خداوند نام و خداوند جای خداوند روزی ده رهنمای
|
|
- Julius Quinn
- 5 years ago
- Views:
Transcription
1 به نام خداوند جان و خرد کزین برتر اندیشه برنگذرد خداوند نام و خداوند جای خداوند روزی ده رهنمای خداوند کیوان و گردان سپهر ز نام و نشان و گمان برترست به بینندگان آفریننده را نیابد بدو نیز اندیشه راه سخن هر چه زین گوهران بگذرد خرد گر سخن برگزیند همی ستودن نداند کس او را چو هست خرد را و جان را همی سنجد اوی بدین آلت رای و جان و زبان به هستیش باید که خستو شوی پرستنده باشی و جوینده راه توانا بود هر که دانا بود از این پرده برتر سخن گاه نیست فروزنده ماه و ناهید و مهر نگارنده بر شده پیکرست نبینی مرنجان دو بیننده را که او برتر از نام و از جایگاه نیابد بدو راه جان و خرد همان را گزیند که بیند همی میان بندگی را ببایدت بست در اندیشه سخته کی گنجد اوی ستود آفریننده را کی توان ز گفتاربی کار یکسو شوی به ژرفی به فرمانش کردن نگاه ز دانش دل پیر برنا بود ز هستی مر اندیشه را راه نیس
2 Pathology and clinic Pathology and clinic
3 Clinicians Are From Mars and Pathologists Are From Venus
4 just as medical language may be hard for lay people to understand, medical specialists may use language that is obscure to practitioners outside their specialty. Among specialists, the language of diagnostic anatomic pathologist is arguably furthest from daily medical discourse. There has been an implicit recognition of this fact in efforts to standardize pathology reporting. These efforts have lead to the adoption of the so-called Bethesda system for Papanicolaou smear reporting1 and similar attempts to standardize reports in other areas, including tumor resections, transplant biopsies, and liver biopsies. However, little explicit attention has been focused on the ability of clinicians to understand pathology reports, despite the role of reports in guiding treatment.
5
6
7 Pathology Department -Biopsy -Cytology Specimen -Autopsy -Necropsy
8 Quality control in the histopathology laboratory:
9 MEASURING QUALITY IN SURGICAL PATHOLOGY Elements of quality that are important in surgical pathology include report accuracy, timeliness, and report completeness price
10 This standard aims to have the total number of failures in quality, or customer satisfaction at 3.4 defects or fewer than 4 defects per products. By comparison, various studies have estimated surgical pathology error rates from as low as 0.25% (2500 per million) to as high as 40%.4 Most investigators, however, agree that a significant error rate in surgical pathology is in the range of 0.5% to 1%.
11 The concept of quality control in histopathology is relatively young and less well understood. Quality control is traditionally applicable to three phases of operation 1) the pre-analytical phase, 2) the analytical phase 3) the post-analytical phase There is a special focus on external quality assessment
12 The pre-analytical phase is related to sample collection, transport, accession and processing.
13 Various studies indicate that the majority of errors in the laboratory relate to the pre-analytical phase
14
15 Analytic phase The analytic phase of the test cycle begins with gross examination of the specimen and ends with diagnosis. All manipulations of the specimen subsequent to gross examinatio such as histological preparation and immunohistochemistry, that lead to a diagnosis are therefore components of the analytic phase of the test cycle. Most critical in this in a diagnosis, including gross dissection and section, embedding, histological sectioning, staining, special and immunohistochemical staining, possible other ancillary studies, and microscopic interpretation. The accuracy of the final diagnosis is a measure of the effectiveness of all of these sequential steps.
16 Analytic aspects The following general recommendations are being made at this stage. 1. For departments with more than one pathologist: -Intra-departmental consultation (review of selected cases by colleagues) -Comparison with other reports (frozen/cytology/histopathology) -Random case review (blinded re-reporting of random cases) By the same person (check for precision) By a different person (check for accuracy) -Intra- and inter-departmental conferences (clinico-pathological conference (CPC)/clinical rounds)
17 2. For laboratories run by single pathologist: reasonable quality may still be achieved by implementing the following: -Random blinded review of reported cases (precision check) -External consultations (may need to be done more often) -Review by experts -Participation in continued medical education (CME) programs
18
19 Post-analytic phase The post-analytic phase of the test cycle begins with dictation of the gross and microscopic examination and the final diagnosis and includes transcription, report correction, verification, and report delivery. Keys in the post-analytic phase are accurate transcription, complete reporting, and report delivery.
20
21
22 As stated above, TAT is a critical element of quality and usually covers all aspects of the laboratory test cycle. While TAT may be fragmented into smaller components, the total TAT is the only measure by which the clinician or customerwill judge the laboratory.
23
24 1.What might the pathology report say about the physical and chemical characteristics of the tissue? After identifying the tissue as cancerous, the pathologist may perform additional tests to get more information about the tumor that cannot be determined by looking at the tissue with routine stains, such as hematoxylin and eosin (also known as H&E), under a microscope (2). The pathology report will include the results of these tests. For example, the pathology report may include information obtained from immunochemical stains (IHC). IHC uses antibodies to identify specific antigens on the surface of cancer cells. IHC can often be used to: Determine where the cancer started Distinguish among different cancer types, such as carcinoma, melanoma, and lymphoma Help diagnose and classify leukemias and lymphomas (3) The pathology report may also include the results of flow cytometry. Flow cytometry is a method of measuring properties of cells in a sample, including the number of cells, percentage of live cells, cell size and shape, and presence of tumor markers on the cell surface. Tumor markers are substances produced by tumor cells or by other cells in the body in response to cancer or certain noncancerous conditions.) Flow cytometry can be used in the diagnosis, classification, and management of cancers such as acute leukemia, chronic lymphoproliferative disorders, and non-hodgkin lymphoma (2). Finally, the pathology report may include the results of molecular diagnostic and cytogenetic studies. Such studies investigate the presence or absence of malignant cells, and genetic or molecular abnormalities in specimens.
25 What information about the genetics of the cells might be included in the pathology report? report? Cytogenetics uses tissue culture and specialized techniques to provide genetic information about cells, particularly genetic alterations. Some genetic alterations are markers or indicators of a specific cancer. For example, the Philadelphia chromosome is associated with chronic myelogenous leukemia (CML). Some alterations can provide information about prognosis, which helps the doctor make treatment recommendations (3). Some tests that might be performed on a tissue sample include:
26 Fluorescence in situ hybridization (FISH): Determines the positions of particular genes. It can be used to identify chromosomal abnormalities and to map genes. Polymerase chain reaction (PCR): A method of making many copies of particular DNA sequences of relevance to the diagnosis. Real-time PCR or quantitative PCR: A method of measuring how many copies of a particular DNA sequence are present. Reverse-transcriptase polymerase chain reaction (RT-PCR): A method of making many copies of a specific RNA sequence. Southern blot hybridization: Detects specific DNA fragments. Western blot hybridization: Identifies and analyzes proteins or peptides.
27 Can individuals get a second opinion about their pathology results? Although most cancers can be easily diagnosed, sometimes patients or their doctors may want to get a second opinion about the pathology results (1). Patients interested in getting a second opinion should talk with their doctor. They will need to obtain the slides and/or paraffin block from the pathologist who examined the sample or from the hospital where the biopsy or surgery was done.
28 Policy for Rejection of Specimens
Quality assurance and quality control in pathology in breast disease centers
Quality assurance and quality control in pathology in breast disease centers Judith Sandbank M.D. Pathology Assaf-Harofeh Medical Center ISRAEL jsandbank@asaf.health.gov.il 1 st IBDC, 28 th January, 2011
More informationPathology Student Interest Group. Sponsored by the College of American Pathologists
Pathology Student Interest Group Sponsored by the College of American Pathologists Pathology Right Now, A Pathologist Somewhere Is. Evaluating Surgical Specimens Diagnosis and Staging of Cancer Adequacy
More informationINTRODUCTION TO PATHOLOGY
INTRODUCTION TO PATHOLOGY The literal translation of the word pathology is the study (logos) of suffering (pathos). It is a discipline that bridges clinical practice and basic sciences. Pathology is concerned
More informationContributions to Anatomic Pathology, over the years
Contributions to Anatomic Pathology, over the years Anatomic Pathology, part 1 G.B. Morgagni Xavier Bichat Rudolf Wirchow Anatomic Pathology, part 1 Anatomic pathology materials: morphological samples
More informationCancers of unknown primary : Knowing the unknown. Prof. Ahmed Hossain Professor of Medicine SSMC
Cancers of unknown primary : Knowing the unknown Prof. Ahmed Hossain Professor of Medicine SSMC Definition Cancers of unknown primary site (CUPs) Represent a heterogeneous group of metastatic tumours,
More informationNeoplasia 2018 lecture 11. Dr H Awad FRCPath
Neoplasia 2018 lecture 11 Dr H Awad FRCPath Clinical aspects of neoplasia Tumors affect patients by: 1. their location 2. hormonal secretions 3. paraneoplastic syndromes 4. cachexia Tumor location Even
More informationANATOMICAL PATHOLOGY TARIFF
ANATOMICAL PATHOLOGY TARIFF A GUIDE TO UTILISATION. The following guidelines have been agreed by consensus of Anatomical Pathologists who are members of the Anatomical Pathologist s Group, or the National
More informationDiagnostic Detectives: Medical Laboratory Professionals A Closer Look at Careers in Histology
Diagnostic Detectives: Medical Laboratory Professionals A Closer Look at Careers in Histology When your doctor orders lab tests do you know.. Who prepares, embeds, cuts, and stains tissue samples and biopsies
More informationQuality Indicators - Anatomic Pathology- HSC/STC Jul-Sep 2 nd Qtr. Apr-Jun 1 st Qtr
Eastern Health Volume 86 Page 001 CIHRT Exhibit P-3595 Page 1 INDICATOR Financial Overtime Hours / FTE Workload Increase - FTE equivalent Workload Quality Indicators - Anatomic Pathology- HSC/STC TOTAL
More informationPD-L1 Analyte Control DR
Quality in Control PD-L1 Analyte Control DR PD-L1_PI_v2 Product Codes: HCL019, HCL020 and HCL021 Contents PD-L1 Analyte Control DR 2 What is PD-L1? 3 The Role of PD-L1 in Cancer 3 PD-L1 Assessment 4 PD-L1
More informationGastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid
More informationHematopathology Case Study
www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated
More informationApplying Risk Management Principles to QA in Surgical Pathology: From Principles to Practice
Applying Risk Management Principles to QA in Surgical Pathology: From Principles to Practice Dr. Gregory Flynn CEO, Institute for Quality Management in Healthcare Managing Director, Quality Management
More informationOctober Billing and compliance. Coagulation. Immunohistochemistry. Immunology. Referral testing ICD 10
October 2015 Billing and compliance ICD 10 Coagulation Processing, transport and stability changes for multiple coagulation tests Immunohistochemistry IHC stain updates Immunology Lyme Western Blot testing
More informationApplications of IHC. Determination of the primary site in metastatic tumors of unknown origin
Applications of IHC Determination of the primary site in metastatic tumors of unknown origin Classification of tumors that appear 'undifferentiated' by standard light microscopy Precise classification
More informationStudy Finds Lung Cancer Subtype Test from UNC, Startup GeneCentric to be Accurate, Reproducible
Study Finds Lung Cancer Subtype Test from UNC, Startup GeneCentric to be Accurate, Reproducible May 30, 2013 By Ben Butkus A team led by clinical researchers from the University of North Carolina, Chapel
More informationVDx: Unlocking Complex Diagnostics
VDx: Unlocking Complex Diagnostics VDx now offers PARR testing in-house on formalin-fixed tissue Complicated Case? Is this cat s chronic lymphocytic enteritis really chronic IBD or is this early small
More informationACMG/CAP Cytogenetics CY
www.cap.org Cytogenetics Analytes/procedures in bold type are regulated for proficiency testing by the Centers for Medicare & Medicaid Services ACMG/CAP Cytogenetics CY Analyte CY Challenges per Shipment
More informationNPQR Quality Payment Program (QPP) Measures 21_18247_LS.
NPQR Quality Payment Program (QPP) Measures 21_18247_LS MEASURE ID: QPP 99 MEASURE TITLE: Breast Cancer Resection Pathology Reporting pt Category (Primary Tumor) and pn Category (Regional Lymph Nodes)
More informationCost-Effective Strategies in the Workup of Hematologic Neoplasm. Karl S. Theil, Claudiu V. Cotta Cleveland Clinic
Cost-Effective Strategies in the Workup of Hematologic Neoplasm Karl S. Theil, Claudiu V. Cotta Cleveland Clinic In the past 12 months, we have not had a significant financial interest or other relationship
More informationCorporate Medical Policy
Corporate Medical Policy Microarray-based Gene Expression Testing for Cancers of Unknown File Name: Origination: Last CAP Review: Next CAP Review: Last Review: microarray-based_gene_expression_testing_for_cancers_of_unknown_primary
More informationObjectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013
Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie
More informationGuidelines for Specimen Submission to Pathology Laboratory
به نام خدا Guidelines for Specimen Submission to Pathology Laboratory Pre-analytic phase 1. Specimen identification 2. Adequacy of clinical history 3. Specimen fixation 4. Specimen delivery 5. Accessioning
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationCleveland Clinic Laboratories. Anatomic Pathology
Cleveland Clinic Laboratories Anatomic Pathology OUR MISSION Cleveland Clinic Laboratories contributes to excellent patient care by providing high-quality, comprehensive laboratory testing and patient-focused
More informationPatterns of lymph node biopsy pathology at. Chris Hani Baragwanath Academic Hospital. over a period of three years Denasha Lavanya Reddy
Patterns of lymph node biopsy pathology at Chris Hani Baragwanath Academic Hospital over a period of three years 2010-2012 Denasha Lavanya Reddy Student number: 742452 A research report submitted to the
More informationGYNECOLOGICAL PATHOLOGY FELLOWSHIP PROGRAM
GYNECOLOGICAL PATHOLOGY FELLOWSHIP PROGRAM The Department of Pathology and Laboratory Medicine University of Calgary, Faculty of Medicine Calgary Health Region and Calgary Laboratory Services Calgary,
More informationEvolution of Pathology
1 Traditional pathology Molecular pathology 2 Evolution of Pathology Gross Pathology Cellular Pathology Morphologic Pathology Molecular/Predictive Pathology Antonio Benivieni (1443-1502): First autopsy
More informationMyelodysplasia/Myeloproliferative Neoplasms (MDS/MPN) Post-HCT Data
Instructions for Myelodysplasia/Myeloproliferative Neoplasms (MDS/MPN) Post-HCT Data (Form 2114) This section of the CIBMTR Forms Instruction Manual is intended to be a resource for completing the Myelodysplasia/Myeloproliferative
More informationGastrointestinal PATHOLOGY FELLOWSHIP
Gastrointestinal PATHOLOGY FELLOWSHIP The Department of Pathology and Laboratory Medicine University of Calgary Calgary, Alberta Description and Objectives Prepared: November 21, 2016 Revised: August 21,
More informationHistotechnological problems in dermatopathology and their possible consequences
Histotechnological problems in dermatopathology and their possible consequences Zsolt B. Argenyi, M.D. Professor of Pathology & Dermatology Director of Dermatopathology University of Washington, Seattle,
More informationQuality Assurance and Quality Control in the Pathology Dept.
Quality Assurance and Quality Control in the Pathology Dept. Judith Sandbank M.D. Pathology Assaf-Harofeh Medical Center ISRAEL jsandbank@asaf.health.gov.il 2 nd IBDC, 9 th February, 2012 Pathology as
More informationDIRECTED WORKPLACE-BASED ASSESSMENTS BY STAGES OF TRAINING AND OPTIONAL PACKAGES
DIRECTED WORKPLACE-BASED ASSESSMENTS BY STAGES OF TRAINING AND OPTIONAL PACKAGES The following are lists of workplace-based assessments, from which should be selected appropriate examples to make up the
More informationUW Medicine Neuropathology
Neuropathology in Patient Care Surgical Neuropathology is that subspecialty of pathology that provides diagnoses on biopsies from the brain, spinal cord, skeletal muscle, peripheral nerve, and eye. In
More informationCentral Pathology Review and Tissue MicroArrays. Dr Lisa Storer Children s Brain Tumour Research Centre Nottingham
Central Pathology Review and Tissue MicroArrays Dr Lisa Storer Children s Brain Tumour Research Centre Nottingham What is a tissue microarray? Tissue microarrays (TMAs) consist of paraffin blocks in which
More informationPositioning the Laboratory to Integrate Clinical Care:
William G. Morice, M.D., Ph.D. Chair, Division of Hematopathology Mayo Clinic, Rochester, MN Positioning the Laboratory to Integrate Clinical Care: New Approaches to Interactive Test Ordering and Reporting
More information1. Q: What has changed from the draft recommendations posted for public comment in November/December 2011?
Frequently Asked Questions (FAQs) in regard to Molecular Testing Guideline for Selection of Lung Cancer Patients for EGFR and ALK Tyrosine Kinase Inhibitors 1. Q: What has changed from the draft recommendations
More informationThe Pathology of Neoplasia Part II
The Pathology of Neoplasia Part II February 2018 PAUL BOGNER, MD A S S O C I A T E P R O F E S S O R O F O N C O L O G Y P A T H O L O G Y A N D D E R M A T O L O G Y Clinical goals of cancer pathology
More information1.5. Research Areas Treatment Selection
1.5. Research Areas Cancer biomarker research embraces many areas of study, including tumorigenesis, metastasis, clinical trial and surrogate endpoints, cell isolation, target identification, drug resistance,
More informationAddendum report coding for the National Quality Improvement Programme in Histopathology: a multi-institutional audit
Addendum report coding for the National Quality Improvement Programme in Histopathology: a multi-institutional audit S. Mahon 1,3, D. Catargiu 2, S. Phelan 2, S. Crowther 3, N. Swan 1. St. Vincent s University
More informationSkin biopsy. Sophia Otto SA Pathology
Skin biopsy Sophia Otto SA Pathology RCPA (Royal College of Pathologists of Australasia) The RCPA is the leading organisation representing pathologists in Australasia. Its mission is to train and support
More informationChapter 8. Summary. Chapter 8. Summary
Chapter 8 Chapter 8 Summary Summary Summary In CHAPTER 1 an introduction to several aspects of cervical cancer, HPV and their relation with immunology is given. It took almost one-and-a-half centuries
More informationPODIATRIC PATHOLOGY REPORT IS;RL;MMR; 1 of 1. A Copy was sent to: DR. JANE DOE 456 SAMPLE BLVD NEW YORK, NY DIAGNOSIS
Batch#: 10388 Tel#: 1-888-CUPTH ccession: Obtained: Received: 12:02 pm PTIENT: JCK JONES 12548 MIN ST FLUSHING, NY 11365 (718) 555-2541 DOB: 01/02/19XX Specimen Final Report Date cct#: 1018 ge: 57 Sex:
More informationADx Bone Marrow Report. Patient Information Referring Physician Specimen Information
ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS
More informationClassification of Hematologic Malignancies. Patricia Aoun MD MPH
Classification of Hematologic Malignancies Patricia Aoun MD MPH Objectives Know the basic principles of the current classification system for hematopoietic and lymphoid malignancies Understand the differences
More informationDigital Pathology - moving on after implementation. Catarina Eloy, MD, PhD
Digital Pathology - moving on after implementation Catarina Eloy, MD, PhD Catarina Eloy, MD, PhD No conflict of interests to declare Pathology challenges today Maintaining high quality students interested
More informationCAP Accreditation of Genetics Testing Laboratories
CAP Accreditation of Genetics Testing Laboratories Secretary s Advisory Committee on Genetics, Health, And Society March 26, 2007 Gail Vance, MD, FCAP College of American Pathologists Overview Shared Goals
More informationFrom Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology. Songlin Zhang, MD, PhD LSUHSC-Shreveport
From Morphology to Molecular Pathology: A Practical Approach for Cytopathologists Part 1-Cytomorphology Songlin Zhang, MD, PhD LSUHSC-Shreveport I have no Conflict of Interest. FNA on Lymphoproliferative
More informationPersonal details: Qualifications:
CV Personal details: Full name: Doaa ShamsEl-Din Ahmed Ghorab. Age: 39 years. Date of birth: 10-12-1977 Nationality: Egyptian. Address: Nabil Helaly, flate 5,third floor, El Noha Tower, Ahmad Maher street,
More informationGOALS AND OBJECTIVES BREAST PATHOLOGY
GOALS AND OBJECTIVES BREAST PATHOLOGY LEVEL: PGY2, PGY3, PGY5 A number of these rotations are introductory in nature, as they are major subspecialties, and are followed by two more blocks in PGY-3, during
More informationANATOMIC PATHOLOGY SAUDI BOARD PROGRAM. Saudi Board Promotion Exam of Pathology 2016
ANATOMIC PATHOLOGY SAUDI BOARD PROGRAM Saudi Board Promotion Exam of Pathology 2016 Objectives: The general objective of the annual promotion assessment is to evaluate that the trainee has satisfactorily
More informationCourse Title Form Hours subject
Course Title Form Hours subject Types, and structure of chromosomes L 1 Histology Karyotyping and staining of human chromosomes L 2 Histology Chromosomal anomalies L 2 Histology Sex chromosomes L 1 Histology
More informationChapter 4 Cellular Oncogenes ~ 4.6 -
Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of
More informationQUALITY CONTROL IN CYTOLOGY
27 QUALITY CONTROL IN CYTOLOGY 27.1 INTRODUCTION Cytopathologists are concerned about and committed to quality assurance and quality control in their laboratories. These practices include, among others,
More informationPersonalized Medicine: Lung Biopsy and Tumor
Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Elizabeth H. Moore, MD Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Genomic testing has resulted in a paradigm shift in the
More informationGuideline. Associated Documents ASCO CAP 2018 GUIDELINES and SUPPLEMENTS -
Guideline Subject: ASCO CAP 2018 HER2 Testing for Breast Cancer Guidelines - Recommendations for Practice in Australasia Approval Date: December 2018 Review Date: December 2022 Review By: HER2 testing
More informationObservership Program Anatomical Pathology
Observership Program Anatomical Pathology Pathology is the study and diagnosis of diseases through examination of organs, tissues, cells and bodily fluids. Pathology is a unique medical specialty in that
More informationFNA Thyroid Cytology Structured Reporting Proforma
FNA Thyroid Cytology Structured Reporting Proforma Mandatory questions (i.e. protocol standards) are in bold (e.g. S1.03). Family name Given name(s) Date of birth S1.02 Clinical details Male Female Intersex/indeterminate
More informationPATHOLOGY FELLOWSHIP PROGRAM IN LYMPHOPROLIFERATIVE DISORDERS
PATHOLOGY FELLOWSHIP PROGRAM IN LYMPHOPROLIFERATIVE DISORDERS The Department of Pathology and Laboratory Medicine University of Alberta, Faculty of Medicine and Dentistry and Alberta Health Services PATHOLOGY
More informationAssessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray
Assessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray Hui Chen, Aysegul A Sahin, Xinyan Lu, Lei Huo, Rajesh R Singh, Ronald Abraham, Shumaila Virani, Bal Mukund Mishra, Russell Broaddus,
More informationBarriers to Understanding
Behind the Scenes: The Critical Importance of Cancer Cell Pathology and the Pathologist Sherry T. Emery, M.D., Chief of Pathology Northeast Health System Barriers to Understanding Questions for 2010 What
More informationTelepathology 2/17/2011. and The Future of Pathology (or Why did we change our Practice Model) University Health Network IMAGINE3: 3 IMAGINE 2!
Telepathology and The Future of Pathology (or Why did we change our Practice Model) Jagdish Butany, MBBS, MS, FRCPC (a)why did we implement telepathology (WSI) at UHN? Consultant Cardiovascular Pathologist/Director
More informationscfish: A Primer Peter K. Rogan, Ph.D. Joan H. M. Knoll, Ph.D., FACMG, FCCMG Children s Mercy Hospitals and Clinics Tuesday, July 29, 2003
scfish: A Primer Peter K. Rogan, Ph.D. Joan H. M. Knoll, Ph.D., FACMG, FCCMG Children s Mercy Hospitals and Clinics Tuesday, July 29, 2003 FISH: A Molecular Cytogenetic Test Complementary nucleic acid
More informationREGULATIONS FOR THE POSTGRADUATE DIPLOMA IN MOLECULAR AND DIAGNOSTIC PATHOLOGY (PDipMDPath)
REGULATIONS FOR THE POSTGRADUATE DIPLOMA IN MOLECULAR AND DIAGNOSTIC PATHOLOGY (PDipMDPath) (See also General Regulations and Regulations for Taught Postgraduate Curricula) M.129 Admission requirements
More informationUtility of Adequate Core Biopsy Samples from Ultrasound Biopsies Needed for Today s Breast Pathology
Utility of Adequate Core Biopsy Samples from Ultrasound Biopsies Needed for Today s Breast Pathology Ugur Ozerdem, M.D. 1 Abstract Background: There is a paradigm shift in breast biopsy philosophy. In
More informationACCME/Disclosures. Diagnosing Mesothelioma in Limited Tissue Samples. Papanicolaou Society of Cytopathology Companion Meeting March 12 th, 2016
Diagnosing Mesothelioma in Limited Tissue Samples Papanicolaou Society of Cytopathology Companion Meeting March 12 th, 2016 Sanja Dacic, MD, PhD University of Pittsburgh ACCME/Disclosures GENERAL RULES
More informationReviewer's report. Version: 1 Date: 24 May Reviewer: Cathy Moelans. Reviewer's report:
Reviewer's report Title: Validation of HER2 testing with core needle biopsy specimens from primary breast cancers in terms of interobserver reproducibility and concordance with surgically resected specimens
More informationTemplate for Reporting Results of Biomarker Testing of Specimens From Patients With Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma
Template for Reporting Results of Biomarker Testing of Specimens From Patients With Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma Version: CLLBiomarkers 1.0.0.2 Protocol Posting Date: June 2017
More informationPhenoPath. Diagnoses you can count on B CELL NON-HODGKIN LYMPHOMA
PhenoPath Diagnoses you can count on B CELL NON-HODGKIN LYMPHOMA C urrent diagnosis of B cell non-hodgkin lymphoma (B-NHL) is based on the 2008 WHO Classification of Tumours of Haematopoietic and Lymphoid
More informationThe innovative aspects are that the test automatically generates a report on ALK status that any clinician can interpret.
pat hways HTG EdgeSeq ALKPlus Assay EU for ALK status testing in non-small-cell lung cancer Medtech innovation briefing Published: 7 November 2017 nice.org.uk/guidance/mib128 Summary The technology described
More informationTemplate for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+)
Template for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+) Version: CMLBiomarkers 1.0.0.2 Protocol Posting Date: June 2017 This biomarker template is
More informationChapter 2 Staging of Breast Cancer
Chapter 2 Staging of Breast Cancer Zeynep Ozsaran and Senem Demirci Alanyalı 2.1 Introduction Five decades ago, Denoix et al. proposed classification system (tumor node metastasis [TNM]) based on the dissemination
More informationUW Medicine Neuropathology
Neuropathology in Patient Care Surgical Neuropathology is that subspecialty of pathology that provides diagnoses on biopsies from the brain, spinal cord, skeletal muscle, peripheral nerve, and eye. In
More informationSupplementary Online Content
Supplementary Online Content Fumagalli D, Venet D, Ignatiadis M, et al. RNA Sequencing to predict response to neoadjuvant anti-her2 therapy: a secondary analysis of the NeoALTTO randomized clinical trial.
More informationUpdated Molecular Testing Guideline for the Selection of Lung Cancer Patients for Treatment with Targeted Tyrosine Kinase Inhibitors
Q: How is the strength of recommendation determined in the new molecular testing guideline? A: The strength of recommendation is determined by the strength of the available data (evidence). Strong Recommendation:
More informationMolecular Testing Updates. Karen Rasmussen, PhD, FACMG Clinical Molecular Genetics Spectrum Medical Group, Pathology Division Portland, Maine
Molecular Testing Updates Karen Rasmussen, PhD, FACMG Clinical Molecular Genetics Spectrum Medical Group, Pathology Division Portland, Maine Keeping Up with Predictive Molecular Testing in Oncology: Technical
More informationGeisinger Clinic Annual Progress Report: 2011 Nonformula Grant
Geisinger Clinic Annual Progress Report: 2011 Nonformula Grant Reporting Period July 1, 2012 June 30, 2013 Nonformula Grant Overview The Geisinger Clinic received $1,000,000 in nonformula funds for the
More informationQuality ID #397: Melanoma Reporting National Quality Strategy Domain: Communication and Care Coordination
Quality ID #397: Melanoma Reporting National Quality Strategy Domain: Communication and Care Coordination 2018 OPTIONS FOR INDIVIDUAL MEASURES: CLAIMS ONLY MEASURE TYPE: Outcome DESCRIPTION: Pathology
More informationAmerican Society of Cytopathology Core Curriculum in Molecular Biology
American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 1 Molecular Basis of Cancer Molecular Oncology Keisha
More informationExplain the laboratory diagnosis of Rabies?
Explain the laboratory diagnosis of Rabies? The standard test for rabies testing is dfa. This test has been thoroughly evaluated for more than 40 years, and is recognized as the most rapid and reliable
More informationHistopathology National Quality Improvement Programme Data Report 2015 Edition 3 created July 2016
Histopathology National Quality Improvement Programme Data Report 2015 Edition 3 created July 2016 Authors Histopathology National Quality Improvement Programme Working Group, RCPI Programme Team Contributors
More informationAnti-hTERT Antibody (SCD-A7)
Quality in Control Anti-hTERT Antibody (SCD-A7) htert_ab_pi_v1 Product Code: HCL025 Contents htert and Telomerase 2 Negative htert 3 Positive htert 4 Guidance and additional data 5 Case Study: RMH12-001
More informationCHAP10-CPTcodes _final doc Revision Date: 1/1/2016
CHAP10-CPTcodes80000-89999_final103115.doc Revision Date: 1/1/2016 CHAPTER X PATHOLOGY / LABORATORY SERVICES CPT CODES 80000-89999 FOR NATIONAL CORRECT CODING INITIATIVE POLICY MANUAL FOR MEDICARE SERVICES
More informationPathology of Sarcoma ELEANOR CHEN, MD, PHD, ASSISTANT PROFESSOR DEPARTMENT OF PATHOLOGY UNIVERSITY OF WASHINGTON
Pathology of Sarcoma ELEANOR CHEN, MD, PHD, ASSISTANT PROFESSOR DEPARTMENT OF PATHOLOGY UNIVERSITY OF WASHINGTON Presentation outline Background and epidemiology of sarcomas Sarcoma classification Sarcoma
More informationRitu Nayar, MD Professor and Vice Chair of Pathology Northwestern University, Feinberg School of Medicine Chicago, IL
Ritu Nayar, MD Professor and Vice Chair of Pathology Northwestern University, Feinberg School of Medicine Chicago, IL email: r-nayar@northwestern.edu Nothing to disclose College of American Pathologists
More informationCleveland Clinic Laboratories Hematology Diagnostic Services. Trust in us for everything you need in a reference lab.
Cleveland Clinic Laboratories Hematology Diagnostic Services Trust in us for everything you need in a reference lab. Our Mission The Pathology and Laboratory Medicine Institute contributes to excellent
More informationMolecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML
Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Imran Mirza, MD, MS, FRCPC Pathology & Laboratory Medicine Institute Sheikh Khalifa Medical City, Abu Dhabi, UAE. imirza@skmc.ae
More informationMethods used to diagnose lymphomas
Institut für Pathologie Institut für Pathologie Methods used to diagnose lymphomas Prof. Dr.Med. Leticia Quintanilla-Fend Molecular techniques NGS histology Cytology AS-PCR Sanger seq. MYC Immunohistochemistry
More informationLYMPH NODE: BIOPSY Guideline & Procedure: Lymph Node Biopsy
LYMPH NODE: BIOPSY Guideline & Procedure: Lymph Node Biopsy (Discuss with hematopathology attending for lymphoma work up case prior to proceed to gross at LBJ) 1. Measure the specimen (three dimensions).
More informationSubject Index. Dry desquamation, see Skin reactions, radiotherapy
Subject Index Actinic keratosis disseminated disease 42 surgical excision 42 AIDS, see Kaposi s sarcoma Amifostine, skin reaction prophylaxis 111 Basal cell carcinoma, superficial X-ray therapy Bowen s
More informationDigital Pathology and CAP Guidelines
Digital Pathology and CAP Guidelines Frequently asked questions The VENTANA family of digital pathology products empowers you with the convenience of a comprehensive image and workflow solution. When used
More informationSalivary Gland FNA ATYPICAL : Criteria and Controversies
Salivary Gland FNA ATYPICAL : Criteria and Controversies W.C. Faquin, M.D., Ph.D. Director, Head and Neck Pathology Massachusetts General Hospital Massachusetts Eye and Ear Infirmary Harvard Medical School
More informationIntegrated Diagnostic Approach to the Classification of Myeloid Neoplasms. Daniel A. Arber, MD Stanford University
Integrated Diagnostic Approach to the Classification of Myeloid Neoplasms Daniel A. Arber, MD Stanford University What is an integrated approach? What is an integrated approach? Incorporating all diagnostic
More informationAnatomic Molecular Pathology: An Emerging Field
Anatomic Molecular Pathology: An Emerging Field Antonia R. Sepulveda M.D., Ph.D. University of Pennsylvania asepu@mail.med.upenn.edu 2008 ASIP Annual Meeting Anatomic pathology (U.S.) is a medical specialty
More informationQuantitative Image Analysis of HER2 Immunohistochemistry for Breast Cancer
Quantitative Image Analysis of HER2 Immunohistochemistry for Breast Cancer Guideline from the College of American Pathologists Early Online Release Publication: Archives of Pathology & Laboratory Medicine
More informationUsefulness Of Touch Preparation Cytology In Postmortem Diagnosis: A Study From The University Hospital Of The West Indies
ISPUB.COM The Internet Journal of Pathology Volume 3 Number 2 Usefulness Of Touch Preparation Cytology In Postmortem Diagnosis: A Study From The University Hospital Of The West Indies S Shirley, C Escoffery
More informationNuclear morphometric study of Non- Hodgkin's Lymphoma (NHL)
Original Research Article Nuclear morphometric study of Non- Hodgkin's Lymphoma (NHL) Sridhar Reddy Erugula 1, P. Sujatha 2, Ayesha Sameera 3, B. Suresh Reddy 4, Jesudass Govada 5, G. Sudhakar 6, Kandukuri
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationRole of FISH in Hematological Cancers
Role of FISH in Hematological Cancers Thomas S.K. Wan PhD,FRCPath,FFSc(RCPA) Honorary Professor, Department of Pathology & Clinical Biochemistry, Queen Mary Hospital, University of Hong Kong. e-mail: wantsk@hku.hk
More informationSingle and Multiplex Immunohistochemistry
Single and Multiplex Immunohistochemistry Steve Westra, BS Reagent Product Specialist Leica Biosystems IHC Theory Polyclonal vs Monoclonal Polyclonal reagents Detect a multitude of epitopes Batch to batch
More information