPA reactions, the MSMLPA protocol starts with sample DNA denaturation and overnight hybridization of MLPA probes to their specific DNA targets. The reaction is then split into two tubes. The one tube is processed as a standard MLPA reaction: ligation of hybridised probe oligonucleotides followed by PCR amplification of ligated probes. This reaction provides information on copy numbers. The other tube of the MLPA hybridization reaction is incubated with the methylation sensitive HhaI endonuclease while simultaneously, the hybridised probes are being ligated. Hybrids of (unmethylated) probe oligonucleotides and unmethylated sample DNA are digested by the HhaI enzyme. Digested probes will not be amplified by PCR and hence will not generate a signal when analysed by (capillary) electrophoresis. In contrast, if the sample DNA is methylated, the (hemi )methylated DNAprobe sample hybrids are prevented from being digested by HhaI and the ligated probes will generate a signal. Table 3 shows the genes which are investigated using this technique. BRAF and KRAS analysis To further characterise the tumour phenotype of patient Y110, we investigated the tumour for presence of the BRAFVal600Glu mutation and for mutations in codons 12 and 13 of KRAS. Exon 15 of BRAF was amplified using the primers 5 TCATAATGCTTGCTCTGATAGGA 3 and 5 GGCCAAAAATTTAATCAGTGGA3 using a standard PCR program (35 cycles) with an annealing temperature of 58 C. 21 Amplification of KRAS exon 1 was performed as described previously. 22 The products were sequenced on a ABI3100 sequencer (Applied Biosystems, Foster City, USA). 99

9 RESULTS DNA methylation analysis DNA methylation analysis of 40 patients resulted in the identification of one patient (patient Y110) with hypermethylation of the MLH1 promoter region in lymphocytes. In DNA isolated from a tumour, skin fibroblasts and a mouth wash of the same patient, a similar methylation pattern was detected (Fig. 1). Direct sequencing of the MLH1 promoter region from 370 to 90 in DNA isolated from lymphocytes showed that all of the 15 CpG dinucleotides present in the fragment were methylated. This male patient had been diagnosed with CRC at age 37. The tumour had an MSIhigh phenotype and showed loss of MLH1 expression. The family history for HNPCCassociated tumours was negative. His deceased father had been diagnosed with a nonhodgkin lymphoma at age 64. His mother was healthy at age 84, as well as his 7 siblings at ages ranging from 48 to 60. The two daughters of the patient were healthy at ages 15 and 18. Tumour DNA was available for 17 of the other 39 patients for DNA methylation analysis. In total 6 patients proved to have a tumour with somatic MLH1 hypermethylation. All 6 patients had a tumour which showed loss of MLH1 staining. Three of these tumours were MSIhigh and two were MSIlow. In one case the MSIanalysis had failed. Four of the 17 patients had a tumour which showed no MLH1 promoter hypermethylation and in 6 cases the quality of the extracted DNA was too poor for methylation analysis. Methylation analysis, performed on DNA isolated from lymphocytes from all 7 siblings of patient Y110 and his mother and on DNA from the lymphoma of the deceased father, showed that none of them had hypermethylation of the MLH1 promoter region (Fig. 1). 100

10 Germline MLH1 promoter hypermethylation Figure 1. Methylation analysis of MLH1 promoter region. Denaturating Gradient Gel Electroforesis of PCR products of the MLH1 promoter region, amplified from bisulfite treated DNA from lymphocytes, tumour tissue, mouth wash and skin fibroblasts. As methylated cytosines are resistant to conversion to uracil by bisulfite treatment, PCR fragments with methylation have a higher GCcontent, and as a consequence a higher melting temperature. Thus, these fragments appear lower in the gel. The tumour of the index patient (lane I T) shows loss of the wild type allele. F: skin fibroblasts, I: index patient Y110, L: lymphocytes, M: mother, P: father, S: sibling, T: tumour tissue, W: mouth wash. 101

11 Methylation analysis in other genes The results of the methylation specific MLPA are summarised in Table 3. Figure 2 shows the MLPA peak patterns of normal colon tissue and lymphocytes of patient Y110, his tumour and the tumour of patient Y275, which had extensive methylation. The DNA sample from normal colon epithelium showed no methylation of the genes investigated. Neither did the two tumours of MLH1 mutation carriers. In DNA from lymphocytes from patient Y110, the MLH1 methylation was confirmed, as two different CpGdinucleotides in the MLH1 promoter were shown to be methylated. The tumour of this patient showed additional methylation of the RARB and PTEN promoters. The MSMLPA was also performed on the tumour samples of which the quality had been too poor for the DGGE analysis. In this way, two extra tumours with somatic MLH1 promoter hypermethylation (making a total of eight) and two additional MSIhigh tumours without MLH1 promoter hypermethylation were detected. One sample of the eight tumours with somatic MLH1 promoter hypermethylation was not available for MSMLPA. One of the remaining seven tumours (Y25) showed hypermethylation of one tumour suppressor gene and six showed hypermethylation of several tumour suppressor genes (Table 3). Four MSIhigh tumours without somatic MLH1 promoter hypermethylation showed a similar methylation pattern. Table 3. Tumour suppressor gene methylation spectrum. The black boxes mark the genes which were hypermethylated in the promoter. *The results for the ESR1 gene were not in all samples interpretable, due to an incomplete digest in the control sample. 102

12 Germline MLH1 promoter hypermethylation Tumours from MLH1 mutation carriers MSIhigh tumours without somatic hypermethylation and MMR gene mutation Patient with germline MLH1 HM Tumours with somatic MLH1 hypermethylation and MMR gene mutation HhaI site Gene Control paraffin Y5 tumour Y22 tumour Y166 tumour Y220 tumour Y224 tumour Y758 tumour Y110 PBL Y110 tumour Y275 tumour Y227 tumour Y270 tumour Y191 tumour Y25 tumour Y181 tumour Y279 tumour CREM TIMP3 APC PARK2 CDKN2A MLH1 TNFRSF1A ATM RARB MLH3 CDKN2B HIC1 PAH CHFR BRCA1 BCL2 CASP8 CDKN1B TSC2 PTEN BRCA2 CDK6 CD44 RASSF1 CDH1 DAPK1 VHL AI ESR1* RASSF1 KLK3 TP73 FHIT BRCA2 IGSF4 CDH13 TNFRSF7 GSTP1 MLH1 CTNNB1 CASR 103

13 Figure 2. MLPA analysis of promoter methylation status of 25 tumour suppressor genes. A: Undigested control sample of paraffin embedded normal colon tissue. B: Digested sample of paraffin embedded normal colon tissue. Only promoters of genes without an HhaI restriction site show peaks. C: Digested sample of lymphocytes from patient Y110. Two different loci in the MLH1 promoter show methylation (indicated with an arrow). D: Digested tumour sample of patient Y110. In addition to MLH1, the RARB and PTEN promoters also show hypermethylation. E: Digested tumour sample of patient Y275. Promoter hypermethylation is seen in MLH1, TIMP3, APC, RARB, CHFR, PTEN, ESR1,andCDH13. BRAFandKRASanalysis The tumour of patient Y110 did not harbour the BRAF V600E mutation. However, in codon 12 of KRAS, the p.gly12ala missense mutation was detected. 104

14 Germline MLH1 promoter hypermethylation DISCUSSION In this study we identified one male patient (patient Y110) with hypermethylation of the MLH1 promoter in lymphocytes amongst 40 mutation negative HNPCC suspected patients who either had a tumour with a negative MLH1 staining, or an MSIhigh tumour. He had been diagnosed with CRC at age 37. The hypermethylation was also present in DNA from skin fibroblasts, a mouth wash and in his colorectal tumour. Methylation analysis in DNA from lymphocytes from his mother, his seven siblings, and from a lymphoma from his father suggested that the methylation in patient Y110 was de novo postzygotic or de novo germline. Previously, eight cancer patients with germline MLH1 promoter methylation were reported (Table I) Five of them had a negative first degree family history for HNPCC associated tumours. In four families firstdegree family members were tested: none of the total of nine tested family members had MLH1 promoter methylation. However, Suter et al. reported that MLH1 promoter methylation was present in a small proportion of spermatozoa from an affected patient, indicating that it has the potential of being transmitted to offspring. 13 One child of that patient had inherited an unmethylated allele which had been methylated in the patient. An explanation could be that the human genome undergoes a genomewide erasure of DNA methylation after fertilisation during the preimplantation and early postimplantation stages. 23 In all likelihood, the risk of transmitting MLH1 promoter methylation to offspring is low. This suggestion is supported by the fact that most patients with germline MLH1 promoter hypermethylation had a negative family history for HNPCC associated tumours. DNA from the two daughters of patient Y110 was unavailable for DNA testing. In time, the daughters will be offered presymptomatic counselling and enrolment in HNPCC screening programs until their cancer risk is established. Germline MLH1 promoter hypermethylation is responsible for only a very small proportion of patients with colorectal cancer. We identified one case in our highly selected patient population of 40 HNPCC suspected patients (2.2%). Gazolli et al. identified one case in 48 HNPCC suspected patients (2.1%), Miyakura et al. four cases in 87 HNPCC suspected CRC patients (4.6%), Hitchins et al. one in 160 HNPCC suspected patients (0.6%), and Suter et al. identified two patients amongst 94 individuals The variation in frequencies can be attributed to differences in selection procedures for the patient inclusion. In total, including the patient identified in this study, nine patients with germline MLH1 promoter hypermethylation have been reported with a mean age of diagnosis of 33 years (range 1746), whichis12yearsyoungerthantheaverageage of onset in HNPCC patients. Most of the 105

15 investigated tumours of these patients showed LOH, MSI and loss of MLH1 expression (Table 1). Hitchins et al. studied the tumour of their patient for promoter methylation of APC, BRCA1, CDH13, CDKN2A, HIC1, RASSF1A, BLM1, CDH1, andtmeff2. 11 They found no methylation at these promoter sites. We studied eight tumours with somatic or germline MLH1 promoter hypermethylation for presence of methylation in 25 tumour suppressor genes with methylation specific MLPA and compared the results to four MSIhigh tumours without MLH1 promoter hypermethylation and two MSIhigh tumours from MLH1 mutation carriers (Table 2). The tumours (with the exception of the tumour of patient Y25) of the patients with somatic MLH1 promoter methylation showed promoter methylation of several other genes, suggesting that these tumours may be classified as CpG island methylator phenotype (CIMP) positive. CIMP tumours show an extremely high frequency of methylation of CpG islands. 24 In addition, they exhibit such an exceptionally high rate of mutations in BRAF (p.val600glu in exon 15) or KRAS (codons 12 and 13 of exon 1), that almost all CIMPpositive tumours show evidence of activation of the RAS oncogenic pathway. 24,25 The four MSIhigh tumours without MLH1 promoter hypermethylation showed also methylation in several genes (one tumour in only one gene), though slightly less than the tumours with MLH1 promoter hypermethylation. In contrast, the tumours of the two MLH1 mutation carriers did not show methylation in other genes. The tumour of patient Y110 had in addition to the promoter MLH1, also the promoters of RARB and PTEN methylated and harboured the p.gly12ala in codon 12 of KRAS. This suggests that tumourigenesis in patient Y110 followed a similar pattern of development as CIMP tumours. Taken together, MLH1 was inactivated in the tumour of patient Y110 with the first hit in the germline or earlypostzygotic and the second hit by LOH at the time of initiation of the tumour. This resulted in mismatch repair deficiency and activation of the RAS oncogenic pathway. To conclude, germline (or earlypostzygotic) MLH1 promoter hypermethylation is responsible for a small fraction of colorectal tumours. Clinicians should take this phenomenon into account when they encounter (young) patients whose tumours show microsatellite instability and a negative MLH1 staining in absence of a germline mutation in MLH1, independent of family history. If a tumour of such a patient shows somatic MLH1 promoter hypermethylation, testing for germline MLH1 promoter hypermethylation should be offered. If a germline defect is revealed, HNPCC screening programs are indicated to prevent cancer or to detect it in an early stage. Although the risk of transmitting germline MLH1 promoter 106

16 Germline MLH1 promoter hypermethylation hypermethylation to offspring seems to be small, first degree family members should be offered presymptomatic testing. REFERENCES 1. Lynch HT, de la Chapelle A. Hereditary colorectal cancer. N Engl J Med 2003;348(10): Marra G, Boland CR. Hereditary nonpolyposis colorectal cancer: the syndrome, the genes, and historical perspectives. J Natl Cancer Inst 1995;87(15): Pedroni M, Tamassia MG, Percesepe A et al. Microsatellite instability in multiple colorectal tumors. Int J Cancer 1999;81(1): Leach FS, Polyak K, Burrell M et al. Expression of the human mismatch repair gene hmsh2 in normal and neoplastic tissues. Cancer Res 1996;56(2): Thibodeau SN, Bren G, Schaid D. Microsatellite instability in cancer of the proximal colon. Science 1993;260(5109): Thibodeau SN, French AJ, Roche PC et al. Altered expression of hmsh2 and hmlh1 in tumors with microsatellite instability and genetic alterations in mismatch repair genes. Cancer Res 1996;56(21): Aaltonen LA, Peltomaki P, Leach FS et al. Clues to the pathogenesis of familial colorectal cancer. Science 1993;260(5109): Kim H, Jen J, Vogelstein B et al. Clinical and pathological characteristics of sporadic colorectal carcinomas with DNA replication errors in microsatellite sequences. Am J Pathol 1994;145(1): Robertson KD. DNA methylation and human disease. Nat Rev Genet 2005;6(8): Gazzoli I, Loda M, Garber J et al. A hereditary nonpolyposis colorectal carcinoma case associated with hypermethylation of the MLH1 gene in normal tissue and loss of heterozygosity of the unmethylated allele in the resulting microsatellite instabilityhigh tumor. Cancer Res 2002;62(14): Hitchins M, Williams R, Cheong K et al. MLH1 germline epimutations as a factor in hereditary nonpolyposis colorectal cancer. Gastroenterology 2005;129(5): Miyakura Y, Sugano K, Akasu T et al. Extensive but hemiallelic methylation of the hmlh1 promoter region in earlyonset sporadic colon cancers with microsatellite instability. Clin Gastroenterol Hepatol 2004;2(2): Suter CM, Martin DI, Ward RL. Germline epimutation of MLH1 in individuals with multiple cancers. Nat Genet 2004;36(5): Berends MJ, Wu Y, Sijmons RH et al. Toward new strategies to select young endometrial cancer patients for mismatch repair gene mutation analysis. J Clin Oncol 2003;21(23): Niessen RC, Berends MJ, Wu Y et al. Identification of mismatch repair gene mutations in young colorectal cancer patients and patients with multiple HNPCCassociated tumours. Gut Berends MJ, Wu Y, Sijmons RH et al. Molecular and clinical characteristics of MSH6 variants: an analysis of 25 index carriers of a germline variant. Am J Hum Genet 2002;70(1): Boland CR, Thibodeau SN, Hamilton SR et al. A National Cancer Institute Workshop on Microsatellite 107

17 Instability for cancer detection and familial predisposition: development of international criteria for the determination of microsatellite instability in colorectal cancer. Cancer Res 1998;58(22): Wu, Y. Design and application of DGGEbased mutation detection systems for genes involved in HNPCC Thesis. University of Groningen ( 19. Gille JJ, Hogervorst FB, Pals G et al. Genomic deletions of MSH2 and MLH1 in colorectal cancer families detected by a novel mutation detection approach. Br J Cancer 2002;87(8): Deng G, Chen A, Hong J et al. Methylation of CpG in a small region of the hmlh1 promoter invariably correlates with the absence of gene expression. Cancer Res 1999;59(9): Davies H, Bignell GR, Cox C et al. Mutations of the BRAF gene in human cancer. Nature 2002;417(6892): Hayes VM, Westra JL, Verlind E et al. New comprehensive denaturinggradientgel electrophoresis assay for KRAS mutation detection applied to paraffinembedded tumours. Genes Chromosomes Cancer 2000;29(4): Allegrucci C, Thurston A, Lucas E et al. Epigenetics and the germline. Reproduction 2005;129(2): Weisenberger DJ, Siegmund KD, Campan M et al. CpG island methylator phenotype underlies sporadic microsatellite instability and is tightly associated with BRAF mutation in colorectal cancer. Nat Genet 2006;38(7): Issa JP. CpG island methylator phenotype in cancer. Nat Rev Cancer 2004;4(12):