Rational combinations with immunotherapeutics

Transcription

1 Rational combinations with immunotherapeutics Ronald Levy, MD Robert K. and Helen K. Summy Professor of Medicine Director, Lymphoma Program Stanford University School of Medicine Associate Director, Translational Science Stanford Cancer Institute Stanford, California

2 Disclosure Information ASH 2016 Ronald Levy, MD I have the following financial relationships to disclose: Consultant for: BeiGene, Corvus Pharmaceuticals, Five Prime Therapeutics, Inc., Immune Design, Innate Pharma S.A., Kite Pharma Grant/Research support from: Bristol-Myers Squibb Company, Dynavax Technologies Corporation, Pfizer Inc., Pharmacyclics LLC Stockholder in: Merck & Co., Inc. I will discuss the following off label use and/or investigational use in my presentation: Combinations of Immunotherapy and Targeted Therapies

3 Immunotherapy of Lymphoma 2016 Target the Tumor Engineered Antibodies Antibody-Drug Conjugates Bispecific Antibodies CAR T Cells Target the Host Enhance ADCC Immune Checkpoint Blockade

4 Monoclonal Antibody Treatment Anti-idiotype antibody Tumor idiotype Rituxan CD20 Lymphoma B cell

5

6

7 [TITLE]

8 Anti-Tumor Activity of Ibrutinib in Combination With a-pd-l1 mab N H 2 N N Ibrutinib O N N N a-pd-l1 O CH 2 ITK T- Cell Tumor

9 Ibrutinib and Anti PD-L1 are Synergistic B Cell Lymphoma Colon Cancer Tumor Volume (mm) Days after inoculation Non treated mice Ibrutinib alone a-pd-l1 alone Ibrutinib and a-pd-l1 Tumor Volume (mm) Days after inoculation Non treated Ibrutinib alone a-pd-l1 alone Ibrutinb and a-pd-l1 Percent survival 100 Non treated mice Ibrutinib alone a-pd-l1 alone Ibrutinib and a-pd-l1 50 Percent survival Non treated Ibrutinib alone a-pd-l1 alone Ibrutinb and a-pd-l Days after inoculation Days after inoculation Sagiv-Barfi et al. Proc Natl Acad Sci USA. 2015;112(9):E

10 Other Targets of Ibrutinib Flt2 Yes Lyn Lck Itk Tec Blk Btk EGFR HER2 HER4 Jak3 Bmx Csk

11 Clinical Trials of BTK Inhibitors Plus PD1 Blockade Ibrutinib in Combination with MEDI4736 in Subjects With Relapsed/Refractory Lymphomas NCT Sponsor: Pharmacyclics Safety, Pharmacokinetics, Pharmacodynamics and Preliminary Efficacy of Ibrutinib With Nivolumab In Hematologic Malignancies NCT Sponsor: Jansen ACP-196 in Combination With Pembrolizumab for Hematologic Malignancies NCT Sponsor: Acerta Ibrutinib in Combination with MEDI4736 In Relapsed or Refractory Solid Tumors NCT Sponsor: Pharmacyclics Pembrolizumab Alone and in Combination with ACP-196 In Non-Small Cell Lung Cancer NCT Sponsor: Acerta Combination of ACP-196 and Pembrolizumab In Head and Neck Squamous Cell Carcinoma NCT Sponsor: Acerta

12 In Situ Therapeutic Vaccination Inject Local Treat Global

13 CpG Bacterial DNA ACGTTGAGTTCGTACGCATACGA Vertebrate DNA AGCTTGAGTC m CGGATGGGTAAGA Immune system recognizes CpG through TLR-9 and activates DC and B cells CpG TLR-9 B Cell Tumor Tumor-specific T Cells TLR-9 Dendritic Cell

14 CpG Works Only When Injected Directly Into the Tumor Li et al. J Immunol. 2007;179(4):

15 In-Situ Vaccination With CpG Therapeutic Design Radiation Low Dose (2gx2)? Tumor Regression? T Cell Immune Response CpG Brody et al. J Clin Oncol. 2010;28(28):

16 38-yo Male With Recurrent FL 24 Pre-treatment 12 weeks weeks Complete Response

17 Intra-Tumoral CpG (Pfizer 7909) Vaccination Induces Objective Clinical Responses Brody et al. J Clin Oncol. 2010;28(28):

18 Two-Tumor Model No Treatment CpG alone CpG + effective Ab Houot, Levy. Blood. 2009;113(15):

19 In Situ Vaccination Summary Combinations Ligand Targets Antibody Targets Tumors TLR9 OX40 Lymphoma TLR 7/8 GITR Melanoma TLR 4 PD-1* Colon Sting PD-1L* Breast BTK* CD40 Spontaneous Breast CTLA4* CD37 (41BB)

20 Inject the Antibodies Directly Into the Tumor Low Dose Avoids Toxicity Anti-CTLA4 Anti-OX40 CpG? Growth of Uninjected Tumor Marabelle et al. J Clin Invest. 2013;123(6):

21 No Treatment CpG+aOx40+aCTLA4 D1 (D8 post tumor inoculation) D4 D7 Marabelle et al. J Clin Invest. 2013;123(6):

22 Intratumoral Tregs Express CTLA4 and OX40 CpG Anti-CTLA4 Anti-OX40 Treg

23 Current Clinical Trial Design Study Timeline: Day Day -1 FNA - 1 XRT CpG + Day 8 FNA 1 8 XRT CpG CpG Or Ibrutinib Or Anti-OX40 Day 36 FNA (optional) CpG CpG CpG Response evaluation per CT scans

24 Visualization of Cell Populations in Patient 001 Using visne: Panel 1 Normal PBMC Treated Site Distal Site tsne2 tsne2 tsne2 tsne1 tsne1 tsne1

25 visne Uncovers Heterogeneity Within B Cells of Patient 001: Panel 1 Normal PBMC Treated Site Distal Site CD19+ B cells Class II on B cells tsne2 tsne1

26 Immunotherapy Comes of Age Specific Therapy With Reduced Toxicity Monoclonal Antibodies Target the Tumor Target the Host Immune System In Situ Therapeutic Vaccination TLR Ligands Plus Checkpoint Antibodies Low Doses Avoid Systemic Toxicity

27 Collaborators Antibody Therapy In-Situ Vaccination Rx Synergy Richard Miller Jiali Li David Maloney Josh Brody Idit Sagiv-Barfi* Michael Campbell Wei Ai Debra Czersinski* Kris Thielemans Matt Goldstein Sherri Brown Roch Houot Mark Kaminski Holbrook Kohrt Neil Berinstein Aurelien Marabelle Tim Meeker Michael Khodadoust* Stan Stewart Matt Frank* Tom Davis Adrienne Salets* John Timmerman Adel Kardosh* Wen Kai Weng Steven Long* Ami Okada* Shoshana Levy*