خداوند نام و خداوند جای خداوند روزی ده رهنمای

Size: px
Start display at page:

Download "خداوند نام و خداوند جای خداوند روزی ده رهنمای"

Transcription

1 به نام خداوند جان و خرد کزین برتر اندیشه برنگذرد خداوند نام و خداوند جای خداوند روزی ده رهنمای خداوند کیوان و گردان سپهر ز نام و نشان و گمان برترست به بینندگان آفریننده را نیابد بدو نیز اندیشه راه سخن هر چه زین گوهران بگذرد خرد گر سخن برگزیند همی ستودن نداند کس او را چو هست خرد را و جان را همی سنجد اوی بدین آلت رای و جان و زبان به هستیش باید که خستو شوی پرستنده باشی و جوینده راه توانا بود هر که دانا بود از این پرده برتر سخن گاه نیست فروزنده ماه و ناهید و مهر نگارنده بر شده پیکرست نبینی مرنجان دو بیننده را که او برتر از نام و از جایگاه نیابد بدو راه جان و خرد همان را گزیند که بیند همی میان بندگی را ببایدت بست در اندیشه سخته کی گنجد اوی ستود آفریننده را کی توان ز گفتاربی کار یکسو شوی به ژرفی به فرمانش کردن نگاه ز دانش دل پیر برنا بود ز هستی مر اندیشه را راه نیس

2 Pathology and clinic Pathology and clinic

3 Clinicians Are From Mars and Pathologists Are From Venus

4 just as medical language may be hard for lay people to understand, medical specialists may use language that is obscure to practitioners outside their specialty. Among specialists, the language of diagnostic anatomic pathologist is arguably furthest from daily medical discourse. There has been an implicit recognition of this fact in efforts to standardize pathology reporting. These efforts have lead to the adoption of the so-called Bethesda system for Papanicolaou smear reporting1 and similar attempts to standardize reports in other areas, including tumor resections, transplant biopsies, and liver biopsies. However, little explicit attention has been focused on the ability of clinicians to understand pathology reports, despite the role of reports in guiding treatment.

5

6

7 Pathology Department -Biopsy -Cytology Specimen -Autopsy -Necropsy

8 Quality control in the histopathology laboratory:

9 MEASURING QUALITY IN SURGICAL PATHOLOGY Elements of quality that are important in surgical pathology include report accuracy, timeliness, and report completeness price

10 This standard aims to have the total number of failures in quality, or customer satisfaction at 3.4 defects or fewer than 4 defects per products. By comparison, various studies have estimated surgical pathology error rates from as low as 0.25% (2500 per million) to as high as 40%.4 Most investigators, however, agree that a significant error rate in surgical pathology is in the range of 0.5% to 1%.

11 The concept of quality control in histopathology is relatively young and less well understood. Quality control is traditionally applicable to three phases of operation 1) the pre-analytical phase, 2) the analytical phase 3) the post-analytical phase There is a special focus on external quality assessment

12 The pre-analytical phase is related to sample collection, transport, accession and processing.

13 Various studies indicate that the majority of errors in the laboratory relate to the pre-analytical phase

14

15 Analytic phase The analytic phase of the test cycle begins with gross examination of the specimen and ends with diagnosis. All manipulations of the specimen subsequent to gross examinatio such as histological preparation and immunohistochemistry, that lead to a diagnosis are therefore components of the analytic phase of the test cycle. Most critical in this in a diagnosis, including gross dissection and section, embedding, histological sectioning, staining, special and immunohistochemical staining, possible other ancillary studies, and microscopic interpretation. The accuracy of the final diagnosis is a measure of the effectiveness of all of these sequential steps.

16 Analytic aspects The following general recommendations are being made at this stage. 1. For departments with more than one pathologist: -Intra-departmental consultation (review of selected cases by colleagues) -Comparison with other reports (frozen/cytology/histopathology) -Random case review (blinded re-reporting of random cases) By the same person (check for precision) By a different person (check for accuracy) -Intra- and inter-departmental conferences (clinico-pathological conference (CPC)/clinical rounds)

17 2. For laboratories run by single pathologist: reasonable quality may still be achieved by implementing the following: -Random blinded review of reported cases (precision check) -External consultations (may need to be done more often) -Review by experts -Participation in continued medical education (CME) programs

18

19 Post-analytic phase The post-analytic phase of the test cycle begins with dictation of the gross and microscopic examination and the final diagnosis and includes transcription, report correction, verification, and report delivery. Keys in the post-analytic phase are accurate transcription, complete reporting, and report delivery.

20

21

22 As stated above, TAT is a critical element of quality and usually covers all aspects of the laboratory test cycle. While TAT may be fragmented into smaller components, the total TAT is the only measure by which the clinician or customerwill judge the laboratory.

23

24 1.What might the pathology report say about the physical and chemical characteristics of the tissue? After identifying the tissue as cancerous, the pathologist may perform additional tests to get more information about the tumor that cannot be determined by looking at the tissue with routine stains, such as hematoxylin and eosin (also known as H&E), under a microscope (2). The pathology report will include the results of these tests. For example, the pathology report may include information obtained from immunochemical stains (IHC). IHC uses antibodies to identify specific antigens on the surface of cancer cells. IHC can often be used to: Determine where the cancer started Distinguish among different cancer types, such as carcinoma, melanoma, and lymphoma Help diagnose and classify leukemias and lymphomas (3) The pathology report may also include the results of flow cytometry. Flow cytometry is a method of measuring properties of cells in a sample, including the number of cells, percentage of live cells, cell size and shape, and presence of tumor markers on the cell surface. Tumor markers are substances produced by tumor cells or by other cells in the body in response to cancer or certain noncancerous conditions.) Flow cytometry can be used in the diagnosis, classification, and management of cancers such as acute leukemia, chronic lymphoproliferative disorders, and non-hodgkin lymphoma (2). Finally, the pathology report may include the results of molecular diagnostic and cytogenetic studies. Such studies investigate the presence or absence of malignant cells, and genetic or molecular abnormalities in specimens.

25 What information about the genetics of the cells might be included in the pathology report? report? Cytogenetics uses tissue culture and specialized techniques to provide genetic information about cells, particularly genetic alterations. Some genetic alterations are markers or indicators of a specific cancer. For example, the Philadelphia chromosome is associated with chronic myelogenous leukemia (CML). Some alterations can provide information about prognosis, which helps the doctor make treatment recommendations (3). Some tests that might be performed on a tissue sample include:

26 Fluorescence in situ hybridization (FISH): Determines the positions of particular genes. It can be used to identify chromosomal abnormalities and to map genes. Polymerase chain reaction (PCR): A method of making many copies of particular DNA sequences of relevance to the diagnosis. Real-time PCR or quantitative PCR: A method of measuring how many copies of a particular DNA sequence are present. Reverse-transcriptase polymerase chain reaction (RT-PCR): A method of making many copies of a specific RNA sequence. Southern blot hybridization: Detects specific DNA fragments. Western blot hybridization: Identifies and analyzes proteins or peptides.

27 Can individuals get a second opinion about their pathology results? Although most cancers can be easily diagnosed, sometimes patients or their doctors may want to get a second opinion about the pathology results (1). Patients interested in getting a second opinion should talk with their doctor. They will need to obtain the slides and/or paraffin block from the pathologist who examined the sample or from the hospital where the biopsy or surgery was done.

28 Policy for Rejection of Specimens

Quality assurance and quality control in pathology in breast disease centers

Quality assurance and quality control in pathology in breast disease centers Quality assurance and quality control in pathology in breast disease centers Judith Sandbank M.D. Pathology Assaf-Harofeh Medical Center ISRAEL jsandbank@asaf.health.gov.il 1 st IBDC, 28 th January, 2011

More information

Pathology Student Interest Group. Sponsored by the College of American Pathologists

Pathology Student Interest Group. Sponsored by the College of American Pathologists Pathology Student Interest Group Sponsored by the College of American Pathologists Pathology Right Now, A Pathologist Somewhere Is. Evaluating Surgical Specimens Diagnosis and Staging of Cancer Adequacy

More information

INTRODUCTION TO PATHOLOGY

INTRODUCTION TO PATHOLOGY INTRODUCTION TO PATHOLOGY The literal translation of the word pathology is the study (logos) of suffering (pathos). It is a discipline that bridges clinical practice and basic sciences. Pathology is concerned

More information

Contributions to Anatomic Pathology, over the years

Contributions to Anatomic Pathology, over the years Contributions to Anatomic Pathology, over the years Anatomic Pathology, part 1 G.B. Morgagni Xavier Bichat Rudolf Wirchow Anatomic Pathology, part 1 Anatomic pathology materials: morphological samples

More information

Cancers of unknown primary : Knowing the unknown. Prof. Ahmed Hossain Professor of Medicine SSMC

Cancers of unknown primary : Knowing the unknown. Prof. Ahmed Hossain Professor of Medicine SSMC Cancers of unknown primary : Knowing the unknown Prof. Ahmed Hossain Professor of Medicine SSMC Definition Cancers of unknown primary site (CUPs) Represent a heterogeneous group of metastatic tumours,

More information

Neoplasia 2018 lecture 11. Dr H Awad FRCPath

Neoplasia 2018 lecture 11. Dr H Awad FRCPath Neoplasia 2018 lecture 11 Dr H Awad FRCPath Clinical aspects of neoplasia Tumors affect patients by: 1. their location 2. hormonal secretions 3. paraneoplastic syndromes 4. cachexia Tumor location Even

More information

ANATOMICAL PATHOLOGY TARIFF

ANATOMICAL PATHOLOGY TARIFF ANATOMICAL PATHOLOGY TARIFF A GUIDE TO UTILISATION. The following guidelines have been agreed by consensus of Anatomical Pathologists who are members of the Anatomical Pathologist s Group, or the National

More information

Diagnostic Detectives: Medical Laboratory Professionals A Closer Look at Careers in Histology

Diagnostic Detectives: Medical Laboratory Professionals A Closer Look at Careers in Histology Diagnostic Detectives: Medical Laboratory Professionals A Closer Look at Careers in Histology When your doctor orders lab tests do you know.. Who prepares, embeds, cuts, and stains tissue samples and biopsies

More information

Quality Indicators - Anatomic Pathology- HSC/STC Jul-Sep 2 nd Qtr. Apr-Jun 1 st Qtr

Quality Indicators - Anatomic Pathology- HSC/STC Jul-Sep 2 nd Qtr. Apr-Jun 1 st Qtr Eastern Health Volume 86 Page 001 CIHRT Exhibit P-3595 Page 1 INDICATOR Financial Overtime Hours / FTE Workload Increase - FTE equivalent Workload Quality Indicators - Anatomic Pathology- HSC/STC TOTAL

More information

PD-L1 Analyte Control DR

PD-L1 Analyte Control DR Quality in Control PD-L1 Analyte Control DR PD-L1_PI_v2 Product Codes: HCL019, HCL020 and HCL021 Contents PD-L1 Analyte Control DR 2 What is PD-L1? 3 The Role of PD-L1 in Cancer 3 PD-L1 Assessment 4 PD-L1

More information

Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR

Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid

More information

Hematopathology Case Study

Hematopathology Case Study www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated

More information

Applying Risk Management Principles to QA in Surgical Pathology: From Principles to Practice

Applying Risk Management Principles to QA in Surgical Pathology: From Principles to Practice Applying Risk Management Principles to QA in Surgical Pathology: From Principles to Practice Dr. Gregory Flynn CEO, Institute for Quality Management in Healthcare Managing Director, Quality Management

More information

October Billing and compliance. Coagulation. Immunohistochemistry. Immunology. Referral testing ICD 10

October Billing and compliance. Coagulation. Immunohistochemistry. Immunology. Referral testing ICD 10 October 2015 Billing and compliance ICD 10 Coagulation Processing, transport and stability changes for multiple coagulation tests Immunohistochemistry IHC stain updates Immunology Lyme Western Blot testing

More information

Applications of IHC. Determination of the primary site in metastatic tumors of unknown origin

Applications of IHC. Determination of the primary site in metastatic tumors of unknown origin Applications of IHC Determination of the primary site in metastatic tumors of unknown origin Classification of tumors that appear 'undifferentiated' by standard light microscopy Precise classification

More information

Study Finds Lung Cancer Subtype Test from UNC, Startup GeneCentric to be Accurate, Reproducible

Study Finds Lung Cancer Subtype Test from UNC, Startup GeneCentric to be Accurate, Reproducible Study Finds Lung Cancer Subtype Test from UNC, Startup GeneCentric to be Accurate, Reproducible May 30, 2013 By Ben Butkus A team led by clinical researchers from the University of North Carolina, Chapel

More information

VDx: Unlocking Complex Diagnostics

VDx: Unlocking Complex Diagnostics VDx: Unlocking Complex Diagnostics VDx now offers PARR testing in-house on formalin-fixed tissue Complicated Case? Is this cat s chronic lymphocytic enteritis really chronic IBD or is this early small

More information

ACMG/CAP Cytogenetics CY

ACMG/CAP Cytogenetics CY www.cap.org Cytogenetics Analytes/procedures in bold type are regulated for proficiency testing by the Centers for Medicare & Medicaid Services ACMG/CAP Cytogenetics CY Analyte CY Challenges per Shipment

More information

NPQR Quality Payment Program (QPP) Measures 21_18247_LS.

NPQR Quality Payment Program (QPP) Measures 21_18247_LS. NPQR Quality Payment Program (QPP) Measures 21_18247_LS MEASURE ID: QPP 99 MEASURE TITLE: Breast Cancer Resection Pathology Reporting pt Category (Primary Tumor) and pn Category (Regional Lymph Nodes)

More information

Cost-Effective Strategies in the Workup of Hematologic Neoplasm. Karl S. Theil, Claudiu V. Cotta Cleveland Clinic

Cost-Effective Strategies in the Workup of Hematologic Neoplasm. Karl S. Theil, Claudiu V. Cotta Cleveland Clinic Cost-Effective Strategies in the Workup of Hematologic Neoplasm Karl S. Theil, Claudiu V. Cotta Cleveland Clinic In the past 12 months, we have not had a significant financial interest or other relationship

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Microarray-based Gene Expression Testing for Cancers of Unknown File Name: Origination: Last CAP Review: Next CAP Review: Last Review: microarray-based_gene_expression_testing_for_cancers_of_unknown_primary

More information

Objectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013

Objectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013 Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie

More information

Guidelines for Specimen Submission to Pathology Laboratory

Guidelines for Specimen Submission to Pathology Laboratory به نام خدا Guidelines for Specimen Submission to Pathology Laboratory Pre-analytic phase 1. Specimen identification 2. Adequacy of clinical history 3. Specimen fixation 4. Specimen delivery 5. Accessioning

More information

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing

More information

Cleveland Clinic Laboratories. Anatomic Pathology

Cleveland Clinic Laboratories. Anatomic Pathology Cleveland Clinic Laboratories Anatomic Pathology OUR MISSION Cleveland Clinic Laboratories contributes to excellent patient care by providing high-quality, comprehensive laboratory testing and patient-focused

More information

Patterns of lymph node biopsy pathology at. Chris Hani Baragwanath Academic Hospital. over a period of three years Denasha Lavanya Reddy

Patterns of lymph node biopsy pathology at. Chris Hani Baragwanath Academic Hospital. over a period of three years Denasha Lavanya Reddy Patterns of lymph node biopsy pathology at Chris Hani Baragwanath Academic Hospital over a period of three years 2010-2012 Denasha Lavanya Reddy Student number: 742452 A research report submitted to the

More information

GYNECOLOGICAL PATHOLOGY FELLOWSHIP PROGRAM

GYNECOLOGICAL PATHOLOGY FELLOWSHIP PROGRAM GYNECOLOGICAL PATHOLOGY FELLOWSHIP PROGRAM The Department of Pathology and Laboratory Medicine University of Calgary, Faculty of Medicine Calgary Health Region and Calgary Laboratory Services Calgary,

More information

Evolution of Pathology

Evolution of Pathology 1 Traditional pathology Molecular pathology 2 Evolution of Pathology Gross Pathology Cellular Pathology Morphologic Pathology Molecular/Predictive Pathology Antonio Benivieni (1443-1502): First autopsy

More information

Myelodysplasia/Myeloproliferative Neoplasms (MDS/MPN) Post-HCT Data

Myelodysplasia/Myeloproliferative Neoplasms (MDS/MPN) Post-HCT Data Instructions for Myelodysplasia/Myeloproliferative Neoplasms (MDS/MPN) Post-HCT Data (Form 2114) This section of the CIBMTR Forms Instruction Manual is intended to be a resource for completing the Myelodysplasia/Myeloproliferative

More information

Gastrointestinal PATHOLOGY FELLOWSHIP

Gastrointestinal PATHOLOGY FELLOWSHIP Gastrointestinal PATHOLOGY FELLOWSHIP The Department of Pathology and Laboratory Medicine University of Calgary Calgary, Alberta Description and Objectives Prepared: November 21, 2016 Revised: August 21,

More information

Histotechnological problems in dermatopathology and their possible consequences

Histotechnological problems in dermatopathology and their possible consequences Histotechnological problems in dermatopathology and their possible consequences Zsolt B. Argenyi, M.D. Professor of Pathology & Dermatology Director of Dermatopathology University of Washington, Seattle,

More information

Quality Assurance and Quality Control in the Pathology Dept.

Quality Assurance and Quality Control in the Pathology Dept. Quality Assurance and Quality Control in the Pathology Dept. Judith Sandbank M.D. Pathology Assaf-Harofeh Medical Center ISRAEL jsandbank@asaf.health.gov.il 2 nd IBDC, 9 th February, 2012 Pathology as

More information

DIRECTED WORKPLACE-BASED ASSESSMENTS BY STAGES OF TRAINING AND OPTIONAL PACKAGES

DIRECTED WORKPLACE-BASED ASSESSMENTS BY STAGES OF TRAINING AND OPTIONAL PACKAGES DIRECTED WORKPLACE-BASED ASSESSMENTS BY STAGES OF TRAINING AND OPTIONAL PACKAGES The following are lists of workplace-based assessments, from which should be selected appropriate examples to make up the

More information

UW Medicine Neuropathology

UW Medicine Neuropathology Neuropathology in Patient Care Surgical Neuropathology is that subspecialty of pathology that provides diagnoses on biopsies from the brain, spinal cord, skeletal muscle, peripheral nerve, and eye. In

More information

Central Pathology Review and Tissue MicroArrays. Dr Lisa Storer Children s Brain Tumour Research Centre Nottingham

Central Pathology Review and Tissue MicroArrays. Dr Lisa Storer Children s Brain Tumour Research Centre Nottingham Central Pathology Review and Tissue MicroArrays Dr Lisa Storer Children s Brain Tumour Research Centre Nottingham What is a tissue microarray? Tissue microarrays (TMAs) consist of paraffin blocks in which

More information

Positioning the Laboratory to Integrate Clinical Care:

Positioning the Laboratory to Integrate Clinical Care: William G. Morice, M.D., Ph.D. Chair, Division of Hematopathology Mayo Clinic, Rochester, MN Positioning the Laboratory to Integrate Clinical Care: New Approaches to Interactive Test Ordering and Reporting

More information

1. Q: What has changed from the draft recommendations posted for public comment in November/December 2011?

1. Q: What has changed from the draft recommendations posted for public comment in November/December 2011? Frequently Asked Questions (FAQs) in regard to Molecular Testing Guideline for Selection of Lung Cancer Patients for EGFR and ALK Tyrosine Kinase Inhibitors 1. Q: What has changed from the draft recommendations

More information

The Pathology of Neoplasia Part II

The Pathology of Neoplasia Part II The Pathology of Neoplasia Part II February 2018 PAUL BOGNER, MD A S S O C I A T E P R O F E S S O R O F O N C O L O G Y P A T H O L O G Y A N D D E R M A T O L O G Y Clinical goals of cancer pathology

More information

1.5. Research Areas Treatment Selection

1.5. Research Areas Treatment Selection 1.5. Research Areas Cancer biomarker research embraces many areas of study, including tumorigenesis, metastasis, clinical trial and surrogate endpoints, cell isolation, target identification, drug resistance,

More information

Addendum report coding for the National Quality Improvement Programme in Histopathology: a multi-institutional audit

Addendum report coding for the National Quality Improvement Programme in Histopathology: a multi-institutional audit Addendum report coding for the National Quality Improvement Programme in Histopathology: a multi-institutional audit S. Mahon 1,3, D. Catargiu 2, S. Phelan 2, S. Crowther 3, N. Swan 1. St. Vincent s University

More information

Skin biopsy. Sophia Otto SA Pathology

Skin biopsy. Sophia Otto SA Pathology Skin biopsy Sophia Otto SA Pathology RCPA (Royal College of Pathologists of Australasia) The RCPA is the leading organisation representing pathologists in Australasia. Its mission is to train and support

More information

Chapter 8. Summary. Chapter 8. Summary

Chapter 8. Summary. Chapter 8. Summary Chapter 8 Chapter 8 Summary Summary Summary In CHAPTER 1 an introduction to several aspects of cervical cancer, HPV and their relation with immunology is given. It took almost one-and-a-half centuries

More information

PODIATRIC PATHOLOGY REPORT IS;RL;MMR; 1 of 1. A Copy was sent to: DR. JANE DOE 456 SAMPLE BLVD NEW YORK, NY DIAGNOSIS

PODIATRIC PATHOLOGY REPORT IS;RL;MMR; 1 of 1. A Copy was sent to: DR. JANE DOE 456 SAMPLE BLVD NEW YORK, NY DIAGNOSIS Batch#: 10388 Tel#: 1-888-CUPTH ccession: Obtained: Received: 12:02 pm PTIENT: JCK JONES 12548 MIN ST FLUSHING, NY 11365 (718) 555-2541 DOB: 01/02/19XX Specimen Final Report Date cct#: 1018 ge: 57 Sex:

More information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS

More information

Classification of Hematologic Malignancies. Patricia Aoun MD MPH

Classification of Hematologic Malignancies. Patricia Aoun MD MPH Classification of Hematologic Malignancies Patricia Aoun MD MPH Objectives Know the basic principles of the current classification system for hematopoietic and lymphoid malignancies Understand the differences

More information

Digital Pathology - moving on after implementation. Catarina Eloy, MD, PhD

Digital Pathology - moving on after implementation. Catarina Eloy, MD, PhD Digital Pathology - moving on after implementation Catarina Eloy, MD, PhD Catarina Eloy, MD, PhD No conflict of interests to declare Pathology challenges today Maintaining high quality students interested

More information

CAP Accreditation of Genetics Testing Laboratories

CAP Accreditation of Genetics Testing Laboratories CAP Accreditation of Genetics Testing Laboratories Secretary s Advisory Committee on Genetics, Health, And Society March 26, 2007 Gail Vance, MD, FCAP College of American Pathologists Overview Shared Goals

More information

From Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology. Songlin Zhang, MD, PhD LSUHSC-Shreveport

From Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology. Songlin Zhang, MD, PhD LSUHSC-Shreveport From Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology Songlin Zhang, MD, PhD LSUHSC-Shreveport I have no Conflict of Interest. FNA on Lymphoproliferative

More information

Personal details: Qualifications:

Personal details: Qualifications: CV Personal details: Full name: Doaa ShamsEl-Din Ahmed Ghorab. Age: 39 years. Date of birth: 10-12-1977 Nationality: Egyptian. Address: Nabil Helaly, flate 5,third floor, El Noha Tower, Ahmad Maher street,

More information

GOALS AND OBJECTIVES BREAST PATHOLOGY

GOALS AND OBJECTIVES BREAST PATHOLOGY GOALS AND OBJECTIVES BREAST PATHOLOGY LEVEL: PGY2, PGY3, PGY5 A number of these rotations are introductory in nature, as they are major subspecialties, and are followed by two more blocks in PGY-3, during

More information

ANATOMIC PATHOLOGY SAUDI BOARD PROGRAM. Saudi Board Promotion Exam of Pathology 2016

ANATOMIC PATHOLOGY SAUDI BOARD PROGRAM. Saudi Board Promotion Exam of Pathology 2016 ANATOMIC PATHOLOGY SAUDI BOARD PROGRAM Saudi Board Promotion Exam of Pathology 2016 Objectives: The general objective of the annual promotion assessment is to evaluate that the trainee has satisfactorily

More information

Course Title Form Hours subject

Course Title Form Hours subject Course Title Form Hours subject Types, and structure of chromosomes L 1 Histology Karyotyping and staining of human chromosomes L 2 Histology Chromosomal anomalies L 2 Histology Sex chromosomes L 1 Histology

More information

Chapter 4 Cellular Oncogenes ~ 4.6 -

Chapter 4 Cellular Oncogenes ~ 4.6 - Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of

More information

QUALITY CONTROL IN CYTOLOGY

QUALITY CONTROL IN CYTOLOGY 27 QUALITY CONTROL IN CYTOLOGY 27.1 INTRODUCTION Cytopathologists are concerned about and committed to quality assurance and quality control in their laboratories. These practices include, among others,

More information

Personalized Medicine: Lung Biopsy and Tumor

Personalized Medicine: Lung Biopsy and Tumor Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Elizabeth H. Moore, MD Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Genomic testing has resulted in a paradigm shift in the

More information

Guideline. Associated Documents ASCO CAP 2018 GUIDELINES and SUPPLEMENTS -

Guideline. Associated Documents ASCO CAP 2018 GUIDELINES and SUPPLEMENTS - Guideline Subject: ASCO CAP 2018 HER2 Testing for Breast Cancer Guidelines - Recommendations for Practice in Australasia Approval Date: December 2018 Review Date: December 2022 Review By: HER2 testing

More information

Observership Program Anatomical Pathology

Observership Program Anatomical Pathology Observership Program Anatomical Pathology Pathology is the study and diagnosis of diseases through examination of organs, tissues, cells and bodily fluids. Pathology is a unique medical specialty in that

More information

FNA Thyroid Cytology Structured Reporting Proforma

FNA Thyroid Cytology Structured Reporting Proforma FNA Thyroid Cytology Structured Reporting Proforma Mandatory questions (i.e. protocol standards) are in bold (e.g. S1.03). Family name Given name(s) Date of birth S1.02 Clinical details Male Female Intersex/indeterminate

More information

PATHOLOGY FELLOWSHIP PROGRAM IN LYMPHOPROLIFERATIVE DISORDERS

PATHOLOGY FELLOWSHIP PROGRAM IN LYMPHOPROLIFERATIVE DISORDERS PATHOLOGY FELLOWSHIP PROGRAM IN LYMPHOPROLIFERATIVE DISORDERS The Department of Pathology and Laboratory Medicine University of Alberta, Faculty of Medicine and Dentistry and Alberta Health Services PATHOLOGY

More information

Assessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray

Assessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray Assessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray Hui Chen, Aysegul A Sahin, Xinyan Lu, Lei Huo, Rajesh R Singh, Ronald Abraham, Shumaila Virani, Bal Mukund Mishra, Russell Broaddus,

More information

Barriers to Understanding

Barriers to Understanding Behind the Scenes: The Critical Importance of Cancer Cell Pathology and the Pathologist Sherry T. Emery, M.D., Chief of Pathology Northeast Health System Barriers to Understanding Questions for 2010 What

More information

Telepathology 2/17/2011. and The Future of Pathology (or Why did we change our Practice Model) University Health Network IMAGINE3: 3 IMAGINE 2!

Telepathology 2/17/2011. and The Future of Pathology (or Why did we change our Practice Model) University Health Network IMAGINE3: 3 IMAGINE 2! Telepathology and The Future of Pathology (or Why did we change our Practice Model) Jagdish Butany, MBBS, MS, FRCPC (a)why did we implement telepathology (WSI) at UHN? Consultant Cardiovascular Pathologist/Director

More information

scfish: A Primer Peter K. Rogan, Ph.D. Joan H. M. Knoll, Ph.D., FACMG, FCCMG Children s Mercy Hospitals and Clinics Tuesday, July 29, 2003

scfish: A Primer Peter K. Rogan, Ph.D. Joan H. M. Knoll, Ph.D., FACMG, FCCMG Children s Mercy Hospitals and Clinics Tuesday, July 29, 2003 scfish: A Primer Peter K. Rogan, Ph.D. Joan H. M. Knoll, Ph.D., FACMG, FCCMG Children s Mercy Hospitals and Clinics Tuesday, July 29, 2003 FISH: A Molecular Cytogenetic Test Complementary nucleic acid

More information

REGULATIONS FOR THE POSTGRADUATE DIPLOMA IN MOLECULAR AND DIAGNOSTIC PATHOLOGY (PDipMDPath)

REGULATIONS FOR THE POSTGRADUATE DIPLOMA IN MOLECULAR AND DIAGNOSTIC PATHOLOGY (PDipMDPath) REGULATIONS FOR THE POSTGRADUATE DIPLOMA IN MOLECULAR AND DIAGNOSTIC PATHOLOGY (PDipMDPath) (See also General Regulations and Regulations for Taught Postgraduate Curricula) M.129 Admission requirements

More information

Utility of Adequate Core Biopsy Samples from Ultrasound Biopsies Needed for Today s Breast Pathology

Utility of Adequate Core Biopsy Samples from Ultrasound Biopsies Needed for Today s Breast Pathology Utility of Adequate Core Biopsy Samples from Ultrasound Biopsies Needed for Today s Breast Pathology Ugur Ozerdem, M.D. 1 Abstract Background: There is a paradigm shift in breast biopsy philosophy. In

More information

ACCME/Disclosures. Diagnosing Mesothelioma in Limited Tissue Samples. Papanicolaou Society of Cytopathology Companion Meeting March 12 th, 2016

ACCME/Disclosures. Diagnosing Mesothelioma in Limited Tissue Samples. Papanicolaou Society of Cytopathology Companion Meeting March 12 th, 2016 Diagnosing Mesothelioma in Limited Tissue Samples Papanicolaou Society of Cytopathology Companion Meeting March 12 th, 2016 Sanja Dacic, MD, PhD University of Pittsburgh ACCME/Disclosures GENERAL RULES

More information

Reviewer's report. Version: 1 Date: 24 May Reviewer: Cathy Moelans. Reviewer's report:

Reviewer's report. Version: 1 Date: 24 May Reviewer: Cathy Moelans. Reviewer's report: Reviewer's report Title: Validation of HER2 testing with core needle biopsy specimens from primary breast cancers in terms of interobserver reproducibility and concordance with surgically resected specimens

More information

Template for Reporting Results of Biomarker Testing of Specimens From Patients With Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma

Template for Reporting Results of Biomarker Testing of Specimens From Patients With Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma Template for Reporting Results of Biomarker Testing of Specimens From Patients With Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma Version: CLLBiomarkers 1.0.0.2 Protocol Posting Date: June 2017

More information

PhenoPath. Diagnoses you can count on B CELL NON-HODGKIN LYMPHOMA

PhenoPath. Diagnoses you can count on B CELL NON-HODGKIN LYMPHOMA PhenoPath Diagnoses you can count on B CELL NON-HODGKIN LYMPHOMA C urrent diagnosis of B cell non-hodgkin lymphoma (B-NHL) is based on the 2008 WHO Classification of Tumours of Haematopoietic and Lymphoid

More information

The innovative aspects are that the test automatically generates a report on ALK status that any clinician can interpret.

The innovative aspects are that the test automatically generates a report on ALK status that any clinician can interpret. pat hways HTG EdgeSeq ALKPlus Assay EU for ALK status testing in non-small-cell lung cancer Medtech innovation briefing Published: 7 November 2017 nice.org.uk/guidance/mib128 Summary The technology described

More information

Template for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+)

Template for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+) Template for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+) Version: CMLBiomarkers 1.0.0.2 Protocol Posting Date: June 2017 This biomarker template is

More information

Chapter 2 Staging of Breast Cancer

Chapter 2 Staging of Breast Cancer Chapter 2 Staging of Breast Cancer Zeynep Ozsaran and Senem Demirci Alanyalı 2.1 Introduction Five decades ago, Denoix et al. proposed classification system (tumor node metastasis [TNM]) based on the dissemination

More information

UW Medicine Neuropathology

UW Medicine Neuropathology Neuropathology in Patient Care Surgical Neuropathology is that subspecialty of pathology that provides diagnoses on biopsies from the brain, spinal cord, skeletal muscle, peripheral nerve, and eye. In

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Fumagalli D, Venet D, Ignatiadis M, et al. RNA Sequencing to predict response to neoadjuvant anti-her2 therapy: a secondary analysis of the NeoALTTO randomized clinical trial.

More information

Updated Molecular Testing Guideline for the Selection of Lung Cancer Patients for Treatment with Targeted Tyrosine Kinase Inhibitors

Updated Molecular Testing Guideline for the Selection of Lung Cancer Patients for Treatment with Targeted Tyrosine Kinase Inhibitors Q: How is the strength of recommendation determined in the new molecular testing guideline? A: The strength of recommendation is determined by the strength of the available data (evidence). Strong Recommendation:

More information

Molecular Testing Updates. Karen Rasmussen, PhD, FACMG Clinical Molecular Genetics Spectrum Medical Group, Pathology Division Portland, Maine

Molecular Testing Updates. Karen Rasmussen, PhD, FACMG Clinical Molecular Genetics Spectrum Medical Group, Pathology Division Portland, Maine Molecular Testing Updates Karen Rasmussen, PhD, FACMG Clinical Molecular Genetics Spectrum Medical Group, Pathology Division Portland, Maine Keeping Up with Predictive Molecular Testing in Oncology: Technical

More information

Geisinger Clinic Annual Progress Report: 2011 Nonformula Grant

Geisinger Clinic Annual Progress Report: 2011 Nonformula Grant Geisinger Clinic Annual Progress Report: 2011 Nonformula Grant Reporting Period July 1, 2012 June 30, 2013 Nonformula Grant Overview The Geisinger Clinic received $1,000,000 in nonformula funds for the

More information

Quality ID #397: Melanoma Reporting National Quality Strategy Domain: Communication and Care Coordination

Quality ID #397: Melanoma Reporting National Quality Strategy Domain: Communication and Care Coordination Quality ID #397: Melanoma Reporting National Quality Strategy Domain: Communication and Care Coordination 2018 OPTIONS FOR INDIVIDUAL MEASURES: CLAIMS ONLY MEASURE TYPE: Outcome DESCRIPTION: Pathology

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 1 Molecular Basis of Cancer Molecular Oncology Keisha

More information

Explain the laboratory diagnosis of Rabies?

Explain the laboratory diagnosis of Rabies? Explain the laboratory diagnosis of Rabies? The standard test for rabies testing is dfa. This test has been thoroughly evaluated for more than 40 years, and is recognized as the most rapid and reliable

More information

Histopathology National Quality Improvement Programme Data Report 2015 Edition 3 created July 2016

Histopathology National Quality Improvement Programme Data Report 2015 Edition 3 created July 2016 Histopathology National Quality Improvement Programme Data Report 2015 Edition 3 created July 2016 Authors Histopathology National Quality Improvement Programme Working Group, RCPI Programme Team Contributors

More information

Anti-hTERT Antibody (SCD-A7)

Anti-hTERT Antibody (SCD-A7) Quality in Control Anti-hTERT Antibody (SCD-A7) htert_ab_pi_v1 Product Code: HCL025 Contents htert and Telomerase 2 Negative htert 3 Positive htert 4 Guidance and additional data 5 Case Study: RMH12-001

More information

CHAP10-CPTcodes _final doc Revision Date: 1/1/2016

CHAP10-CPTcodes _final doc Revision Date: 1/1/2016 CHAP10-CPTcodes80000-89999_final103115.doc Revision Date: 1/1/2016 CHAPTER X PATHOLOGY / LABORATORY SERVICES CPT CODES 80000-89999 FOR NATIONAL CORRECT CODING INITIATIVE POLICY MANUAL FOR MEDICARE SERVICES

More information

Pathology of Sarcoma ELEANOR CHEN, MD, PHD, ASSISTANT PROFESSOR DEPARTMENT OF PATHOLOGY UNIVERSITY OF WASHINGTON

Pathology of Sarcoma ELEANOR CHEN, MD, PHD, ASSISTANT PROFESSOR DEPARTMENT OF PATHOLOGY UNIVERSITY OF WASHINGTON Pathology of Sarcoma ELEANOR CHEN, MD, PHD, ASSISTANT PROFESSOR DEPARTMENT OF PATHOLOGY UNIVERSITY OF WASHINGTON Presentation outline Background and epidemiology of sarcomas Sarcoma classification Sarcoma

More information

Ritu Nayar, MD Professor and Vice Chair of Pathology Northwestern University, Feinberg School of Medicine Chicago, IL

Ritu Nayar, MD Professor and Vice Chair of Pathology Northwestern University, Feinberg School of Medicine Chicago, IL Ritu Nayar, MD Professor and Vice Chair of Pathology Northwestern University, Feinberg School of Medicine Chicago, IL email: r-nayar@northwestern.edu Nothing to disclose College of American Pathologists

More information

Cleveland Clinic Laboratories Hematology Diagnostic Services. Trust in us for everything you need in a reference lab.

Cleveland Clinic Laboratories Hematology Diagnostic Services. Trust in us for everything you need in a reference lab. Cleveland Clinic Laboratories Hematology Diagnostic Services Trust in us for everything you need in a reference lab. Our Mission The Pathology and Laboratory Medicine Institute contributes to excellent

More information

Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML

Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Imran Mirza, MD, MS, FRCPC Pathology & Laboratory Medicine Institute Sheikh Khalifa Medical City, Abu Dhabi, UAE. imirza@skmc.ae

More information

Methods used to diagnose lymphomas

Methods used to diagnose lymphomas Institut für Pathologie Institut für Pathologie Methods used to diagnose lymphomas Prof. Dr.Med. Leticia Quintanilla-Fend Molecular techniques NGS histology Cytology AS-PCR Sanger seq. MYC Immunohistochemistry

More information

LYMPH NODE: BIOPSY Guideline & Procedure: Lymph Node Biopsy

LYMPH NODE: BIOPSY Guideline & Procedure: Lymph Node Biopsy LYMPH NODE: BIOPSY Guideline & Procedure: Lymph Node Biopsy (Discuss with hematopathology attending for lymphoma work up case prior to proceed to gross at LBJ) 1. Measure the specimen (three dimensions).

More information

Subject Index. Dry desquamation, see Skin reactions, radiotherapy

Subject Index. Dry desquamation, see Skin reactions, radiotherapy Subject Index Actinic keratosis disseminated disease 42 surgical excision 42 AIDS, see Kaposi s sarcoma Amifostine, skin reaction prophylaxis 111 Basal cell carcinoma, superficial X-ray therapy Bowen s

More information

Digital Pathology and CAP Guidelines

Digital Pathology and CAP Guidelines Digital Pathology and CAP Guidelines Frequently asked questions The VENTANA family of digital pathology products empowers you with the convenience of a comprehensive image and workflow solution. When used

More information

Salivary Gland FNA ATYPICAL : Criteria and Controversies

Salivary Gland FNA ATYPICAL : Criteria and Controversies Salivary Gland FNA ATYPICAL : Criteria and Controversies W.C. Faquin, M.D., Ph.D. Director, Head and Neck Pathology Massachusetts General Hospital Massachusetts Eye and Ear Infirmary Harvard Medical School

More information

Integrated Diagnostic Approach to the Classification of Myeloid Neoplasms. Daniel A. Arber, MD Stanford University

Integrated Diagnostic Approach to the Classification of Myeloid Neoplasms. Daniel A. Arber, MD Stanford University Integrated Diagnostic Approach to the Classification of Myeloid Neoplasms Daniel A. Arber, MD Stanford University What is an integrated approach? What is an integrated approach? Incorporating all diagnostic

More information

Anatomic Molecular Pathology: An Emerging Field

Anatomic Molecular Pathology: An Emerging Field Anatomic Molecular Pathology: An Emerging Field Antonia R. Sepulveda M.D., Ph.D. University of Pennsylvania asepu@mail.med.upenn.edu 2008 ASIP Annual Meeting Anatomic pathology (U.S.) is a medical specialty

More information

Quantitative Image Analysis of HER2 Immunohistochemistry for Breast Cancer

Quantitative Image Analysis of HER2 Immunohistochemistry for Breast Cancer Quantitative Image Analysis of HER2 Immunohistochemistry for Breast Cancer Guideline from the College of American Pathologists Early Online Release Publication: Archives of Pathology & Laboratory Medicine

More information

Usefulness Of Touch Preparation Cytology In Postmortem Diagnosis: A Study From The University Hospital Of The West Indies

Usefulness Of Touch Preparation Cytology In Postmortem Diagnosis: A Study From The University Hospital Of The West Indies ISPUB.COM The Internet Journal of Pathology Volume 3 Number 2 Usefulness Of Touch Preparation Cytology In Postmortem Diagnosis: A Study From The University Hospital Of The West Indies S Shirley, C Escoffery

More information

Nuclear morphometric study of Non- Hodgkin's Lymphoma (NHL)

Nuclear morphometric study of Non- Hodgkin's Lymphoma (NHL) Original Research Article Nuclear morphometric study of Non- Hodgkin's Lymphoma (NHL) Sridhar Reddy Erugula 1, P. Sujatha 2, Ayesha Sameera 3, B. Suresh Reddy 4, Jesudass Govada 5, G. Sudhakar 6, Kandukuri

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Role of FISH in Hematological Cancers

Role of FISH in Hematological Cancers Role of FISH in Hematological Cancers Thomas S.K. Wan PhD,FRCPath,FFSc(RCPA) Honorary Professor, Department of Pathology & Clinical Biochemistry, Queen Mary Hospital, University of Hong Kong. e-mail: wantsk@hku.hk

More information

Single and Multiplex Immunohistochemistry

Single and Multiplex Immunohistochemistry Single and Multiplex Immunohistochemistry Steve Westra, BS Reagent Product Specialist Leica Biosystems IHC Theory Polyclonal vs Monoclonal Polyclonal reagents Detect a multitude of epitopes Batch to batch

More information