ACCEPTED. Unidad de Investigacion Medica en Enfermedades Infecciosas y Parasitarias 1, Hospital de

Transcription

1 IAI Accepts, published online ahead of print on 1 April 00 Infect. Immun. doi:./iai Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved Heterogeneity in the activity of Mexican Helicobacter pylori strains on gastric epithelial cells and its association with diversity in the caga gene. Running title: Biological activity and diversity in the caga gene Reyes-Leon Adriana 1, Atherton John C,., Argent Richard H,., Puente J. L., Torres J. 1 * Unidad de Investigacion Medica en Enfermedades Infecciosas y Parasitarias 1, Hospital de Pediatria, Centro Medico Nacional Siglo XXI, Instituto Mexicano del Seguro Social (IMSS), Mexico City, Mexico; Wolfson Digestive Diseases Centre, and Institute of Infection, Immunity and Inflammation, University of Nottingham, Queen s Medical Centre, Nottingham, United Kingdom; and Departamento de Microbiologia Molecular, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Cuernavaca, Morelos, Mexico. *Corresponding author: Unidad de Investigación Medica en Enfermedades Infecciosas y Parasitarias, Hospital de Pediatría, Centro Medico Nacional Siglo XXI, Instituto Mexicano del Seguro Social (IMSS). Av. Cuauhtemoc 0, Mexico, D. F., C.P. 0, Mexico. Phone: - 0. Fax -. jtorresl@yahoo.com.mx 1

2 ABSTRACT Background: Helicobacter pylori CagA is translocated into gastric epithelial cells by type IV secretion system and interacts with SHP- phosphatase altering cell morphology. Multiple EPIYA motifs on CagA are associated with increased activity on cells and gastric cancer. Aim: To study the heterogeneity in the activity on cells of multiple H. pylori single colonies isolated from a single patient and its association with polymorphism in caga. Methods: Presence of caga, cage, cagt and cag was studied in 1 H. pylori isolates from antrum and corpus of 1 patients. AGS gastric epithelial cells were infected with isolates, and IL- secretion, cytoskeletal changes, CagA translocation and tyrosine phosphorylation were measured. The caga variable region was sequenced in 0 isolates to determine number and type of EPIYA motifs. Results: Isolates from an individual stomach were usually genetically related and had quantitatively similar phenotypic effects on cells (IL- induction and cytoskeletal changes). However, strains from different patients with similar CagA-EPIYA motif patterns varied widely in these phenotypes. Among isolates with an EPIYA-ABC pattern phenotype was variable: IL- induction ranged from 00 to 100 pg/ml and morphological changes occurred in 0 to 0 % of cells. In several cases caga sequence diversity appeared to explain lack of CagA activity: isolates with an EPIYA-ACC pattern or a modified B-motif, had reduced cell activity. Conclusion: cagpai(+) H. pylori isolates displayed a high level of heterogeneity in their capacity to induce IL- secretion and morphological changes; an absent or modified B-motif was associated with low activity.

3 INTRODUCTION H. pylori infects up to 0 % of the world s human population, lives for decades in the human stomach (1), and is associated with duodenal ulcer (DU) (1), gastric ulcer (GU), distal gastric adenocarcinoma (GC) and gastric MALT lymphoma (1). Its ability to cause disease has been associated with the expression of several virulence factors including the VacA cytotoxin (, ), BabA protein (1), neutrophil activating protein (HP-NAP) (0, ), outer inflammatory protein (OipA) (0), duodenal ulcer promoting gene (dupa) () and the cag pathogenicity island (cagpai). The cagpai is a 0 kb region originally acquired horizontally and inserted into the glutamate racemase gene (1, 1); it is present in about 0-0 % of H. pylori isolates from Western countries and in more than 0 % from East Asian countries. Some studies have shown that severe gastroduodenal diseases are associated with H. pylori strains that harbor an intact cagpai (,,,,,, ), whereas others studies could not find a relationship (, ). Genes in the cagpai encode a type IV secretion system (1) through which CagA is translocated into gastric epithelial cells where it is phosphorylated by Src kinases on the tyrosine residues of a five amino acid (EPIYA) motif (,, 0, ). Once phosphorylated CagA interacts with SHP- phosphatase and stimulates downstream signaling cascades involved in the reorganization of the cytoskeleton resulting in cellular morphological changes such as the Hummingbird phenotype, which is characterized by a prominent elongation and spreading of host cells, including production of filapodia and lamellipodia (0, ). Attachment of H. pylori to gastric epithelial cells also induces the production of interleukin- (IL-), mobilizing inflammatory cells to the site of infection, in a process involving NF-κB activation (,, ). Recently, some authors have

4 reported that IL- release might be mediate by MAP kinases through tyrosine phosphorylation of CagA (1, ). The caga gene contains a end which is highly conserved and a end which is variable. The variable region contains several repeat sequences, each of which contain an EPIYA motif; the size variation of CagA correlates with the number of repeat sequences located in this region (). EPIYA motifs in Western H. pylori isolates are classified as EPIYA-A, EPIYA-B and EPIYA-C and are defined by the amino acid sequences surrounding the EPIYA motifs. It has been suggested that the number of EPIYA-C sites directly correlates with level of tyrosine phosphorylaton, SHP- binding activity and cell damage. CagA in East Asian H. pylori isolates posses EPIYA-A, EPIYA-B and EPIYA-D motifs, the EPIYA-D motif has a higher affinity for SHP- than Western EPIYA-C and appears to induce more severe cellular changes (1). Evidence has been presented showing that CagA protein with more EPIYA motifs is more frequent in strains associated with cases of atrophic gastritis and gastric cancer than in strains from patients with chronic gastritis, suggesting an association between the size of the variable region of caga and clinical outcome (, ). In South African patients, H. pylori strains with four to six EPIYA motifs, and a higher CagA molecular weight were isolated from patients with gastric cancer (). In addition, the study demonstrated that when H. pylori is co-cultured with gastric epithelial cells, a correlation between the size of the CagA protein, the magnitude of tyrosine phosphorylation and the intensity of the cellular elongation exists (). Similar results have been reported with strains from Chinese patients (1).

5 Several studies have addressed the correlation between genetic diversity in the cagpai and disease, but few have reported on phenotypic diversity regarding cellular activity of multiple isolates obtained from a single patient. Accordingly, the aim of this work was to study phenotypic diversity in the activity on gastric epithelial cells of multiple H. pylori single colonies isolated from single patients and to correlate this diversity with the polymorphisms observed in the variable region of the caga gene.

6 MATERIALS AND METHODS Patients. We studied children with chronic abdominal pain (CAP) ( boys and girls) attending the Gastroenterology Department at the Hospital de Pediatria, Centro Medico Nacional Siglo XXI (CMN-SXXI), Instituto Mexicano del Seguro Social (IMSS) in Mexico City, with a mean age of. years (ranging from to 1 years), and adults ( men and women) attending the Gastroenterology Department at the Hospital de Especialidades, CMN-SXXI-IMSS, with a mean age of. years (ranging from to years). Three adult patients had gastric ulcers (GU), four duodenal ulcers (DU) and one non-ulcer dyspepsia (NUD). Patients were endoscoped as part of the usual diagnostic protocol and two biopsies were taken from each of the antrum and corpus; one biopsy from each region was used to culture H. pylori. The study was approved by the ethics committee of the Hospital de Pediatria at CMN-SXXI, IMSS. Helicobacter pylori culture and isolation of multiple single colonies from biopsies. Antrum and corpus biopsy specimens were placed in sterile 0. % saline solution, homogenized and inoculated on blood agar base media (BBL, MD, USA) plates, supplemented with % sheep blood. The plates were incubated at C, in a % CO atmosphere, for up to days. H. pylori was identified by colony and microscopic morphology, and positive oxidase, catalase and urease tests. From each primary growth, seven to ten single colonies from each of the antrum and corpus were isolated and propagated on blood agar medium. We studied a total of 00 isolates from children (mean of 0 per patient) and isolates from adults (mean of 1 per patient).

7 Detection of cagpai genes. DNA was isolated from confluent plate cultures of each isolate, using the commercial Wizard method (Promega Corporation. MA, USA), according to the manufacturer s instructions. DNA from H. pylori strains -1 (ATCC ), (ATCC 00) and Tx0a (ATCC 1) were prepared for use as controls. cage, cagt and cag genes were selected for study because they are distributed along the cagpai and because they are homologous to known genes in type IV secretion systems; in addition, caga was studied because it encodes the protein which is translocated by this system. The presence of these genes was evaluated in the 1 H. pylori isolates by PCR using specific primers (Table 1). Two sets of primers were used for each gene examined except for the cag gene (Table 1). All PCR mixtures consisted of 1 µl of chromosomal DNA template (0 ng), 1 x PCR buffer, 1. mm MgCl, 0. mm each deoxynucleotide (Boehringer Mannheim, Germany), pmol of each primers and 1. units of Taq DNA polymerase (Invitrogen, Life Technologies, Brazil) in a final volume of µl. PCR reactions were performed in a thermal cycler (GeneAmp PCR system 00, PE Applied Biosystems). Positive (, -1) and negative (Tx0a) controls for the cagpai were included in each run. To test for the absence of the cagpai we used the cag empty site (ES) assay with primers and that flank the left and right ends of the cagpai (1). The PCR conditions for each reaction were as previously described (1,,,,, 1). PCR products were electrophoresed, stained with ethidium bromide and visualized under UV light. To confirm PCR results dot blot hybridization was performed, the PCR products for caga, cage, cagt and cag genes were amplified with specific primers F1 and B1, 1 and, cagt-f and cagt-r and cag-f and cag-r respectively using chromosomal DNA from strain -1. PCR products were electrophoresed and appropriate fragments (probes) were purified (Rapid Gel Extaction Systems, Marligen Bioscience, U.S.A) and radioactively labeled with dctp [α- P] by

8 random primer extension (Megaprime DNA labelling system kit, Amersham, Pharmacia Biotech). Hybridization was performed using Hybond-N + nylon membranes (Amersham, Pharmacia Biotech) using 0 ng of genomic DNA per spot from each isolate. Membranes were incubated with the probes, washed and processed for autoradiography with X-ray film (Kodak). Random Amplified Polymorphic DNA (RAPD-PCR) method. Reactions were carried in µl volume containing 0 ng of H. pylori genomic DNA;. µl of X PCR buffer;. mm of MgCl ; 0 pmol of primer 1 or (Table 1); 0. mm each deoxynucleotide (Boehringer Mannheim, Germany); 1. units of Taq DNA polymerase (Invitrogen, Life Technologies, Brazil) as previously reported (). An aliquot of 0 µl of PCR product was electrophoresed in % agarose gel at 0 V, stained and visualized. Sequencing of the variable region of the caga gene. The variable region of caga was amplified with primers cag and cag () (Table 1) and nucleotide sequencing was performed using the dideoxynucleotide chain termination method with a BigDye Terminator v.1 Cycle Sequencing kit (Applied Biosystems) in an automated DNA sequencer, ABI PRISM (Applied Biosystems), as previously described (). Nucleotide and derived amino acid sequences were analyzed and aligned with Chromas (version 1. Technelysium) and DNAMAN (version.0 Lynnon BioSoft) programs. Biological activities of H. pylori on gastric epithelial cells. For translocation and phosphorylation, and IL- induction assays AGS cell line (ATCC CRL-1) was grown in cm flasks with Nutrient Mixture Ham s F-1 (GIBCO, Invitrogen Corporation, USA)

9 supplemented with % heat inactivated fetal bovine serum (F1-% FBS) (GIBCO, Invitrogen Corporation, USA) at C in a % CO atmosphere for hrs; next, serum free F-1 medium was added and cells incubated for additional hrs. For cellular elongation assay 1x AGS cells/ml were grown in well plates with F1-% FBS during h. H. pylori strains to be tested were grown for h in blood agar plates and a single colony was re-seeded on agar plate and incubated for growth during h. H. pylori growth was harvested, and resuspended in serum free F-1 medium, to reach an optical density of 0.1 at 0 nm (1. x bacteria/ml) before addition to AGS cells at a multiplicity of infection (MOI) of 1:0. AGS cells in either cm or -well plates, were co-cultured with H. pylori isolates in serum free F-1 medium for up to hrs (see below). H. pylori strains and 010 (ATCC 0) were used as positive controls. After co-culture for h, the cell culture supernatant was collected and stored at -0 C until tested for IL- induction. The amount of IL- in each sample was measured by enzyme-linked immunosorbent assay (ELISA) using the OptEIA human IL- kit (BD Biosciences, USA) following the manufacturer s instructions. Cells were then washed twice with phosphate-buffered saline (PBS) containing 1 mm calcium chloride and 0. mm magnesium chloride and scraped from the flasks in ml PBS containing 1 mm sodium vanadate, harvested by centrifugation at 1,000 g for minutes, and resuspended in 0 µl PBS/sodium vanadate and 0 µl x sample loading buffer (0. M Tris-HCl, ph., 0. M dithiothreitol, % sodium dodecyl sulfate, 0 % glycerol, 0. % bromophenol blue). Samples were boiled and analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were separated on % polyacrylamide gels, electrotransferred to nitrocellulose membranes using standard procedures and examined for the presence of CagA protein using polyclonal antibodies (bn-0, Santa Cruz Biotechnology, 1:1,000). Phosphorylated tyrosine was detected with monoclonal antibodies

10 (PY, Santa Cruz Biotechnology 1:,000). Blots were then incubated with horseradish peroxidase-conjugated rabbit anti-goat and goat anti-mouse antibodies (Zymed Laboratories, California) and developed with ECL Western blotting detection reagents (Amersham Biosciences, Piscataway, NJ, USA). In some cases, translocated CagA was detected using sera from infected patients (1:0 dilution in PBS) with high levels of anti-caga antibodies; incubated with a peroxidase-conjugated goat antibody to human immunoglobulin G (Zymed Laboratories, California; 1:00 dilution) and developed with ECL Western blotting detection reagents (1). For induction of cellular elongation of AGS cells, AGS cells infected with H. pylori isolates were incubated for up to h. Cells were then examined for the cellular elongation by light microscopy reading three randomly chosen (0X) fields (); results were reported as percent of cells exhibiting the cellular elongation effect. Each isolate was tested for IL-, CagA translocation and phosphorylation, and for cellular elongation in two separate experiments with each sample run in duplicate in each assay. H. pylori adherence and viability during co-infection. To assess H. pylori adherence to AGS cells, co-infection was monitored under light microscopy (0x) during different periods of time to visualize bacteria attached to cells and mobility. Viability of the inoculated bacteria was monitored at 1, and h after co-infection; an aliquot of µl of a 1:0 dilution of the cell culture supernatant was taken, spread on blood agar plates and cultured for h. Statistical analysis. A -tailed Student s t test was used to assess the relationship of cagpai(+) and cagpai(-) strains with induction of IL- release and cellular elongation in AGS cells. A p value of <0.0 (two-sided) was considered as statistically significant.

11 RESULTS Presence of caga, cage, cagt and cag genes. Among the 1 H. pylori isolates studied, all four cagpai genes (caga, cage, cagt and cag) were present in 0 isolates (. % cagpai+); and were absent in isolates (1.1 %), which were positive for the PCR empty site (cagpai- isolates) (Table ). In all 0 isolates from patient, caga was absent, but cage, cagt and cag were present, indicating a partial deletion in the cagpai. Patient was colonized with both, cagpai(+) and cagpai(-) isolates, which had different RAPD patterns (data not shown), showing evidence of mixed infection (Table ). The variable region of the caga gene was amplified in the 0 caga(+) isolates. There was diversity in the size of the fragment among isolates with PCR products showing a length variation between 00 to 0 bp (Table ). Although in the majority of cases all isolates from a patient showed the same length, in three cases (patients, and 1) isolates presented different size in the caga. In patient, 1 isolates had a caga fragment size of 0 bp and one a size of 0 bp. Patient 1 had one isolate with a caga fragment of 00 bp whereas all others had a size of 0 bp (Table and Figure 1); analysis by RAPD-PCR showed that this variation was due to infection with multiple H. pylori strains. In patient most isolates had a fragment size of 0 bp and two isolates had a size of 00 bp (Table and Figure 1); RAPD-PCR analysis showed that these isolates were the same strain with polymorphic variation in its region. Diversity in IL- secretion by AGS cells co-cultured with cagpai(+) and cagpai(-) isolates. We selected a group of H. pylori isolates, cagpai(+), with a partial cagpai (caga-) and cagpai(-), to analyze their ability to induce IL- secretion (Figure A). Among the cagpai(+) H.

12 pylori isolates tested, a wide diversity in their ability to induce IL- secretion was observed, with values which ranged from less than 0 to over 1,00 pg/ml. IL- levels induced by cagpai(-) isolates and by isolates with a partial cagpai (caga - ) were below 00 pg/ml in all cases; which were significantly lower than levels induced by cagpai(+) isolates (Figure A). Isolates from individual patients, on the whole, gave similar results (Figure ). However, wide variation was seen between patients. For further analysis we developed a definition of an IL- non-inducing isolate; using a cut-off value of the mean plus standard deviations of the values obtained with the Tx0a reference strain and the nine cagpai(-) isolates (< 00 pg/ml), 1 of the cagpai(+) isolates were defined as negative for IL- induction (. %). Among these 1 isolates were, out of isolates from patient, out of from patient, and a fraction of isolates from patients,,,, and 1 (Figure ). Diversity in the induction of cellular elongation in AGS cells co-cultured with cagpai(+) and cagpai(-) isolates. AGS cells were infected with the same H. pylori isolates that were tested for IL- induction. Among the H. pylori cagpai(+) isolates tested, there was wide diversity in their ability to induce cellular elongation, with values ranging from less than % to over 0 % of cells affected. cagpai(-) isolates and isolates with a partial cagpai (caga-) induced elongation in < 0 % of the cells (Figure B); these values were significantly lower than those induced by cagpai(+) isolates. Isolates from the same patient induced, in general, similar values, although wide variation was seen between patients. Most strains inducing high levels of IL- also caused the highest cytoskeletal changes, although there were clear exceptions (e.g., patients 0,, and 1; Figure ). We defined the cut-off value for cellular elongation as the mean plus standard deviations of the values obtained with the Tx0a reference strain (negative control) 1

13 and nine cagpai(-) isolates (< 0 %). Using this cut-off value, of the (1. %) cagpai(+) isolates were negative for cellular elongation, out of from patient, and a fraction of isolates from patients,, and (Figure ). H. pylori adherence and viability during co-infection. cagpai (+) isolates with low or high activity on AGS cells were monitored for adherence and viability. Both type of isolates, positive or negative for cell activity showed a similar pattern of adherence to AGS cells, which increased over time as can be seen in supplemental Figure 1; mobility of bacteria was evident during the hrs of the assay. Viable H. pylori (> CFU/ml) could be recovered in agar plates even after hrs of co-infection with both type of isolates; besides, images show the growth of H. pylori colonies on the surface of AGS cells after hrs of co-infection (Supplemental Figure 1). In summary, no difference was observed in adherence, mobility or viability between isolates with low or high activity on cells. Translocation and phosphorylation of CagA in AGS cells. The above results showed that H. pylori cagpai(+) isolates had variable effects on AGS cells. To further study this variability, we analyzed the translocation and phosphorylation of the CagA protein in AGS cells in the same isolates. We observed differences in the size of the CagA proteins, which correlated with variation in the size of the variable region of caga (Figure ). According to our results, of the cagpai(+) isolates tested had CagA translocated and phosphorylated within AGS cells. In the remaining four isolates (all from patient ), CagA protein was not recognized by the commercial polyclonal anti-caga antibody (bn-0) we used; however, the translocated CagA protein was recognized by the anti-phosphorylated tyrosine antibody (PY) (Figure ). In 1

14 addition, the CagA protein from these isolates was recognized by IgG of sera from two H. pylori infected patients. (Supplemental Figure ). As expected, the isolates with a partial cagpai, with absence of the caga gene, and the cagpai(-) isolates did not express CagA protein and did not have CagA phosphorylated in AGS cells. Of interest, the cagpai(+) isolates that were non-inducers of either cellular elongation or IL- secretion, were still able to translocate and phosphorylate CagA in AGS cells; although in several cases (such as a) phosphorylation was weak (Figure ). Diversity in the biological activity of H. pylori isolates from a single patient. Heterogeneity in the activity of multiple isolates from a single patient on AGS cells was analyzed. Although most isolates from a single patient were rather homogeneous with regard to cell activity (Figure ), significant diversity was observed in some cases. Isolates from patients, and displayed a high diversity for both cellular elongation and IL- induction. In addition, we identified isolates causing a high cellular elongation phenotype but which were negative for IL- induction (from patients,,,, and 1). Isolates negative for the cellular elongation but inducers of IL- (from patients, and ) were also found; although in all these cases induction of IL- was rather weak (Figure ). Sequencing of the variable region of caga gene. From the cagpai(+) H. pylori isolates tested in the above studies, we chose 0 isolates for sequencing, representing the different sizes in the region of the caga gene and different levels of activity on AGS cells (Table ). In all of these 0 isolates caga had the Western type sequence (Figure ). The number of EPIYA motifs 1

15 varied among these isolates, 0 (. %) had three, (1. %) had four and (1. %) had five motifs. The majority of the isolates with three EPIYA motifs were ABC type and only two isolates (from patient ) were ACC type, with a deletion between the A and C motifs. All of these 0 isolates had a caga size of 0 bp (Table ). The isolates with four EPIYA motifs were ABCC type and all had a caga of 0 bp. Among the five isolates with five EPIYA motifs, two were ABCCC type and three were ABABC type, and had between 00 to 0 bp (Table ). Isolates from patient yielded caga PCR products of 00 bp (isolates c and c) and of 0 bp (isolates a1 and a); these PCR products were sequenced. When compared with isolates a1 and a, isolate c had a deletion of ~ amino acids after the EPIYA-C motif (Figure ); of interest, another isolate from the corpus, c, also showed a deletion after the EPIYA-C motif although this was shorter (~1 amino acids). All isolates from this patient showed similar RAPD patterns, suggesting they were the same strain. However isolate c was negative for IL- induction, while isolates a1, a and c were positive, suggesting that the long deletion after the EPIYA-C motif might be associated with loose of biological activity. Among the 0 isolates tested from patient, 1 had a size of 0 bp and an ABC pattern; whereas one had a size of 0 bp (a) and an ABCC pattern. Isolate a displayed higher levels of IL- secretion and of cellular elongation than isolates with the ABC pattern; isolate a had a different RAPD pattern implying it was a different co-infecting strain. Fourteen isolates were tested from patient 1; 1 had a size of 0 bp and an ABC pattern, whereas one had a size of 00 bp (c1) and an ABABC pattern. IL- secretion and cellular elongation levels were lower in the isolate with an ABABC pattern. Isolate c1 also had a different RAPD pattern (data not shown) implying that it was a 1

16 different co-infecting strain (Figure ). Thus, of three patients with isolates differing in size of region, two had mixed infection and one had the same strain with polymorphism in sequence. Association of the sequence in the region of caga with the activity on AGS cells. We next analyzed the sequence of the variable region searching for possible association with activity on cells, especially in isolates which lacked activity on AGS cells. There was no clear association between the number and type of EPIYA motifs and the ability to induce IL- secretion or cellular elongation (Figure ). However, several interesting results were found in the sequences among isolates negative for both cellular elongation and IL- induction; some had an EPIYA-ACC pattern (patient ; Figure ), suggesting the importance of the EPIYA-B motif for cell activity. Isolates from patient with an EPIYA-ABC pattern had a modified B motif (B* = EPTYA) and three out of four were negative for IL- induction and all four were negative for induction of cellular elongation (Figure ). Isolates from patient 0 with an EPIYA-ABCC pattern had a different modification on B motif (B & = EPIYT) and induced lower levels of cellular elongation and IL- secretion than isolates with normal ABCC pattern (Figure ). In isolates from patient that were caga+, but whose protein product was not recognized by the commercial polyclonal anti-caga (Figure 1), we observed a short insertion of five amino acid (DKGPE) before the EPIYA-A motif, which was not observed in any other patient (Figure ); of interest, isolates from this patient caused a moderate IL- and cellular elongation induction (Figure ). 1

17 DISCUSION caga is a highly polymorphic gene with diversity in its ` end region, which is important for the biological activity of the protein on gastric epithelial cells. This region has the tyrosine phosphorylation site and the SHP- phosphatase binding site. The interaction with these proteins activates a series of signaling pathways, causing an increase in proliferation and abnormal cell motility (, ). It is therefore important to extend studies on polymorphism in this of caga across populations and to correlate this diversity with the biological activity of the strains. In the present study we addressed both the extent of polymorphism in the caga gene and the diversity in the biological activities of Mexican strains on gastric epithelial cells. To better describe the extent of polymorphisms, we chose to study multiple single colonies isolated from different sites of the stomach of individual patients. All isolates from the antrum and corpus of 1 of the 1 patients studied had a homogenous cagpai content; one had a partial cagpai content (patient ); and in only one patient a mixed infection with cagpai (+) and (-) strains was documented (patient ). However, in spite of rather homogeneous gene content in cagpai, diversity in the sequence of caga region was observed in isolates from three patients; in one case the multiple isolates were found to be the same strain (patient ) and in two cases the strains were not the same as documented by RAPD analyses (patient and 1); thus, mixed infection was documented in two cases and polymorphism in was shown in one patient. Once we had determined that most isolates in this study were positive for the cagpai, we next analyzed phenotypic diversity by studying the heterogeneity in the activity of these isolates on 1

18 epithelial cells. cagpai(-) and partial cagpai (caga-) isolates induced very low levels of cellular elongation (< 0 %), and IL- (< 00 pg/ml), as expected. On the other hand, even among isolates positive for the four genes of cagpai tested, including caga, there were a number of isolates which were unable to induce IL- secretion or cellular elongation, which suggests that the mere presence of the cagpai is not sufficient for these activities. In several of these cases, low phosphorylation of CagA might explain the low cell activity, but in others negative activity was observed in spite of the translocation and phosphorylation of CagA. It should be stressed that in all our cases CagA protein was translocated and phosphorylated, suggesting the presence of a functional type IV secretion system. Polymorphisms in the caga region explained many of these cases and illustrate the importance of the EPIYA-B motif; thus, strains lacking this motif (ACC pattern) were unable to induce either IL- secretion or cellular elongation, an observation which has not been reported previously. In addition, strains with a modified B motif (EPTYA) also displayed a weak activity, which further confirms the importance of the whole motif for cell activity. Deletions after the EPIYA-C motif were also associated with either a low or absent biological activity. These results show that a negative or weak IL- or cellular elongation induction in cagpai(+) isolates might be due to specific modifications in the CagA sequence. In accordance with these results, recently Brandt et al. have reported that among cagpai(+) strains there are high and low IL- inducers, this variability was associated with the number of the EPIYA motifs, and the amino acid residues surrounding these motifs; stressing the need for CagA to induce IL- in epithelial cells (1). The diversity in the activity of different cagpai (+) H. pylori isolates on AGS cells does not appear to be influenced by the degree of adherence of the isolate to AGS cells or its ability to grow during the co-infection experiment, since we found 1

19 similar adherence and growth on AGS cells by H. pylori isolates with either high or low cell activity. Of note, among the cagpai(+) isolates, the range of IL- induction varied as much as 0 times (from 0 to over 100 pg/ml) and the intensity of induction of the cellular elongation varied over 1 times (from to 0 %); such wide diversity has not been documented previously and as discussed below, polymorphisms in the caga gene partially explain this diversity. Higashi et al. described that the variation in biological effects of CagA are caused by the variation in the number and sequence of tyrosine phosphorylation sites (1). This correlation was not observed in our study, as is exemplified by the fact that IL- and cellular elongation activities of isolates with an ABC pattern varied from negative to high inducers. The amount of CagA translocated and phosphorylated had a correlation with low activity in several isolates but not in others. As discussed above, in some of these cases variations in the sequence of the B-motif might explain the observed low activity on cells. Still, when the cellular elongation was analyzed, the degree of induction tended to increase in the direction ACC AB * C ABC ABCC ABABC, which partially agrees with previous reports (, 1). This correlation was not observed for IL- induction, which is also in agreement with previous reports (,, ), and confirms that although the role of CagA for both activities is controversial, the mechanism of action is different for each activity (1). This is further supported by the fact that isolates from six patients displayed a moderate or strong cellular elongation activity but a negative IL- induction. Some reports have proposed a key role for cage in IL- induction (); however our results would disagree with this, as all isolates with a negative or low IL- induction had the cage gene present. Still, we can not discard the possibility that like in caga, sequence diversity in cage might cause difference in 1

20 IL- induction. Others authors have also reported that H. pylori can induce NF-κB activation (and Il- secretion) in epithelial cells via Nod1 that respond to peptidoglycan delivered to the cytoplasm of the cell by the type IV secretion system encoded by cagpai (). When diversity in phenotype was analyzed in multiple isolates from a single patient, all representing a unique strain, in many cases a rather homogeneous degree of activity was documented among the isolates. However, there were patients where activity of the isolates on cells varied over times. Some of these cases might be explained by polymorphisms in the caga sequence among the colonizing isolates; sequence diversity, insertions or deletions were documented in such cases. However, in other cases such diversity cannot be explained by heterogeneity in the caga sequence and polymorphisms in other genes of the cag PAI or outside the island might help to explain this diversity. It should be noted that isolates of a single patient classified as the same isolate with tests like RAPD or AFLP, may still show a variation in the gene content of to % of the genome (1, ) and this variation may cause phenotypic diversity. The mechanisms responsible for the observed diversity in these patients deserve further study. An interesting case was patient, whose H. pylori strain produced a CagA protein which could not be recognized by the commercial antibody used in this study; sequence studies showed that it had a five amino acid insertion before the EPIYA-A motif. Conceivably, this might cause changes in the structure of the protein, sufficient to avoid recognition by these particular antibodies. However, this modified protein was still recognized by sera of the same patient from whom the strain was isolated as well as by sera from other patients. 0

21 In conclusion, our study documents a high diversity in the ability of cagpai(+) strains to induce both IL- and cellular elongation in epithelial cells; such diversity might be partially explained by polymorphisms in the region of caga. Another novel observation was the finding that isolates lacking EPIYA-B motif (pattern ACC) or with a modified B-motif displayed a negative or weak activity on epithelial cells; to our knowledge such a possible association has not been reported previously. We documented important diversity in the activity of isolates from a single patient on cells, which in some but not all cases could potentially be explained by polymorphisms in caga. 1

22 ACKNOWLEDGEMENTS This work was partially supported by CONACYT, Mexico (Sectorial Salud, grant CO1-). J.T. is recipient of the Fundacion-IMSS-exclusivity scholarship. Part of this work was submitted as requirement for the D. Sc. degree of Reyes-Leon Adriana at DOCTORADO EN CIENCIAS BIOMEDICAS, UNIVERSIDAD NACIONAL AUTONOMA DE MEXICO.

23 REFERENCES Akopyants, N., S. W. Clifton, D. Kersulyte, J. E. Crabtree, B. E. Youree, C. A. Reece, N. O. Bukanov, E. S. Drazek, B. A. Roe, and D. Berg. 1. Analyses of the cag pathogenicity island of Helicobacter pylori. Mol. Microbiol. :.. Akopyanz, N., N. O. Bukanov, T. U. Westblom, S. Kresovich, and D. E. Berg. 1. DNA diversity among clinical isolates of Helicobacter pylori detected by PCR-based RAPD fingerprinting. Nucleic Acids Res. 0:1-1.. Aras, R. A., Y. Lee, S. K. Kim, D. Israel, R. M. Peek, Jr., and M. J. Blaser. 00. Natural variation in populations of persistently colonizing bacteria affect human host cell phenotype. J. Infect. Dis. 1:.. Argent, R. H., M. Kidd, R. J. Owen, R. J. Thomas, M. C. Limb, and J. C. Atherton. 00. Determinants and consequences of different levels of CagA phosphorylation for clinical isolates of Helicobacter pylori. Gastroenterology. 1:1-.. Atherton, J. C., P. Cao, R. M. Peek, Jr., M. K. Tummuru, M. J. Blaser, and T. L. Cover. 1. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vaca types with cytotoxin production and peptic ulceration. J. Biol. Chem. 0: Atherton, J. C., R. M. Peek, Jr., K. T. Tham, T. L. Cover, and M. J. Blaser. 1. Clinical and pathological importance of heterogeneity in vaca the vacuolating cytotoxin gene of Helicobacter pylori. Gastroenterology. :-.

24 Audibert, C., C. Burucoa, B. Janvier, and J. L. Fauchére Implication of the structure of the Helicobacter pylori cag pathogenicity island in induction of interleukin- secretion. Infect. Immun. :1 1.. Azuma, T., A. Yamakawa, S. Yamazaki, K. Fukuta, M. Ohtani, Y. Ito, M. Dojo, Y. Yamazaki, and M. Kuriyama 00. Correlation between variation of the region of the caga gene in Helicobacter pylori and disease outcome in Japan. J. Infect. Dis. 1: Azuma, T., S. Yamazaki, A. Yamakawa, M. Ohtani, A. Muramatsu, H. Suto, Y. Ito, M. Dojo, Y. Yamazaki, M. Kuriyama, Y. Keida, H. Higashi, and M. Hatakeyama. 00. Association between diversity in the Src homology domain-containing tyrosine phosphatase binding site of Helicobacter pylori CagA protein and gastric atrophy and cancer. J. Infect. Dis. 1:0.. Backert, S., S. Moese, M. Selbach, V. Brinkmann, and T. F. Meyer Phosphorylation of tyrosine of the Helicobacter pylori CagA protein is essential for induction of a scattering phenotype in gastric epithelial cells. Mol. Microbiol. :1.. Backert, S., T. Schwarz, S. Miehlke, C. Kirsch, C. Sommer, T. Kwok, M. Gerhard, U. B. Goebel, N. Lehn, W. Koenig, and T. F. Meyer. 00. Functional analysis of the cag pathogenicity island in Helicobacter pylori isolates from patients with gastritis, peptic ulcer and gastric cancer. Infect. Immun. :-. 1. Björkholm, B., A. Lundin, A. Sillén, K. Guillemin, N. Salama, C. Rubio, J. I. Gordon, P. Falk, and L. Engstrand Comparison of genetic divergence and fitness between two subclones of Helicobacter pylori. Infect. Immun. :.

25 Blaser, M. J., G. I. Perez-Perez, H. Kleanthous, T. L. Cover, M. Peek, P. Chyou, G. N. Stemmermann, and A. Nomura. 1. Infection with Helicobacter pylori strains possessing caga is associated with an increased risk of developing adenocarcinoma of the stomach. Cancer Res. :1. 1. Brandt, S., T. Kwok, R. Harting, W. König, and S. Backert. 00. NF-κB activation and potentiation of proinflammatory responses by the Helicobacter pylori CagA protein. Proc. Natl. Acad. Sci. USA : Censini, S., C. Lange, Z. Xiang, J. E. Crabtree, P. Ghiara, M. Borodovsky, R. Rappuoli, and A. Covacci. 1. cag, a pathogenicity island of Helicobacter pylori, encodes type I- specific and disease-associated virulence factors. Proc. Natl. Acad. Sci. USA : Covacci, A., S. Censini, M. Bugnoli, R. Petracca, D. Burroni, G. Macchia, A. Massone, E. Papini, Z. Xiang, N. Figura, and R. Rappuoli. 1. Molecular characterization of the 1-kDa immunodominant antigen of Helicobacter pylori associated with cytotoxicity and duodenal ulcer. Proc. Natl. Acad. Sci. USA 0:1. 1. Covacci, A., J. L. Telford, G. Del Giudice, J. Parsonnet, and R. Rappuoli. 1. Helicobacter pylori virulence and genetic geography. Science : Eck, M., B. Schmauber, R. Haas, A. Greiner, S. Czub, and H. K. Müller-Hermelink. 1. MALT-type lymphoma of the stomach is associated with Helicobacter pylori strains expressing the CagA protein. Gastroenterology. : Gerhard, M., N. Lehn, N. Neumayer, T. Boren, R. Rad, W. Schepp, S. Miehlke, M. Classen, and C. Prinz. 1. Clinical relevance of the Helicobacter pylori gene for bloodgroup antigen-binding adhesion. Proc. Natl. Acad. Sci. USA :1-1.

26 Higashi, H., R. Tsutsumi, S. Muto, T. Sugiyama, T. Azuma, M. Asaka, and M. Hatakeyama. 00. SHP- tyrosine phosphatase as an intracellular target of Helicobacter pylori CagA protein. Science :. 1. Higashi, H., R. Tsutsumi, A. Fujita, S. Yamazaki, M. Asaka, T. Azuma, and M. Hatakeyama. 00. Biological activity of the Helicobacter pylori virulence factor CagA is determined by variation in the tyrosine phosphorylation sites. Proc. Natl. Acad. Sci. USA :1 1.. Hong, L., P. I. Hsu, D. Graham, and Y. Yamaoka. 00. Duodenal ulcer promoting gene of Helicobacter pylori. Gastroenterology. 1:-.. Ikenoue, T., S. Maeda, K. Ogura, M. Akanuma, Y. Mitsuno, Y. Imai, H. Yoshida, Y. Shiratori, and M. Omata Determination of Helicobacter pylori virulence by simple gene analysis of the cag pathogenicity island. Clin. Diagn. Lab. Immunol. : 1.. Israel, D. A., N. Salama, U. Krishna, U. M. Rieger, J. C. Atherton, S. Falkow, and R. M. Peek, Jr Helicobacter pylori genetic diversity within the gastric niche of a single human host. Proc. Natl. Acad. Sci. USA : Jenks, P., F. Megraud, and A. Labigne. 1. Clinical outcome after infection with Helicobacter pylori does not appear to be reliably predicted by the presence of any of the genes of the cag pathogenicity island. Gut :.. Kauser, F., A. A. Khan, M. A. Hussain, I. M. Carroll, N. Ahmad, S. Tiwari, Y. Shouche, B. Das, M. Alam, S. M. Ali, C. M. Habibullah, R. Sierra, F. Megraud, and L. A. Sechi. 00. The cag pathogenicity island of Helicobacter pylori is disrupted in the majority of patients isolates from different human populations. J. Clin. Microbiol. :0-0.

27 Kidd, M., A. J. Lastovica, J. C. Atherton, and J. A. Louw Conservation of the cag pathogenicity island is associated with vaca alleles and gastroduodenal disease in South African Helicobacter pylori isolates. Gut : 1.. Kim, S., Y. Lee, H. Kim, and M. J. Blaser. 00. Helicobacter pylori CagA transfection of gastric epithelial cells induces interleukin-. Cell. Microbiol. :-.. Maeda, S., H. Yoshida, T. Ikenoue, K. Ogura, F. Kanai, N. Kato, Y. Shiratori, and M. Omata. 1. Structure of cag pathogenicity island in Japanese Helicobacter pylori isolates. Gut : Montecucco, C., and M. de Bernard. 00. Molecular and cellular mechanisms of action of the vacuolating cytotoxin (VacA) and neutrophil activating protein (HP-NAP) virulence factors of Helicobacter pylori. Microb. Infect. : Naito, M., T. Yamazaki, R. Tsutsumi, H. Higashi, K. Onoe, S. Yamazaki, T. Azuma, and M. Hatakeyama. 00. Influence of EPIYA-Repeat polymorphism on the phosphorylation dependent biological activity of Helicobacter pylori CagA. Gastroenterology. 10:1 0.. Nilsson, C., A. Sillén, L. Eriksson, M. Strand, H. Enroth, S. Normark, P. Falk, and L. Engstrand. 00. Correlation between cag pathogenicity island composition and Helicobacter pylori associated gastroduodenal disease. Infect. Immun. 1: 1.. Occhialini, A., A. Marais, M. Urdaci, R. Sierra, N. Muñoz, A. Covacci, and F. Megraud Composition and gene expression of the cag pathogenicity island in Helicobacter pylori strains isolated from gastric carcinoma and gastritis patients in Costa Rica. Infect. Immun. :10 10.

28 Odenbreit, S., J. Püls, B. Sedlmaier, E. Gerland, W. Fischer, and R. Haas Translocation of Helicobacter pylori CagA into gastric epithelial cells by type IV secretion. Science : Owen, R. J., S. I. Sharp, A. J. Lawson, Z. Durrani, S. Rijpkema, and M. Kidd. 00. Investigation of the biological relevance of Helicobacter pylori cage locus diversity, presence of CagA tyrosine phosphorylation motifs and vacuolating cytotoxin genotype on IL- induction in gastric epithelial cells. FEMS Immunol. Med. Microbiol. : Rieder, G., R. A. Hatz, A. P. Moran, A. Walz, M. Stolte, and G. Enders. 1. Role of adherence in interleukin- induction in Helicobacter pylori-associated gastritis. Infect. Immun. : 0.. Rudi, J., C. Kolb, M. Maiwald, D. Kuck, A. Sieg, P. R. Galle, and W. Stremmel. 1. Diversity of Helicobacter pylori vaca and caga genes and relationship to VacA and CagA protein expression, cytotoxin production and associated diseases. J. Clin. Microbiol. :.. Satin, B., G. Del Giudice, V. D. Bianca, S. Dusi, C. Laudanna, F. Tonello, D. Kelleher, R. Rappuoli, C. Montecucco, and F. Rossi The neutrophil-activating protein (HP- NAP) of Helicobacter pylori is a protective antigen and a major virulence factor. J. Exp. Med. :1-1.. Segal, E., J. Cha, J. Lo, S. Falkow, and L. S. Tompkins. 1. Altered states: involvement of phosphorylated CagA in the induction of host cellular growth changes by Helicobacter pylori. Proc. Natl. Acad. Sci. USA : Selbach, M., S. Moese, C. R. Hauck, T. F. Meyer, and S. Backert. 00. Src is the kinase of the Helicobacter pylori CagA protein in vitro and in vivo. J. Biol. Chem. :.

29 Selbach, M., S. Moese, T. F. Meyer, and S. Backert. 00. Functional analysis of the Helicobacter pylori cag pathogenicity island reveals both VirD-CagA-dependent and VirD-CagA-independent mechanisms. Infect. Immun. 0: 1.. Sharma, S. A., M. K. Tummuru, G. G. Miller, and M. J. Blaser. 1. Interleukin- response of gastric epithelial cell lines to Helicobacter pylori stimulation in vitro. Infect. Immun. : Sharma, S. A., M. K. Tummuru, M. J. Blaser, and L. D. Kerr. 1. Activation of IL- gene expression by Helicobacter pylori is regulated by transcription factor nuclear factor-κb in gastric epithelial cells. J. Immunol. 10: Stein, M., F. Bagnoli, R. Halenbeck, R. Rappuoli, W. J. Fantl, and A. Covacci. 00. c- Src/Lyn kinases activate Helicobacter pylori CagA through tyrosine phosphorylation of the EPIYA motifs. Mol. Microbiol. :1 0.. Tsutsumi, R., H. Higashi, M. Higuchi, M. Okada, and M. Hatakeyama. 00. Attenuation of Helicobacter pylori CagA-SHP- signaling by interaction between CagA and C-terminal Src kinase. J. Biol. Chem. : 0.. Tsutsumi, R., A. Takahashi, T. Azuma, H. Higashi, and M. Hatakeyama. 00. Focal adhesion kinase is a substrate and downstream effector of SHP- complexed with Helicobacter pylori CagA. Mol. Cell. Biol. :1.. Tummuru, M., T. L. Cover, and M. J. Blaser. 1. Cloning and expression of a highmolecular-mass major antigen of Helicobacter pylori: evidence of linkage to cytotoxin production. Infect. Immun. 1:1-10.

30 1. Tummuru, M., S. A. Sharma, and M. J. Blaser. 1. Helicobacter pylori picb, a homologue of the Bordetella pertussis toxin secretion protein, is required for induction of IL- in gastric epithelial cells. Mol. Microbiol. 1:.. Viala, J., C. Chaput, I. G. Boneca, A. Cardona, S. E. Girardin, A. P. Moran, R. Athman, S. Memet, M. R. Huerre, A. J. Coyle, P. S. DiStefano, P. J. Sansonetti, A. Labigne, J. Bertin, D. J. Philpott, and R. L. Ferrero. 00. Nod1 responds to peptydoglycan delivered by Helicobacter pylori cag pathogenicity island. Nat. Immunol. :-. 0. Yamaoka, Y., D. H. Kwon, and D. Graham A M r,000 proinflammatory outer membrane protein (oipa) of Helicobacter pylori. Proc. Natl. Acad. Sci. USA. :. 1. Zhang, Y., R. H. Argent, D. P. Letley, R. J. Thomas, and J. C. Atherton. 00. Tyrosine phosphorylation of CagA from Chinese Helicobacter pylori isolates in AGS gastric epithelial cells. J. Clin. Microbiol. : 0. 0

31 Table 1. Specific primers used to identify cagpai genes in this study. Gene Primer Primer Sequences ( ) Product size (bp) Reference caga ( end) F1 GATAACAGGCAAGCTTTTTGAGG B1 caga ( end) cag cag cage cagt CTGCAAAAGATTGTTTGGCAG GGAACCCTAGTCGGTAATG ATCTTTGAGCTTGTCTATCG 1 TTGAAAACTTCAAGGATAGGATAGAGC GCCTAGCGTAATATCACCATTACCC PBRT-F PBRT-R cagt-f cagt-r AAGGGTAAAGAAATGGGACTG GGAAGCGTGATAAAAGAGCAATGT ATGAAAGTGAGAGCAAGTGT TCACTTACCACTGAGCAAAC CAG1 TCTAAAAAGATTACGCTCATAGGCG CAG1 CTTTGGCTTGCATGTTCAAGTTGCC cag cag-f ATGGAAGACTTTTTGTATAA 0 cag-r TCACAGTTCGCTTGAACCCA 1

32 Empty site ACATTTTGGCTAAATAAACGCTG TCATGCGAGCGGCGATGTG 1 CCGCAGCCAA AACGCGCAAC 0 1

33 Table.- Characteristics of the H. pylori isolates studied per patient and tested for the cagpai, the caga region and activity on cells. Children No. of Patient Diagnosis a isolates cagpai status b caga size, bp No. of isolates used in AGS co-culture experiments / No. of isolates sequenced EPIYA Patterns c CAP 0 Partial - / 0 - CAP / ACC CAP / ABC CAP / AB & C CAP / ABC 1 CAP / 1 ABC DU / ABC CAP / ABCC 0 CAP / AB & CC CAP / ABC / 1 ABCC 1 DU / 0 -

34 Adults GU / 0 - NUD / 0 - GU / AB*C DU / ABCCC DU / ABABC DU 1 GU / / / 0 1 / 1 1 / 1 Total 1 / 0 a CAP = Chronic Abdominal Pain; DU = Duodenal ulcer; GU = Gastric ulcer; NUD = Non-ulcer dyspepsia. b + = Present; - = Absent c B*=EPTYAQVAKKV; B & =EPIYTQVAKKV ABC ABC - AB & C AB & AB & C

35 FIGURE LEGENDS Figure 1.- Determination of the size of the caga variable region by PCR. PCR products of single colony isolates from different patients or from the same patient (, 1 and ) showing size variation. Lane M, molecular size marker. Figure.- Diversity in the biological activity on AGS cells by cagpai(+), four partial cagpai (caga - ) and nine cagpai(-). A) Induction of IL- expression and B) Induction of the cellular elongation. Intensity of both activities varied considerably among the cagpai(+) isolates and was significantly higher than in partial cagpai and cagpai(-) isolates. Horizontal lines indicate mean value. The results represented the mean of three independent experiments. The cut off value for both activities was estimated as the mean plus standard deviations of the values obtained with the Tx0a reference strain and cagpai(-) isolates. Figure.- Diversity in the induction of cellular elongation and IL- secretion by multiple cagpai(+) H. pylori strains, partial cagpai and cagpai(-) isolates from a single patient. Patient number is indicated in the X axes and intensity of cell activity in the Y axes. Horizontal lines indicate mean values and the bars the standard deviation. The results represented the mean of three independent experiments. Figure.- Translocation and phosphorylation of the CagA protein in AGS cells infected with cagpai(+) and cagpai partial H. pylori isolates. Western blot analysis of the CagA translocation into AGS cells with polyclonal α-caga and detection of CagA

36 phosphorylation with α-phospho-tyrosine monoclonal antibody. Isolate a is a cagpai partial (caga-) isolate; all other isolates (from a to c) are cagpai(+). Isolate c was negative for Western blot anti-caga but positive with anti-p-tyr. Isolates with variability in the biological activities levels are marked with circles or squares. Figure. Deduced amino acid sequences of the C-terminal repeat region of CagA from cagpai(+) isolates positive or negative for induction of IL- or cellular elongation. The EPIYA A, B and C motifs and the SHP- binding site after the EPIYA-C are underlined and the western sequence type is shadowed. Figure.- Relationship between the EPIYA patterns and the ability to induce both IL- secretion and the cellular elongation in 0 cagpai(+) H. pylori isolates from our population. Isolates without B motif (ACC pattern, patient ) and with a modified B motif (EPTYA, patient ) caused significantly lower cellular elongation phenotype.

37 1 1 1