The Development of a Novel Cancer Immunotherapeutic Platform Using Tumor-targeting Mesenchymal Stem Cells and a Protein Vaccine
|
|
- Ashlynn Greene
- 5 years ago
- Views:
Transcription
1 original artile The Development of a Novel Caner Immunotherapeuti Platform Using Tumor-targeting Mesenhymal Stem Cells and a Protein Vaine Hon-Jian Wei 1, Alexander TH Wu 2 4, Chung-Huei Hsu 5, Yi-Ping Lin 6, Wen-Fang Cheng 7, Ching-Hua Su 1, Wen-Ta Chiu 4,8, Jaqueline Whang-Peng 4,9, Frank L Douglas 10 and Win-Ping Deng 4,6 1 Graduate Institute of Medial Sienes, College of Mediine, Taipei Medial University, Taipei, Taiwan; 2 Department of Radiation, Shool of Mediine, College of Mediine, Taipei Medial University, Taipei, Taiwan; 3 Translational Researh Laboratory, Caner Center, Taipei Medial University Hospital, Taipei, Taiwan; 4 Center of Exellene for Caner Researh, Taipei Medial University, Taipei, Taiwan; 5 Department of Nulear Mediine, Taipei Medial University Hospital, Taipei, Taiwan; 6 Graduate Institute of Biomedial Materials and Engineering, College of Oral Mediine, Taipei Medial University, Taipei, Taiwan; 7 Graduate Institute of Onology, College of Mediine, National Taiwan University, Taipei, Taiwan; 8 College of Mediine, Taipei Medial University, Taipei, Taiwan; 9 Division of Caner Center, Wan Fang Hospital, Taipei, Taiwan; 10 Austen BioInnovation Institute in Akron, Akron, Ohio, USA An ideal antianer strategy should target only the malignant ells but spare the normal ones. In this regard, we established a platform, onsisting of an antigen-delivering vehile and a protein vaine, for developing an immunotherapeuti approah with the potential for eliminating various aner types. Mesenhymal stem ells (MSCs) have been demonstrated apable of targeting tumors and integrating into the stroma. Moreover, we have developed a protein vaine PE(ΔIII)-E7-KDEL3 whih speifially reognized E7 antigen and eliited immunity against ervial aner. Taking advantage of tumor-homing property of MSCs and PE(ΔIII)-E7-KDEL3, we used E6/E7-immortalized human MSCs () as an E7 antigen-delivering vehile to test if this protein vaine ould effetively eliminate non-e7-expressing tumor ells. Animals whih reeived ombined treatment of and PE(ΔIII)-E7-KDEL3 demonstrated a signifiant inhibition of tumor growth and lung-metastasis when ompared to PE(ΔIII)-E7-KDEL3 only and only groups. The effiieny of tumor suppression orrelated positively to the speifi immune response indued by PE(ΔIII)-E7-KDEL3. In addition, this ombined treatment inhibited tumor growth via induing apoptosis. Our findings indiated that ould be used as a tumor-targeting devie and mediate antitumor effet of PE(ΔIII)-E7-KDEL3. We believe this strategy ould serve as a platform for developing a universal vaine for different aner types. Reeived 12 November 2010; aepted 24 June 2011; published online 26 July doi: /mt Introdution Despite the advanes in both linial and basi researh, dediated to reduing mortality rates and improving survival, aner remains the leading ause of death among patients younger than age 85 years in the United States. 1 Ninety perent of aner deaths do not result from the primary tumor but rather from subsequent organ metastases. 2 Thus, an ideal aner therapy should be able to systemially eradiate both the primary and metastati tumors in the body. Currently, systemi therapy has been limited to hemotherapy and biologi response modifiers. While new therapeuti agents like doetaxel, pemetrexed, and erlotinib have been demonstrated effiay in treating patients with advaned lung aner, linial responses to treatment and improved survival have been modest. 3 The limited suesses of systemi hemotherapy thus undersore the need for developing new therapeuti strategies. Although not without risks, one suh novel therapy approah is vaine therapy. 4,5 Antigenspeifi peptide or protein-based immunotherapy appears to be an attrative approah for aner treatment beause of its potential in eradiating systemi tumors at multiple sites and speifiity in disriminating between normal and neoplasti ells. For instane, human papillomavirus (HPV)-16/18 AS04-adjuvanted vaine has been reported highly effetive against ervial infetion and preaner aused by onogeni HPV types. 6 Although this vaine offers protetions against HPV-16 or HPV-18 infetions and assoiated preanerous lesions, it has little effet against patients who have been burdened by fully developed ervial aner. This limitation ould be a result of immunoediting by aner ells and intrinsially low immunogeniity of ertain antigens suh as E7. 7 To overome this problem, a fusion protein vaine, PE(ΔIII)-E7-KDEL3, was previously developed by our ollaborators. 8 The improved vaine poteny and E7 antigen-presenting ability were attributed to the addition of retrograde-delivery and KDEL domains from exotoxin The first two authors ontributed equally to this work. Correspondene: Win-Ping Deng, Graduate Institute of Biomedial Materials and Engineering, College of Oral Mediine, Taipei Medial University, 250 Wu-Hsing Street, Taipei, 110, Taiwan. wpdeng@ms41.hinet.net Moleular Therapy vol. 19 no. 12, de
2 Stem Cell-based Vaine Treatment The Amerian Soiety of Gene & Cell Therapy A of Pseudomonas aeruginosa. This engineered protein vaine was shown to signifiantly enhane major histoompatibility omplex (MHC) lass I and II presentation of the linked E7 antigen, leading to inreased immunologial responses and antitumor effets in vivo. 8 Another emerging aner therapeuti tool is mesenhymal stem ell (MSC)-based therapy. Others and our laboratory have demonstrated that MSCs targeted to and infiltrated into the tumor and its stroma thus ould be utilized in antianer gene therapy Taking advantage of the aforementioned MSCs tumor-homing and infiltrating abilities, we established an immortalized human MSC ell line, termed using modified HPV-16 E6/E7 genes, 14 whih was then be utilized to target, infiltrate and tag primary and metastati tumors. In this study, we aimed to reate an alternative aner immunotherapeuti platform by ombining our previously established protein vaine, PE(ΔIII)-E7-KDEL3 and the E7 antigen arrying a Proliferation ratio Naive Immune Control MHC I MHC II. We hypothesized that tumors ould be targeted, infiltrated, and tagged by the E7-expressing so that E7-speifi protein vaine, PE(ΔIII)-E7-KDEL3, indued and mounted immunologial attak to suppress or eliminate tumor ells. The first omponent of our system, a speially designed protein vaine, PE(ΔIII)-E7-KDEL3 has been shown to greatly enhane antigen-speifi immunologi responses against HPV-16 E7; it exhibited improved poteny and effiay when ompared to its predeessors both in vitro and in vivo. 8 Although effetive, this protein vaine is limited to targeting E7-expressing tumors suh as ervial and ovarian aners. In order for this fusion protein vaine to be applied in a broader spetrum of aner treatments, we a b Day 7 Day 21 NG4TL4-TK ells inoulation Protein vaine Boost protein vaine Boost protein vaine Time (days) administration Control + b 1:10 3 1: : :10 4 1: :10 5 Control + Relative ytotoxiity (fold hange) Naive Control Naive Immune Figure 1 In vitro immunologial analyses of mie vainated with protein vaine. (a) Splenoyte proliferation assay in response to E7 peptide in vitro. Splenoytes from mie vainated with PE(ΔIII)-E7- KDEL3 showed inreased proliferation in response to E7 peptides ontaining a major histoompatibility omplex (MHC) lass II epitope. (b) Dot blot analysis of E7-speifi antibodies purified from mie vainated with PE(ΔIII)-E7-KDEL3. () E7-speifi antibodies mediated omplement-dependent ytotoxiity. After inubation with the oulture of NG4TL4-TK and KP-hMSC ells, the sera from mie vainated with PE(ΔIII)-E7-KDEL3 indued more ell lysis than that from naive mie. Error bars represent SD among three independent experiments. P < 0.05, P < hmscs, human mesenhymal stem ells. Day 7 Day 14 Figure 2 In vivo imaging of mie-bearing tumor with protein vaine/ mesenhymal stem ells (MSCs) ombined treatment. (a) Illustration of experimental design. (b) Representative planar γ-amera images from the subutaneous tumor model. Images were taken at 7 and 21 after subutaneous (s..) injetion of NG4TL4-TK ells in the right flanks. () Representative planar γ-amera images of lung-metastasis model. Images were olleted at 7 and 14 days after intravenous injetion of NG4TL4-TK ells. There are four groups in both models. Control group, tumor bearing with no treatment (PE(ΔIII)-E7-KDEL3) group, tumor bearing with protein vaine treatment only;, tumor bearing with MSCs treatment only; +PE(ΔIII)-E7-KDEL3 group, tumor bearing with ombined treatment. In the subutaneous tumor model, mie with ombined treatment showed a signifiantly lower level of signal intensity from the tumor than other groups at day 21. Similar to the subutaneous model, signal intensity from the tumor in the lungs was signifiantly weaker in the ombined treatment group. Dotted irle represents the position of the lungs vol. 19 no. 12 de. 2011
3 Stem Cell-based Vaine Treatment introdued a seond omponent to our system, an E7-expressing human MSC ell line. Previously, we demonstrated that were able to target mirosopi tumors, proliferate, and integrate into the stroma. Importantly, these integrated MSCs did not beome tumorigeni and presented a great therapeuti advantage. 9 These intrinsi properties of MSCs make them an ideal traer and delivery system in devising ell-based antianer therapy. We demonstrated that as a tool in tumor targeting and infiltration in a subutaneous and lung-metastasis mouse model. 15,16 In this study, we ombined the E7-expressing MSCs and PE(ΔIII)-E7-KDEL3 protein vaine and examined their antitumor effets. This ombined treatment signifiantly suppressed tumorigenesis and metastasis in the mouse model. More importantly, our system offered a platform for the future development of a universal antitumor treatment. Results Inreased number of E7-speifi CD4 + T-ell preursors and serum level of anti-e7 antibodies eliited by PE(ΔIII)-E7-KDEL3 protein vaine To investigate the immunologial response stimulated by PE(ΔIII)- E7-KDEL3 protein vaine, splenoytes isolated from vainated and naive mie were inubated with E7 peptide-ontaining MHC lass I epitope (amino aid 49 57) or MHC lass II epitope (amino aid 30 67). After a 5-day inubation period, splenoytes ultured with E7 peptide-ontaining MHC lass II epitope exhibited a signifiantly inreased proliferation rate (Figure 1a), suggesting that PE(ΔIII)-E7-KDEL3 protein vaine stimulated signifiantly more E7-speifi CD4 + T-ell preursors than CD8 +. In vitro dot blot analysis was used to demonstrate the relative E7-speifi antibody titer stimulated by the protein vaine (Figure 1b). Then, we oultured NG4TL4-TK and ells with serum from vaine immunized mie to determine antibody-mediated tumor ytotoxiity. Our results demonstrated that anti-e7 serum inreased the inidene of ell lysis in NG4TL4-TK/ oulture (Figure 1). Tumor growth inhibition by PE(ΔIII)-E7-KDEL3 protein vaine/msc ombined treatment monitored by noninvasive moleular imaging We utilized planer γ-imaging to evaluate the therapeuti effet of ombined protein vaine/msc treatment in a mouse model. The time ourse of experiment was illustrated in Figure 2a. Briefly, mie were inoulated with NG4TL4-TK ells at day 0 followed by intravenous injetion of ells on day 3. Mie were first immunized with PE(ΔIII)-E7-KDEL3 protein vaine 7 days after tumor inoulation and reeived boost shots 1 and 2 weeks later. The experiment was divided into four groups, the ontrol group (no treatment), vaine only group (PE(ΔIII)-E7-KDEL3), MSCs only group () and finally ombined-treatment group reeiving both the vaine and MSCs (+PE(ΔIII)- E7-KDEL3). In subutaneous tumor model, planer γ-imaging was obtained on day 7 and 21 post-tumor inoulation. The signal intensity refleted the extent and relative growth of tumor. a Control + + b Control + Tumor volume (m 3 ) 4 Day Days after tumor inoulation Number of pulmonary nodule Control + Figure 3 Assessments of mie-bearing tumor with protein vaine/mesenhymal stem ell (MSC) ombined treatment. (a) The volumes of subutaneous tumors from different treatment groups. The tumors in ombined-treatment group were signifiantly smaller than that in other groups at day 21, and slightly inreased at day 28. Even after 34 days, the signal intensity of planar γ-amera imaging remains weak in ombined-treatment group (n = 6). (b) Representative maro-morphologial images of pulmonary nodules from different treatment groups. The least number of tumor nodules were observed in the ombined-treatment group. () Quantifiation of pulmonary nodules from ontrol and treatment groups. A signifiant derease was observed in the number of pulmonary nodules in the ombined-treatment group when ompared with other groups (n = 5). Error bars indiate SD. P < 0.05, ompared with ontrol group. Moleular Therapy vol. 19 no. 12 de
4 Stem Cell-based Vaine Treatment The Amerian Soiety of Gene & Cell Therapy a M HSV1-tk Control GAPDH b M HPV-16 E6/E7 GAPDH 1.3 kp 346 bp 628 bp 346 bp + Figure 4 Ex vivo validation of mesenhymal stem ells (MSCs) targeting and vaine/mscs ombined treatment in pulmonary metastati tumor. (a) The presene of HSV1-tk gene in the lung tissues from different treatment groups was deteted using reverse transription (RT)- PCR. There were five different groups namely, without any treatment (lane 1), vaine only treatment (lane 2), MSCs only treatment (lane 3), the ombined treatment (lane 4), and positive ontrol NG4TL4-TK ells (lane 5). HSV1-tk gene was used as an indiator for that the pulmonary tumors were developed by NG4TL4-TK ells, and ould be deteted in all groups. (b) RT-PCR detetion of HPV-16 E6/E7 expression in lung tissues from the mie reeived different treatments. The group arrangement is the same as in a exept lane 5, whih represents a positive ontrol, MSCs only. HPV-16 E6/E7 gene in the MSC was deteted in MSCs only treatment group (lane 3) and MSCs ontrol (lane 5). GAPDH was used as an internal standard. M represents DNA ladder. () Hematoxylin and eosin (H&E) stained parafilm setions of the lung tissues from different treatment groups. Pulmonary alveoli were appeared more intat in the ombined-treatment group than in other groups. Blue arrow indiated tumor nodule formation. Animals that reeived the ombined treatment demonstrated a gradual derease in signal intensity, refleting redued tumor burden over time as observed on day 21 whereas reversal was observed in the ontrol animals (Figure 2b). In lung-metastasis model, mie reeived intravenous inoulation of NG4TL4-TK ells, were subjeted to planar γ-imaging 7 and 14 days postinoulation. No signals were deteted in the lungs (dot irle) on day 7 in all groups. On day 14, signals from NG4TL4-TK ells were deteted in the lungs of all groups indiating lung metastasis had ourred. Among four experimental groups, mie that reeived the ombined treatment exhibited the weakest tumor signal intensity (Figure 2). Data from both subutaneous and lung-metastasis models suggested the ombined treatment posed an inhibitory effet on NG4TL4-TK tumor growth and lung metastasis. Inhibition of primary and pulmonary metastati tumor in mie using protein vaine/msc ombined treatment To validate data obtained from the in vivo imaging experiments, we alulated the volumes of subutaneous tumors. The results showed that the tumors in ombined-treatment group were signifiantly smaller than that in other groups on day 21. Exept the mie in ombined-treatment group, other mie were all sarified due to oversized or ulerated tumors after day 21. The tumor volumes only slightly inreased and the signal intensity of planar γ-imaging remained weak in ombined-treatment group when examined on day 34 (Figure 3a). To evaluate pulmonary metastases, lung tissues of mie reeiving tumor grafts were olleted 21 days after tumor inoulation. The maromorphologial analysis demonstrated that signifiantly fewer pulmonary nodules were observed in the ombined-treatment group when ompared to those in other groups (Figure 3b). After quantifiation, the mean numbers of pulmonary tumor nodules in mie that reeived the ombined treatment were signifiantly lower than the animals treated with other approahes (Figure 3). We also performed survival assay on lung-metastasis model. The result showed that the survival rate of ombined-treatment group was ~25 35% higher than other groups (Supplementary Figure S1). Homing of MSCs to pulmonary metastati tumor Next, we onfirmed that the pulmonary tumors were originated from NG4TL4-TK ells by the presene of HSV1-tk gene using semiquantitative reverse transription (RT)-PCR. The presene of HSV1-tk PCR produt was deteted in all treatment groups (Figure 4a). The mrna level of HSV1-tk appeared to be lower in both vaine only (Figure 4a, lane 2) and ombined-treatment samples (Figure 4a, lane 4). In a parallel experiment, HPV-16 E6/ E7 gene was utilized to identify MSCs. As expeted, HPV-16 E6/E7 mrna was deteted in the lung tissue of mie that reeived MSC only treatment (Figure 4b, lane 3), verifying MSCs ould target and infiltrate tumors. However, HPV-16 E6/E7 mrna was not deteted in the ombined-treatment group (Figure 4b, lane 4). We reasoned that HPV-16 E6/E7 was undetetable in the ombinedtreatment group was due to the immunologial attak launhed by the vaine against ells with E7 antigen inluding the injeted MSCs. The effetiveness of protein vaine/msc ombined treatment was also validated by histologial analysis. In hematoxylin and eosin setions, the lung tissue of ombined-treatment group demonstrated a higher degree of strutural integrity as evident by the presene of intat pulmonary alveolus (arrow in Figure 4). Tumor regression by protein vaine/msc ombined-treatment PE(ΔIII)-E7-KDEL3 protein vaine-indued immunity was predominantly mediated by antibody-dependent mehanisms as shown in Figure 1. To validate this notion, we analyzed the relationship between serum onentration of anti-e7 antibodies and tumor volume. In the subutaneous tumor model, a negative orrelation between the titer of anti-e7 antibody and tumor volume was observed. In the ombined-treatment group (+PE(ΔIII)-E7-KDEL3), three animals (six mie in total) showed a substantially smaller tumor burden than the animals that reeived stem ell treatment only (, Figure 5a) and this tumor suppression was orrelated to the signifiantly higher serum onentration of anti-e7 antibody. We further examined whether the protein vaine/msc ombined treatment ould indue tumor apoptosis. TUNEL assay revealed that the number of apoptoti ells (green) in the tumor of mie treated with protein vaine/msc were higher than mie reeived only stem ells () (Figure 5b). Quantitatively, an approximately twofold inrease in apoptoti ells was observed in the tumor setions from protein vaine/msc group when ompared to setions from the stem ells-treated group (Figure 5) vol. 19 no. 12 de. 2011
5 Stem Cell-based Vaine Treatment a + b + E7-speifi antibody 4 Tumor volume (m 3 ) Apoptoti ells/field 0 + Figure 5 Evaluation of tumor inhibition by the protein vaine/mesenhymal stem ells (MSCs) ombined treatment. (a) Western blots probed with anti-e7-antibody from sera of the mie reeived the ombined treatment. A negative orrelation between the level of anti-e7 antibody and the tumor volume was observed. (b) TUNEL analysis of tumor setions obtained from the ombined treatment and MSCs only treatment groups. TUNEL staining was shown in green and propidium iodide (PI) in red. The sample from the ombined treatment ontained more TUNEL-positive ells than the MSCs only group. () Quantifiation of TUNEL analysis (n = 6). Error bars represent SD among three independent experiments. P < 0.05, ompared with group. Disussion It is well doumented that the immune system an ontrol neoplasti development and growth in a proess termed immunosurveillane by reognizing tumor antigens. Some of these antigens, so-alled tumor-speifi antigen, are expressed exlusively by tumors. Tumor-speifi antigens usually arise from viral infetion, geneti mutations, and/or transloations of normal ellular genes. Another group of antigens expressed on tumors more ommonly are alled tumor-assoiated antigen. Tumor-assoiated antigens are found on both normal ells and malignant ells but in a signifiantly higher number in the latter; generally a solid tumor is omposed of heterogeneous ell population and their ellular heterogeneity often ontributes to tumor s ability to esape host immunosurveillane. For instane, tumor-assoiated antigens are often selfantigens so responses are rendered by self-tolerane. 17 Tumor ells downregulate the expression of MHC I/II and ostimulatory moleules leading to anergi T or B ells and failure to respond to their ognate antigens under stimulation. Defets in antigen presentation by antigen-presenting ells, in partiularly, the dendriti ells also ontributes to tumor esape. 18 The tumor stroma has also been shown to assist tumor immunoresistane by serving as a physial barrier between the tumor and immune ells. 19 Therefore, there are two major obstales enountered in aner immunosurveillane: the lak of tumor-speifi antigens and antigen-presenting ability. Hene, we purposed to overome these two aforementioned problems with the ombined usage of protein vaine/msc system and examine the feasibility of this approah in this study. One of the two key omponents of our system was the HPV- 16 E6/E7-immortalized human MSC ell line,. The insertion of HPV-16 E6/E7 genes served two funtions. First, the human MSCs were immortalized so that they ould be used indefinitely and variations between different bathes of primary stem ells ould also be avoided. The immortalized have been thoroughly haraterized and shown to be nontumorigeni. 14 Seond, upon infiltration, delivered the E7 antigen into non-e7 expressing tumor ells thereby providing a tumor-speifi antigen and expanding the therapeuti spetrum of the E7 antigen-based protein vaine (PE(ΔIII)-E7-KDEL3). This laim was supported by several lines of experimental evidene in our study. First, E7 mrna transript was deteted in the tumor biopsies. Seond, tumor-bearing mie reeived E7-expressing and PE(ΔIII)-E7-KDEL3 protein vaine exhibited the highest degree of tumor and metastasis suppression as shown by the planer γ-imaging. Third, lung tissues olleted from lone treatment of or PE(ΔIII)-E7-KDEL3 protein vaine ontained similar numbers of nodules when ompared to nontreatment ontrol whereas the ombined treatment ontained signifiantly fewer nodules. Colletively, these findings indiated Moleular Therapy vol. 19 no. 12 de
6 Stem Cell-based Vaine Treatment The Amerian Soiety of Gene & Cell Therapy Antibody-dependent ytotoxiity : Complement : Natural killer ell II. I. I. Tumor-assoiated stroma MSCs-E7 Endothelial ell-e7 Differentiation Stroma fibroblast-e7 II. Cell fusion I. MSCs-E7 Fused ell-e7 Tumor ell Figure 6 Proposed mehanism underlying the antitumor effet mediated by the vaine/mesenhymal stem ell (MSC) ombined treatment. Diagrammati representation of antitumor mehanisms mediated by +PE(ΔIII)-E7-KDEL3 ombined treatment. Antibody-mediated tumor immunity have been shown ould be ahieved by omplement dependent ytotoxiity and antibody dependent ell-mediated ytotoxiity (NK ells). Hene, we proposed two possible senarios that failitated antitumor effet of PE(ΔIII)-E7-KDEL3. First, injeted upon targeting and interating with tumor ells, integrated into tumor-assoiated stroma by differentiating into vasular endothelial ells and stroma fibroblasts. The E7-antibody reongnized antigen and inhibited the tumor via destroying tumor-assoiated and antiangiogeni effet. Seond, and the tumor ells underwent ellular fusion so that the hybrid progenies also expressed E7 antigen. Thus, antitumor effet was then ahieved by anti-e7 antibodies from the immunization leading to the redued tumor burden and metastasis. that suessfully infiltrated into the tumor and eliited tumoriidal immunologial responses. The detetion of E7 antigen in the tumor also provided evidene that human MSCs suessfully survived in immunologial ompetent mie. This attribute played an important role in our study and provided additional support that human MSCs ould be engrafted into different speies Reent reports have suggested that mesenhymal ells are apable of suppressing immunologial reations by sereting various hemokines and nitri oxide. 23,24 This immunosuppressing ability ould play a major role in the initial survival of followed by the subsequent immunoediting ability of NG4TK4-tk tumor ells one were inorporated into the tumor miroenvironment. This laim was supported by the detetion of E7 antigen in the lung tissues obtained from tumor-bearing mie that reeived only as the treatment. However, E7 antigen was not detetable in the lung tissues olleted from tumor-bearing mie reeiving and PE(ΔIII)-E7-KDEL3 ombined treatment. It is possible that E7-expressing within the tumor might be reognized and eliminated by the vaine-mediated immunologial attaks as evident by the disappearane of E7 antigen in the residual tumor tissue from the mie whih reeived the ombined treatment. In addition, E7-expressing was likely the primary target for vaine-indued anti-e7 immunity as the result of adaptive immunity developed from previous inoulations. Based on this reason and limitation, booster shots ontaining ould not be used in these vainated animals for eliminating residual tumors or seondary metastasis in present study. In the future, this limitation ould be irumvented by an induible promoter system where E7 gene expression an be regulated in the MSCs, allowing stealth homing of E7-expressing MSCs to the tumor without being reognized by the E7 protein vaine-indued immunity. Two induible promoter systems, inluding radiation-induible 25,26 and tetrayline-induible promoters, 27,28 are being investigated for the improvement of this urrent platform. Tumor antigens have been shown primarily present in assoiation with MHC lass I moleules and reognized by tumorspeifi CD8 + T ells, 29,30 however they also have been found to be assoiated with MHC lass II moleules and reognized by CD4 + T ells In previous study, PE(ΔIII)-E7-KDEL3 protein vaine eliited its antitumor effet via all venues of immunologial responses inluding both CD4 + T, CD8 + T, and natural killer ells. 8 However, CD4 + T ells and MHC II moleules appeared to be the predominant route utilized to deliver tumor suppressing effets in this study. The addition of might ontribute to the different immunologial responses triggered by PE(ΔIII)- E7-KDEL3 protein vaine when ompared to the results from the earlier study. As stated previously, MSCs are apable of suppressing immune system, thus it is possible that immunologial reations mediated by CD8 + T ould be somehow downregulated by the inorporation of. In addition, the extent or amount of E7 antigen tagged to NG4TL4-TK tumors via the inorporation of E7-expressing ould be muh less when ompared to the endogenous E7 antigen presented by TC-1 tumor ells mentioned previously vol. 19 no. 12 de. 2011
7 Stem Cell-based Vaine Treatment The underlying moleular mehanisms responsible for the antianer effets mediated by and PE(ΔIII)- E7-KDEL3 ombined treatment ould be unique due to the involvement of MSCs. Based on the observation that infiltrated tumor ells were targeted and eliminated by anti-e7 antibody generated from PE(ΔIII)-E7-KDEL3 inoulation, we proposed two possible senarios (Figure 6). One senario involves the potential possibility that the infiltrated was integrated into tumor-assoiated stroma. Others and our previous studies have demonstrated that systemi delivery of MSCs ould target to the tumor lesion and then ontribute to the formation of tumor-assoiated stroma by differentiating in to vasular endothelial ells and stomal fibroblasts. 9,35 37 Thus, it is possible that the tumor-assoiated stroma was tagged with E7 antigen as the result of inorporation. The irulating anti-e7 antibody generated from the protein vaine reognized the antigen and inhibited the tumor via destroying the tumorassoiated stroma and antiangiogeni effet. This possibility is urrently being investigated in our laboratory. Another possible senario is that ell fusion may our between tumor and MSCs. MSCs have been shown to be fusogeni in nature. For instane, inflammation has been suggested to trigger the fusion of myelo-lymphoid ells with nonhematopoieti ells inluding ardiomyoytes, skeletal musle, hepatoytes, and Purkinjie neurons. 38 More importantly, the formation of heterokaryon ontains geneti information from both parental ells as demonstrated in the resue of fumarylaetoaetate hydrolasedefiient hepatoytes by heterotypi ell fusion of transplanted bone marrow-derived stem ells. 39 In addition, transplantation of rat bone marrow into mie led to the ativation of dormant rat Purkinjie-speifi genes in BMDC nulei after fusion with mouse Purkinjie neurons aompanied with nulear reprogramming. 40 Based on these findings and to demonstrate that the fusogeni ability of E7-expressing MSCs was not limited to ell line, we onduted in vitro oulture experiments using MSCs isolated from ord blood (CB-MSCs) and NG4TL4-TK tumor ells. CB-MSCs was trandued with nonfuntional (nontumorigeni) E7 antigen and puromyin resistant gene while NG4TL4-TK with neomyin resistant gene. We found that oulturing these two ells gave rise to fusion hybrid ells with resistane to both puromyin and neomyin. Among six single olonies after dual antibioti seletion, one olony appeared to ontain both E7 and TK genes, indiating the suessful ell fusion and the inorporation of parental geneti information into the progeny (Supplementary Figure S2). This finding suggested that spontaneous fusion and geneti reprogramming between MSCs and tumor ells might be more frequent than previously onsidered. Therefore, ell fusion phenomenon ould be one of the potential mehanisms for and PE(ΔIII)-E7-KDEL3 ombined treatmentindued tumoriidal effet. In summary, the present study provided evidene for an alternative approah onsisting of E7-expressing MSCs and its speifi protein vaine, PE(ΔIII)-E7-KDEL3. This ombined treatment appeared to effetively suppress tumorigenesis and metastasis in the mouse model. These experimental findings served as a platform for the future development of a universal treatment for different aner types. Materials and Methods Animals. Four- to six-week-old female FVB/N mie were purhased from the National Taiwan University (Taipei, Taiwan). The animal experiment protool was approved by the Institutional Animal Care and Use Committee of Taipei Medial University. Cell. Murine fibrosaroma ell lines ontaining herpes simplex virus type I thymidine kinase (HSV1-tk) gene (NG4TL4-TK), lung-olonizing metastati saroma ells, were ultured in minimum essential medium supplemented with 10% fetal bovine serum, 100 U/ml peniillin, 10 μg/ ml streptomyin, and 2 mmol/l l-glutamine in a humidified atmosphere with 5% CO 2 at 37 C. 41 Human MSC ell line was originally ultured from the bone marrow of a 61-year-old female donor, immortalized by retroviral-mediated transdution of human papilloma virus E6/E7 genes, and maintained in Dulbeo s modified Eagle s medium ontaining 1 mg/ml gluose and 10% fetal bovine serum, 100 U/ml peniillin, 10 μg/ ml streptomyin, and 2 mmol/l l-glutamine in a humidified atmosphere with 5% CO 2 at 37 C. This immortalized hmsc line is >99% positive for CD29, CD44, CD90, CD105, SH2, and SH3 MSC harateristi markers. 14 Preparation and vaination of protein vaines. The PE(ΔIII)-E7-KDEL3 protein vaine was kindly provided by Dr C.W. Liao, Animal Tehnology Institute Taiwan, Miaoli, Taiwan. 8 The stok of PE(ΔIII)-E7-KDEL3 was diluted with phosphate-buffered saline and inubated for 2 hours in 37 C before vaination. Mie were immunized with 0.1 mg/mouse PE(ΔIII)- E7-KDEL3 mixed with 10% ISA206 adjuvant by subutaneously injeted into the baks of the mie. These animals were then boosted subutaneously 1 and 2 weeks later using the same regimen. Mixed leukoyte reation and 5-bromo-2-deoxyuridine ELISA. Mie were immunized with 0.1 mg/mouse PE(ΔIII)-E7-KDEL3 and boosted with the same regimen 1 and 2 weeks later. Splenoytes were harvested 1 week after the last vaination. Proliferation of splenoytes was determined in vitro using a 5-bromo-2-deoxyuridine ell proliferation assay kit (CHEMICON, Billeria, MA) aording to the manufaturer s instrutions. Before ell proliferation assay, pooled splenoytes from vainated or naive mie were inubated for 6 days with either 1 μg/ml of E7 peptide (amino aid 49 57) ontaining an MHC lass I epitope for deteting E7-speifi CD8 + T ell preursors 42 or 1 μg/ml of E7 peptide (amino aid 30 67) ontaining an MHC lass II epitope for deteting E7-speifi CD4 + T ell preursors. 43 Dot blot assay. For dot blot analysis, E7 protein was blotted onto nitroellulose membrane (Bio-Rad Laboratories, Herules, CA). The membranes were bloked with bloking buffer (5% skim milk in Tris-buffered saline Tween-20) for 1 hour and then bloking solution was disarded. The nitroellulose membrane was inubated with serial diluted serum at 4 C overnight. Antibody binding was deteted by inubation with goat anti-mouse immunoglobulin G-horseradish peroxidase and followed by Western Lighting Chemiluminesene Reagent Plus assay (PerkinElmer, Waltham, MA) aording to the manufaturer s protool. Cytotoxiity assay. For this assay, NG4TL4-TK and ells/well (1:1, in total) were seeded in 96-well plate overnight and followed by the addition of serum from vainated mie for 3 days. Cytotoxiity assay was performed by quantitative measurements of latate dehydrogenase using CytoTox-One Homogeneous Membrane Integrity Assay (Promega, Madison, WI) aording to vendor s protool. Tumor xenografts and protein vaine inoulation. Tumor xenografts were established by subutaneous injetion of or intravenous injetion of NG4TL4-TK ells at day 0 followed by intravenous injetion of on day 3. Mie were first immunized with PE(ΔIII)-E7- KDEL3 protein vaine 7 days after tumor inoulation and reeived boost shots 1 and 2 weeks later. The experiment was divided into four groups, the ontrol group (no treatment), vaine only group (PE(ΔIII)-E7-KDEL3), Moleular Therapy vol. 19 no. 12 de
8 Stem Cell-based Vaine Treatment The Amerian Soiety of Gene & Cell Therapy MSCs only group () and finally ombined-treatment group reeiving both the vaine and MSCs (+PE(ΔIII)-E7-KDEL3). In subutaneous model, tumor volumes were alulated as previously desribed 44 and planer γ-imaging was obtained at day 7 and 21 after the inoulation of NG4TL4-TK ells. After day 21, the animals in ontrol, vaine only and MSCs only group were sarified due to oversized or ulerated tumors. In lung-metastasis model, planar γ-imaging was obtained from 7 and 14 days postinoulation. Planar γ-imaging was performed as desribed. 16 Briefly, 3.7 MBq of 131 I-FIAU were injeted into the tail vein 24 hours before planar imaging. Images were olleted with a digital γ-amera (Elsint SP-6), equipped with a high-energy pinhole ollimator, a 364 kev ± 10% 131 I photopeak energy window, and a bit image matrix. In lung-metastasis model, mie were sarified and lung tissues were olleted 21 days after tumor inoulation. Lungs were fixed in 4% paraformaldehyde and pulmonary tumor nodules in eah mouse were evaluated and enumerated by experimenters blinded to sample identity. For histologial analysis, the fixed lungs were embedded in paraffin and followed by utting in 10 μm setions and stained with hematoxylin and eosin. E7 and TK gene validation by PCR. Total RNA harvested from ells and tumor tissues was extrated using TRIzol reagent (Invitrogen Life Tehnologies, Carlsbad, CA) and underwent RT followed by PCR amplifiation. RT was performed with Super-Sript III (Invitrogen Life Tehnologies) and an Oligo (dt) primer. Four mirograms of RNA were added into a final volume of 21-μl solution ontaining 10 mmol/l deoxynuleotide triphosphate mix, 10 RT buffer, 25 mmol/l MgCl 2, 0.1 mol/l dithiothreitol, RNase inhibitor, and RNase H. Six mirograms of RT produt were used for the PCR amplifiation in a final volume of 50 μl ontaining 2.5 mmol/l deoxynuleotide triphosphate, 25 mmol/l MgCl 2, primers, and Taq DNA polymerase (Invitrogen Life Tehnologies). PCR amplifiation of reverse-transribed omplementary DNA was performed with the following primers and onditions. The primers used for HSV1-tk are 5 TGC AGCGACCCGCTTAACAGCGT 3 (forward) and 5 CATAGATCTGGAT CCTTCCGGTATTGTCT 3 (reverse). Tm: 55 C, 35 yles. The primers for HPV-16 E6/E7 are 5 ATGCATAGTATATAGAGATGGGAAT 3 (forward) and 5 CTGCAGCATCAGCCATGGTAGA 3 (reverse). Tm: 56 C, 35 yles. The primers for GAPDH are 5 GCTCTCCAGAACATCATCCCTGCC 3 (forward) and 5 CGTTGTCATACCAGGAAATGAGCTT 3 (reverse). Tm: 55 C, 35 yles. PCR produts were then run on 1% agarose gels (AMRESCO, Solon, OH) and visualized with ethidium bromide staining. Images were analyzed using FloGel-I (Fluoresent Gel Image System; TOP BIO, Taipei, Taiwan). GAPDH was used as an internal ontrol. Western blot analysis. Reombinant E7 protein was loaded into a sodium dodeyl sulfate-polyarylamide gel and separated by eletrophoresis. For western blotting, proteins from gels were transferred to a polyvinylidene fluoride membrane (pore size, 0.45 μm; Millipore, Billeria, MA) using a Mini Trans-Blot Cell apparatus (Bio-Rad Laboratories). The polyvinylidene fluoride membrane was probed with a 166,000 dilution serum from mie with ombined-treatment group or stem ells only group. The E7-speifi antibody was deteted with inubation with goat anti-mouse immunoglobulin G-horseradish peroxidase and followed by Western Lighting Chemiluminesene Reagent Plus assay (PerkinElmer) aording to the manufaturer s protool. TUNEL assay. TUNEL assay was performed using DeadEnd olorimetri apoptosis detetion system (Promega) aording to the manufaturer s instrutions. Briefly, subutaneous tumor setions from mie of ombined-treatment group or stem ells only group were made permeable with 20 μg/ml proteinase K for 10 minutes at room temperature and the fragmented DNA was labeled using the TdT (terminal deoxynuleotidyl transferase) reation mixture ontaining fluoresein-12-dutp for 1 hour at 37 C aording to supplier reommendations. Nulei were stained with 1 μg/ml propidium iodide. The result of TUNEL assay was expressed quantitatively by the ratio of apoptoti ells/field of view. The group reeived +PE(ΔIII)-E7-KDEL3 treatment demonstrated a signifiantly higher number of apoptoti ells when ompared to the ontrol group whih reeived only. Statistial analysis. All data are expressed as the means ± SD for the number of experiments. Statistial signifiane (P < 0.05; P < 0.01) between experimental and ontrol groups was alulated by paired t-test. SUPPLEMENTARY MATERIAL Figure S1. Survival analysis of mie-bearing pulmonary metastati tumor with protein vaine/mscs ombined treatment. Figure S2. In vitro investigation of the interations between mesenhymal stem ells and aner ells. ACKNOWLEDGMENTS This work was supported by National Siene Counil (NSC B MY3 to W.-P.D.; NSC B MY3 to A.T.H.W.); Core Faility grant (NSC B ) and the Department of Health (DOH) to Taipei Medial University Center of Exellene for Caner Researh (TMU-CECR, DOH100-TD-C ). HealthBanks Bioteh Co., Ltd., Purzer Pharmaeutial Co., Ltd., and Kooper Bioteh Co., Ltd. REFERENCES 1. Jemal, A, Siegel, R, Ward, E, Hao, Y, Xu, J and Thun, MJ (2009). Caner statistis, CA Caner J Clin 59: Mehlen, P and Puisieux, A (2006). Metastasis: a question of life or death. Nat Rev Caner 6: Giovannetti, E, Lemos, C, Tekle, C, Smid, K, Nannizzi, S, Rodriguez, JA et al. (2008). Moleular mehanisms underlying the synergisti interation of erlotinib, an epidermal growth fator reeptor tyrosine kinase inhibitor, with the multitargeted antifolate pemetrexed in non-small-ell lung aner ells. Mol Pharmaol 73: Suntharalingam, G, Perry, MR, Ward, S, Brett, SJ, Castello-Cortes, A, Brunner, MD et al. (2006). Cytokine storm in a phase 1 trial of the anti-cd28 monolonal antibody TGN1412. N Engl J Med 355: Offit, PA (2005). The Cutter inident, 50 years later. N Engl J Med 352: Paavonen, J, Naud, P, Salmerón, J, Wheeler, CM, Chow, SN, Apter, D et al.; HPV PATRICIA Study Group. (2009). Effiay of human papillomavirus (HPV)-16/18 AS04- adjuvanted vaine against ervial infetion and preaner aused by onogeni HPV types (PATRICIA): final analysis of a double-blind, randomised study in young women. Lanet 374: Cheng, WF, Hung, CF, Pai, SI, Hsu, KF, He, L, Ling, M et al. (2002). Repeated DNA vainations eliited qualitatively different ytotoxi T lymphoytes and improved protetive antitumor effets. J Biomed Si 9(6 Pt 2): Liao, CW, Chen, CA, Lee, CN, Su, YN, Chang, MC, Syu, MH et al. (2005). Fusion protein vaine by domains of baterial exotoxin linked with a tumor antigen generates potent immunologi responses and antitumor effets. Caner Res 65: Hung, SC, Deng, WP, Yang, WK, Liu, RS, Lee, CC, Su, TC et al. (2005). Mesenhymal stem ell targeting of mirosopi tumors and tumor stroma development monitored by noninvasive in vivo positron emission tomography imaging. Clin Caner Res 11: Kuerova, L, Matuskova, M, Pastorakova, A, Tyiakova, S, Jakubikova, J, Bohovi, R et al. (2008). Cytosine deaminase expressing human mesenhymal stem ells mediated tumour regression in melanoma bearing mie. J Gene Med 10: Hamada, H, Kobune, M, Nakamura, K, Kawano, Y, Kato, K, Honmou, O et al. (2005). Mesenhymal stem ells (MSC) as therapeuti ytoreagents for gene therapy. Caner Si 96: Kurozumi, K, Nakamura, K, Tamiya, T, Kawano, Y, Ishii, K, Kobune, M et al. (2005). Mesenhymal stem ells that produe neurotrophi fators redue ishemi damage in the rat middle erebral artery olusion model. Mol Ther 11: Nakamura, K, Ito, Y, Kawano, Y, Kurozumi, K, Kobune, M, Tsuda, H et al. (2004). Antitumor effet of genetially engineered mesenhymal stem ells in a rat glioma model. Gene Ther 11: Hung, SC, Yang, DM, Chang, CF, Lin, RJ, Wang, JS, Low-Tone Ho, L et al. (2004). Immortalization without neoplasti transformation of human mesenhymal stem ells by transdution with HPV16 E6/E7 genes. Int J Caner 110: Wang, HE, Yu, HM, Liu, RS, Lin, M, Gelovani, JG, Hwang, JJ et al. (2006). Moleular imaging with 123I-FIAU, 18F-FUdR, 18F-FET, and 18F-FDG for monitoring herpes simplex virus type 1 thymidine kinase and ganilovir prodrug ativation gene therapy of aner. J Nul Med 47: Deng, WP, Wu, CC, Lee, CC, Yang, WK, Wang, HE, Liu, RS et al. (2006). Serial in vivo imaging of the lung metastases model and gene therapy using HSV1-tk and ganilovir. J Nul Med 47: Igney, FH and Krammer, PH (2002). Immune esape of tumors: apoptosis resistane and tumor ounterattak. J Leuko Biol 71: Stewart, TJ and Abrams, SI (2008). How tumours esape mass destrution. Onogene 27: Singh, S, Ross, SR, Aena, M, Rowley, DA and Shreiber, H (1992). Stroma is ritial for preventing or permitting immunologial destrution of antigeni aner ells. J Exp Med 175: vol. 19 no. 12 de. 2011
9 Stem Cell-based Vaine Treatment 20. Min, JJ, Ahn, Y, Moon, S, Kim, YS, Park, JE, Kim, SM et al. (2006). In vivo bioluminesene imaging of ord blood derived mesenhymal stem ell transplantation into rat myoardium. Ann Nul Med 20: Hou, M, Yang, KM, Zhang, H, Zhu, WQ, Duan, FJ, Wang, H et al. (2007). Transplantation of mesenhymal stem ells from human bone marrow improves damaged heart funtion in rats. Int J Cardiol 115: Grinnemo, KH, Månsson, A, Dellgren, G, Klingberg, D, Wardell, E, Drvota, V et al. (2004). Xenoreativity and engraftment of human mesenhymal stem ells transplanted into infarted rat myoardium. J Thora Cardiovas Surg 127: Ren, G, Zhang, L, Zhao, X, Xu, G, Zhang, Y, Roberts, AI et al. (2008). Mesenhymal stem ell-mediated immunosuppression ours via onerted ation of hemokines and nitri oxide. Cell Stem Cell 2: Xu, G, Zhang, L, Ren, G, Yuan, Z, Zhang, Y, Zhao, RC et al. (2007). Immunosuppressive properties of loned bone marrow mesenhymal stem ells. Cell Res 17: Hallahan, DE, Maueri, HJ, Seung, LP, Dunphy, EJ, Wayne, JD, Hanna, NN et al. (1995). Spatial and temporal ontrol of gene therapy using ionizing radiation. Nat Med 1: Senzer, N, Mani, S, Rosemurgy, A, Nemunaitis, J, Cunningham, C, Guha, C et al. (2004). TNFerade biologi, an adenovetor with a radiation-induible promoter, arrying the human tumor nerosis fator alpha gene: a phase I study in patients with solid tumors. J Clin Onol 22: Howe, JR, Skryabin, BV, Belher, SM, Zerillo, CA and Shmauss, C (1995). The responsiveness of a tetrayline-sensitive expression system differs in different ell lines. J Biol Chem 270: Barde, I, Zanta-Boussif, MA, Paisant, S, Leboeuf, M, Rameau, P, Delenda, C et al. (2006). Effiient ontrol of gene expression in the hematopoieti system using a single Tet-on induible lentiviral vetor. Mol Ther 13: Boël, P, Wildmann, C, Sensi, ML, Brasseur, R, Renauld, JC, Coulie, P et al. (1995). BAGE: a new gene enoding an antigen reognized on human melanomas by ytolyti T lymphoytes. Immunity 2: van der Bruggen, P, Traversari, C, Chomez, P, Lurquin, C, De Plaen, E, Van den Eynde, B et al. (1991). A gene enoding an antigen reognized by ytolyti T lymphoytes on a human melanoma. Siene 254: Topalian, SL, Gonzales, MI, Parkhurst, M, Li, YF, Southwood, S, Sette, A et al. (1996). Melanoma-speifi CD4+ T ells reognize nonmutated HLA-DR-restrited tyrosinase epitopes. J Exp Med 183: Manii, S, Sturniolo, T, Imro, MA, Hammer, J, Sinigaglia, F, Noppen, C et al. (1999). Melanoma ells present a MAGE-3 epitope to CD4(+) ytotoxi T ells in assoiation with histoompatibility leukoyte antigen DR11. J Exp Med 189: Pieper, R, Christian, RE, Gonzales, MI, Nishimura, MI, Gupta, G, Settlage, RE et al. (1999). Biohemial identifiation of a mutated human melanoma antigen reognized by CD4(+) T ells. J Exp Med 189: Wang, RF, Wang, X and Rosenberg, SA (1999). Identifiation of a novel major histoompatibility omplex lass II-restrited tumor antigen resulting from a hromosomal rearrangement reognized by CD4(+) T ells. J Exp Med 189: Karnoub, AE, Dash, AB, Vo, AP, Sullivan, A, Brooks, MW, Bell, GW et al. (2007). Mesenhymal stem ells within tumour stroma promote breast aner metastasis. Nature 449: Hall, B, Andreeff, M and Marini, F (2007). The partiipation of mesenhymal stem ells in tumor stroma formation and their appliation as targeted-gene delivery vehiles. Handb Exp Pharmaol: Spaeth, EL, Dembinski, JL, Sasser, AK, Watson, K, Klopp, A, Hall, B et al. (2009). Mesenhymal stem ell transition to tumor-assoiated fibroblasts ontributes to fibrovasular network expansion and tumor progression. PLoS ONE 4: e Alvarez-Dolado, M, Pardal, R, Garia-Verdugo, JM, Fike, JR, Lee, HO, Pfeffer, K et al. (2003). Fusion of bone-marrow-derived ells with Purkinje neurons, ardiomyoytes and hepatoytes. Nature 425: Vassilopoulos, G, Wang, PR and Russell, DW (2003). Transplanted bone marrow regenerates liver by ell fusion. Nature 422: Johansson, CB, Youssef, S, Kolekar, K, Holbrook, C, Doyonnas, R, Corbel, SY et al. (2008). Extensive fusion of haematopoieti ells with Purkinje neurons in response to hroni inflammation. Nat Cell Biol 10: Wei, SJ, Chao, Y, Shih, YL, Yang, DM, Hung, YM and Yang, WK (1999). Involvement of Fas (CD95/APO-1) and Fas ligand in apoptosis indued by ganilovir treatment of tumor ells transdued with herpes simplex virus thymidine kinase. Gene Ther 6: Feltkamp, MC, Smits, HL, Vierboom, MP, Minnaar, RP, de Jongh, BM, Drijfhout, JW et al. (1993). Vaination with ytotoxi T lymphoyte epitope-ontaining peptide protets against a tumor indued by human papillomavirus type 16-transformed ells. Eur J Immunol 23: Cheng, WF, Hung, CF, Hsu, KF, Chai, CY, He, L, Ling, M et al. (2001). Enhanement of sindbis virus self-repliating RNA vaine poteny by targeting antigen to endosomal/ lysosomal ompartments. Hum Gene Ther 12: Deng, WP, Chao, MW, Lai, WF, Sun, C, Chung, CY, Wu, CC et al. (2006). Corretion of malignant behavior of tumor ells by traditional Chinese herb mediine through a restoration of p53. Caner Lett 233: Moleular Therapy vol. 19 no. 12 de
Supplementary Figure 1. Verification of drug infusions into the IPN. a. Representative
Supplementary Figure 1. Verifiation of drug infusions into the IPN. a. Representative neutral red-stained oronal setion from a mouse with a guide annula targeting the IPN. The guide annula sar is irled
More informationoriginal article Chao-Lien Liu 1, Peiqing Ye 1, Benjamin C Yen 1 and Carol H Miao 1,2
The Amerian Soiety of Gene & Cell Therapy original artile In Vivo Expansion of Regulatory T ells With IL-2/IL-2 mab Complexes Prevents Anti-fator VIII Immune Responses in Hemophilia A Mie Treated With
More informationdescribing DNA reassociation* (renaturation/nucleation inhibition/single strand ends)
Pro. Nat. Aad. Si. USA Vol. 73, No. 2, pp. 415-419, February 1976 Biohemistry Studies on nulei aid reassoiation kinetis: Empirial equations desribing DNA reassoiation* (renaturation/nuleation inhibition/single
More informationa-4/b-1 and a-l/b-2 integrins mediate cytokine induced lung leukocyte-epithelial adhesion and injury
British Journal of Pharmaology (27) 152, 915 929 & 27 Nature Publishing Group All rights reserved 7 1188/7 $3. www.brjpharmaol.org RESEARCH PAPER a-4/b-1 and a-l/b-2 integrins mediate ytokine indued lung
More informationReading a Textbook Chapter
HENR.546x.APPBpp001-013 7/21/04 9:37 AM Page 1 APPENDIX B Reading a Textbook Chapter Copyright 2005 Pearson Eduation, In. 1 2 Read the following hapter from the ollege textbook Total Fitness: Exerise,
More informationRetraction Retracted: Study of Effect of Salvianolic Acid B on Motor Function Recovery in Rats with Spinal Cord Injury
Hindawi BioMed Researh International Volume 217, Artile ID 8234878, 1 page https://doi.org/1.1155/217/8234878 Retration Retrated: Study of Effet of Salvianoli Aid B on Motor Funtion Reovery in Rats with
More informationDepartment of Virology, Wellcome Research Laboratories, Langley Court, Beckenham, Kent BR3 3BS, U.K. and heterologous virus challenge.
Journal of General Virology (1992), 73, 727-731. Printed in Great Britain 727 Comparison between in vitro neutralization titres and in vivo protetion against homologous and heterologous hallenge indued
More informationChemotherapy triggers HIF-1 dependent glutathione synthesis and copper chelation that induces the breast cancer stem cell phenotype
hemotherapy triggers HIF-1 dependent glutathione synthesis and opper helation that indues the breast aner stem ell phenotype Haiquan Lu a, ebangshu Samanta a, Lisha Xiang a, Huimin Zhang a, Hongxia Hu
More informationa b Pml F/F Prrx1-cre f 1.4 n.s.
a b Pml F/F Prrx1-re X Prrx1-re-Pml F/F Relative CFU-F numbers 2. Prrx1-Cre-PML +/+ n.s. d early passages e f 1.4 n.s. Adsorbane Adsorbane.8.6.4.2.8.6.4.2 1 2 3 4 days in ulture late passages 2 4 6 8 1
More informationOriginal Articles. Experimental disciform edema and necrotizing keratitis in the rabbit. Joseph F. Metcalf, James I. McNeill, and Herbert E.
Original Artiles Experimental disiform edema and nerotizing keratitis in the rabbit Joseph F. Metalf, James I. MNeill, and Herbert E. Kaufman The development of experimental disiform edema and nerotizing
More informationHomotypic Cell Cannibalism and Cannibalism Index-A Four Year Study in In ltrating Ductal Carcinoma Breast 1* 1 1
ISSN 2231-4261 ORIGINAL ARTICLE Homotypi Cell Cannibalism and Cannibalism Index-A Four Year Study in In ltrating Dutal Carinoma Breast 1* 1 1 Alok Mohan, Pradeep Kr. Sharma, R.K. Thakral 1 Department of
More informationRADIATION DOSIMETRY INTRODUCTION NEW MODALITIES
RADIATION DOSIMETRY M. Ragheb 1/17/2006 INTRODUCTION Radiation dosimetry depends on the aumulated knowledge in nulear siene in general and in nulear and radio hemistry in partiular. The latter is onerned
More informationChapter III. Efficacy of promising agents/combinations in preventing vaginal/cervical inflammation caused by infection with T. vaginalis Introduction
Chapter III Effiay of promising agents/ombinatio in preventing vaginal/ervial inflammation aused by infetion with T. vaginalis Introdution A ontraeptive mirobiide is supposed to be in ontat with the erviovaginal
More informationStefan D Anker, Stephan von Haehling
464 See end of artile for authors affiliations Correspondene to: Dr Stefan D Anker, National Heart and Lung Institute, Department of Clinial Cardiology, Dovehouse Street, London SW3 6LY, UK; s.anker@imperial.a.uk
More informationMETHODS JULIO A. PANZA, MD, ARSHED A. QUYYUMI, MD, JEAN G. DIODATI, MD, TIMOTHY S. CALLAHAN, MS, STEPHEN E. EPSTEIN, MD, FACC
JACC Vol. 17. No.3 Marh 1. 1991 :657-63 657 METHODS Predition of the Frequeny and Duration of Ambulatory Myoardial Ishemia in Patients With Stable Coronary Artery Disease by Determination of the Ishemi
More informationMeasurement of Dose Rate Dependence of Radiation Induced Damage to the Current Gain in Bipolar Transistors 1
Measurement of Dose Rate Dependene of Radiation Indued Damage to the Current Gain in Bipolar Transistors 1 D. Dorfan, T. Dubbs, A. A. Grillo, W. Rowe, H. F.-W. Sadrozinski, A. Seiden, E. Spener, S. Stromberg,
More informationCytomegalovirus and tumor stress-surveillance by human γδ T cell receptor binding to Endothelial Protein C Receptor
Cytomegalovirus and tumor stress-surveillane y human γδ T ell reeptor inding to Endothelial Protein C Reeptor Carrie R. Willox, Vinent Pitard, Sonia Netzer, Lionel Couzi, Mahoo Salim, Toias Silerzahn,
More informationReversal of ammonia coma in rats by L-dopa: a peripheral effect
Gut, 1979, 2, 28-32 Reversal of ammonia oma in rats by L-dopa: a peripheral effet L. ZV1, W. M. DOZAK, AND R. F. DRR From the Department of Mediine, Hennepin ounty Medial enter and Minneapolis Veterans
More informationUbiquitin-dependent degradation of TGF-β-activated Smad2
Ubiquitin-dependent degradation of -ativated Roger S. Lo* and Joan Massagué* *Cell Biology Program, Howard Hughes Medial Institute, Memorial Sloan-Kettering Caner Center, New York, New York 10021, USA
More informationDEPOSITION AND CLEARANCE OF FINE PARTICLES IN THE HUMAN RESPIRATORY TRACT
PII: S0003^t878(96)00171-8 Ann. oup. Hyg., Vol. 41, Supplement 1, pp. 503-508, 1997 1997 British Oupational Hygiene Soiety Published by Elsevier Siene Ltd. All rights reserved Printed in Great Britain
More informationUrbanization and childhood leukaemia in Taiwan
C International Epidemlologial Assoiation 1998 Printed in Great Britain International Journal of Epidemiology 199827:587-591 Urbanization and hildhood leukaemia in Taiwan Chung-Yi Li, a Ruey S Iin b and
More informationKeywords: congested heart failure,cardiomyopathy-targeted areas, Beck Depression Inventory, psychological distress. INTRODUCTION:
International Journal of Medial Siene and Eduation An offiial Publiation of Assoiation for Sientifi and Medial Eduation (ASME) Original Researh Artile ASSOCIATION BETWEEN QUALITY OF LIFE AND ANXIETY, DEPRESSION,
More informationSupplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence
Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay Name FoxO1 forward FoxO1 reverse GK forward GK reverse INS-1 forward INS-1 reverse INS-2 forward INS-2 reverse Glut2 forward Glut2
More informationSequence Analysis using Logic Regression
Geneti Epidemiology (Suppl ): S66 S6 (00) Sequene Analysis using Logi Regression Charles Kooperberg Ingo Ruzinski, Mihael L. LeBlan, and Li Hsu Division of Publi Health Sienes, Fred Huthinson Caner Researh
More informationPDF hosted at the Radboud Repository of the Radboud University Nijmegen
PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publiation lik this link. http://hdl.handle.net/2066/24753
More informationPARKINSON S DISEASE: MODELING THE TREMOR AND OPTIMIZING THE TREATMENT. Keywords: Medical, Optimization, Modelling, Oscillation, Noise characteristics.
PARKINSON S DISEASE: MODELING THE TREMOR AND OPTIMIZING THE TREATMENT Mohammad Haeri, Yashar Sarbaz and Shahriar Gharibzadeh Advaned Control System Lab, Eletrial Engineering Department, Sharif University
More informationRecent advances in basic science BACTERIAL INTERACTIONS WITH CELLS OF THE INTESTINAL MUCOSA: TOLL- LIKE RECEPTORS AND NOD2
1182 Reent advanes in basi siene BACTERIAL INTERACTIONS WITH CELLS OF THE INTESTINAL MUCOSA: TOLL- LIKE RECEPTORS AND NOD2 Published online first 19 April 2005 Correspondene to: Dr E Cario, University
More informationSquirrel Monkeys. serum and was associated with a significant reduction in
INFCTION AND IMMUNITY, June 1991, p. 1927-1931 19-9567/91/61927-5$2./ Copyright 1991, Amerian Soiety for Mirobiology Vol. 59, No. 6 Immune Modulation of Prevotella intermedia Colonization in Squirrel Monkeys
More informationData Retrieval Methods by Using Data Discovery and Query Builder and Life Sciences System
Appendix E1 Data Retrieval Methods by Using Data Disovery and Query Builder and Life Sienes System All demographi and linial data were retrieved from our institutional eletroni medial reord databases by
More informationTumor Blood Flow Modifying Effect of Electrochemotherapy with Bleomycin
ANTICANCER RESEARCH 19: 417-422 (1999) Tumor Blood Flow Modifying Effet of Eletrohemotherapy with Bleomyin GREGOR SERSAl, MAJA CEMAZARl, DAMIJAN MIKLAVCIC 2 and DAVID J. CHAPLIN 3 l/nstitute of Onology
More informationbetween normal children and children with primary
Arhives of Disease in Childhood, 1989, 64, 224-228 odium transport in erythroytes: differenes between normal hildren and hildren with primary and seondary hypertension M UCHIYAMA, V HAH, C E DAMAN WILLEM,
More informationTHE PRESENT AND FUTURE MANAGEMENT OF MALIGNANT BRAIN TUMOURS: SURGERY, RADIOTHERAPY, CHEMOTHERAPY
ii24 THE PRESENT AND FUTURE MANAGEMENT OF MALIGNANT BRAIN TUMOURS: SURGERY, RADIOTHERAPY, CHEMOTHERAPY See end of artile for authors affiliations Correspondene to: Professor R Rampling, Western Infirmary,
More informationSupplementary Figure 1. Implants derived from human embryoid body preparations contain non-cardiac structures. In early studies, infarcted hearts
a Supplementary Figure 1. Implants derived from human emryoid ody preparations ontain non-ardia strutures. In early studies, infarted hearts reeived ell preparations of low ardia purity (
More informationrabbits were paired and both strains were used for For the estimation of mediators in the grafts, rabbits
Br. J. Pharma. (1978), 64, 123-128. HANGES N BLOOD FLOW AND MEDATOR ONTENT OF RABBT SKN GRAFTS G.P. LEWS & BEVERLEY A. MANGHAM Department of Pharmaology, Royal ollege of Surgeons, Linoln's nn Fields, London
More informationHistometry of lymphoid infiltrate in the thyroid of primary thyrotoxicosis patients
J. /in. Path., 1976, 29, 398*402 Histometry of lymphoid infiltrate in the thyroid of primary thyrotoxiosis patients Relation of extent of thyroiditis to preoperative drug treatment and postoperative hypothyroidism
More informationLearned spatiotemporal sequence recognition and prediction in primary visual cortex
Supplementary Materials for Learned spatiotemporal sequene reognition and predition in primary visual ortex Jeffrey P. Gavornik and Mark F. Bear Howard Hughes Medial Institute Piower Institute for Learning
More informationSimple Bacterial Preservation Medium and Its Application to
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Mar. 1978, p. 487491 0099-2240/78/0035-0487$02.00/0 Copyright i 1978 Amerian Soiety for Mirobiology Vol. 35, No. 3 Printed in U.S.A. Simple Baterial Preservation
More informationcollagen-induced arthritis
Pro. Natl. Aad. Si. USA Vol. 92, pp. 517-521, January 1995 Medial Sienes Leukotriene B4 plays a ritial role in the progression of ollagen-indued arthritis R. J. GRIFFITHS*, E. R. PETrIPHER, K. KOCH, C.
More informationTHE ATP-DEPENDENT CONCENTRATION OF CALCIUM BY A GOLGI APPARATUS-RICH FRACTION ISOLATED FROM RAT LIVER
J. Cell Si. 30, 117-128 (1978) Printed in Great Britain Company of Biologists Limited igys THE ATP-DEPENDENT CONCENTRATION OF CALCIUM BY A GOLGI APPARATUS-RICH FRACTION ISOLATED FROM RAT LIVER STUART HODSON
More informationUnit 02 - The Inside Story about Nutrition and Health. True / False
True / False 1. Geneti traits exert the strongest overall influene on health and longevity. False 2. The bodies of modern humans adapted to exist on a diet of wild game, fish, fruits, nuts, seeds, roots,
More informationThe effects of question order and response-choice on self-rated health status in the English Longitudinal Study of Ageing (ELSA)
The effets of question order and response-hoie on self-rated health status in the English Longitudinal Study of Ageing (ELSA) A Bowling, J Windsor Theory and methods Department of Primary Care and Population
More informationTNFa-induced GM-CSF release from human airway smooth muscle cells depends on activation of an ET-1 autoregulatory positive feedback mechanism
Additional details of the methods and results, and an additional figure are published online only at http://thorax.bmj. om/ontent/vol64/issue12 1 Department of Pneumology, Clini III for Internal Mediine,
More informationclinical conditions using a tape recorder system
Thorax (1964), 19, 125 Objetive assessment of ough suppressants under linial onditions using a tape reorder system C. R. WOOLF AND A. ROSENBERG From the Respiratory Unit, Sunnybrook Hospital (Department
More informationStudy of Necrosis in the Liver of Formaldehyde and Benzo(α)Pyrene Exposured-Mice
THE JOURNAL OF TROPICAL LIFE SCIENCE OPEN ACCESS Freely available online VOL. 3, NO. 1, pp. 58 62, January, 2013 Study of Nerosis in the Liver of Formaldehyde and Benzo(α)Pyrene Exposured-Mie Ahmad Soni,
More informationMolecular Epidemiology and Prevalence of Macrolide Efflux Genes mef(a) and mef(e) in Streptococcus pneumoniae Obtained in Canada from 1997 to 2002
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Mar. 2005, p. 1257 1261 Vol. 49, No. 3 0066-4804/05/$08.00 0 doi:10.1128/aac.49.3.1257 1261.2005 Copyright 2005, Amerian Soiety for Mirobiology. All Rights Reserved.
More informationSystematic Review of Trends in Fish Tissue Mercury Concentrations
Systemati Review of Trends in Fish Tissue Merury Conentrations Tom Grieb 1, Roxanne Karimi 2, Niholas Fisher 2, Leonard Levin 3 (1) Tetra Teh, In., Lafayette, CA, USA; (2) State University of New York,
More informationMultifocal Carcinoma of Oral Cavity: A Case Report
JKIMSU, Vol. 5, No. 1, January-Marh, 2016 ISSN 2231-4261 CASE REPORT Multifoal Carinoma of Oral Cavity: A Case Report 1* 2 Anilkumar L Bhoweer, Sudarshan Ranpise 1 Consultant Oral Mediine & Dental Radiology
More informationThe effects of bilingualism on stuttering during late childhood
Additional information is published online only at http:// ad.bmj.om/ontent/vol93/ issue11 1 Division of Psyhology and Language Sienes, University College London, London, UK; 2 Department of Language and
More informationSupplementary Information Computational Methods
Supplementary Information Computational Methods Data preproessing In this setion we desribe the preproessing steps taken to establish the data matrix of hepatoyte single ell gene expression data (Table
More informationImpaired acetaldehyde oxidation in alcoholics*
Impaired aetaldehyde oxidation in aloholis* K R PALMR and W J JNKINSt From the Aademi Department of Mediine, Royal Free Hospital, London Gut, 1982, 23, 729-733 SUMMARY High blood aetaldehyde levels in
More informationPathology of sentinel lymph nodes for melanoma
Postgraduate Medial Shool, University of Surrey and Department of Histopathology, Royal Surrey County Hospital, Guildford, Surrey, UK Correspondene to: Professor M G Cook, Royal Surrey County Hospital,
More informationFunctional GI disorders: from animal models to drug development
1 UCLA Center for Neuroviseral Sienes & Women s Health, Departments of Mediine, Physiology and Psyhiatry, David Geffen Shool of Mediine at UCLA, Los Angeles, CA, USA; 2 UCLA Center for Neuroviseral Sienes
More informationEffect of Dietary Astaxanthin and Background Color on Pigmentation and Growth of Red Cher r y Shr imp, Neocaridina heteropoda
KASETSART UNIVERSITY FISHERIES RESEARCH BULLETIN 04, VOLUME 38 () Effet of Dietary and Color on Pigmentation and Growth of Red Cher r y Shr imp, Neoaridina heteropoda Nongnuh Laohavisuti * and Usharee
More informationExpression and Significance of p53, Rb, p21/waf-1, p16/ink-4a, and PTEN Tumor Suppressors in Canine Melanoma
Vet Pathol 39:458 472 (2002) Expression and Signifiane of p53, Rb, p21/waf-1, p16/ink-4a, and PTEN Tumor Suppressors in Canine Melanoma A. KOENIG, S. R. BIANCO, S. FOSMIRE, J. WOJCIESZYN, AND J. F. MODIANO
More informationpolymorphonuclear neutrophil release of granular
Br. J. Pharma. (1985), 86, 533-537 Phorbol myristate aetate enhanes human polymorphonulear neutrophil release of granular enzymes but inhibits hemokinesis J.R.S. Hoult & Sussan Nourshargh Department of
More informationComparative Activity of Amoxycillin and Ampicillin in an Experimental Bacterial Infection in Mice
ANTMCROBAL AGNTS AND CHMOTHRAPY, Sept. 1973, p. 285-293 Copyright i 1973 Amerian Soiety for Mirobiology Vol. 4, No. 3 Printed in U.S.A. Comparative Ativity of Amoxyillin and Ampiillin in an xperimental
More informationAcute transcriptional up-regulation specific to osteoblasts/osteoclasts in medaka fish
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Aute transriptional up-regulation speifi to osteoblasts/osteolasts in medaka fish immediately after exposure to mirogravity Masahiro Chatani, 1, Hiroya Morimoto,
More informationPIG3 promotes NSCLC cell mitotic progression and is associated with poor prognosis of NSCLC patients
Li et al. Journal of Experimental & Clinial Caner Researh (2017) 36:39 DOI 10.1186/s13046-017-0508-2 RESEARCH Open Aess PIG3 promotes NSCLC ell mitoti progression and is assoiated with poor prognosis of
More informationHistological profile of tumours from MYCN transgenic mice
Histologial profile of tumours from MYCN transgeni mie H C Moore, 1 K M Wood, 2 M S Jakson, 3 M A Lastowska, 3 D Hall, 3 H Imrie, 1 C P F Redfern, 1 P E Lovat, 1 F Ponthan, 1 K O Toole, 1 J Lune, 1 D A
More informationCorrespondence should be addressed to Ali Mobasheri,
Evidene-Based Complementary and Alternative ediine Volume 2012, Artile ID 509383, 16 pages doi:10.1155/2012/509383 Researh Artile Botanial Extrats from Rosehip (Rosaanina), Willow Bark (Salix alba), and
More informationEffect of Curing Conditions on Hydration Reaction and Compressive Strength Development of Fly Ash-Cement Pastes
Effet of Curing Conditions on Hydration Reation and Development of Fly Ash-Cement Pastes Warangkana Saengsoy Candidate for the degree of Dotor of Philosophy Supervisor: Prof. Dr. Toyoharu Nawa Division
More informationSafe and Efficient Gene Therapy for Pyruvate Kinase Deficiency
The Amerian Soiety of Gene & Cell Therapy original artile Safe and Effiient Gene Therapy for Pyruvate Kinase Defiieny Maria Garia-Gomez 1,2, Andrea Calabria 3, Maria Garia-Bravo 1,2, Fabrizio Benedienti
More informationphosphatidylcholine by high performance liquid chromatography: a partial resolution of molecular species
A large-sale purifiation of phosphatidylethanolamine, lysophosphatidylethanolamine, and phosphatidylholine by high performane liquid hromatography: a partial resolution of moleular speies R. S. Fager,
More informationAge-dependent penetrance of different germline mutations in the BRCA1 gene
Age-dependent penetrane of different germline mutations in the BRCA1 gene F Al-Mulla, 1 J M Bland, 2 D Serratt, 3 J Miller, 3 C Chu, 3 G T Taylor 4 Additional data are published online only at http://jp.bmj.
More informationProliferation of Legionella pneumophila as an Intracellular Parasite
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Mar. 1984, p. 467-471 0099-2240/84/030467-05$02.00/0 Copyright C) 1984, Amerian Soiety for Mirobiology Vol. 47, No. 3 Proliferation of Legionella pneumophila as
More informationDetection and Classification of Brain Tumor in MRI Images
PrahiGadpayle and Prof.P.S.Mahajani 45 Detetion and Classifiation of Brain Tumor in MRI Images PrahiGadpayleand Prof.P.S.Mahajani Abstrat Brain tumor detetion in Magneti Resonane Imaging (MRI) is important
More informationEffect of atorvastatin on inflammation and outcome in patients with type 2 diabetes mellitus on hemodialysis
http://www.kidney-international.org & 2008 International Soiety of Nephrology original artile Effet of atorvastatin on inflammation and outome in patients with type 2 diabetes mellitus on hemodialysis
More informationSupplementary Figure 1. Schematic illustrating major conclusions of this study.
ORNs GABA A GABA B glomeruli LN PNs Supplementary Figure 1. Shemati illustrating major onlusions of this study. This study represents the most diret evidene to date of inhiitory interations etween olfatory
More informationA review of novel biological tools used in screening for the early detection of lung cancer
1 Respiratory Unit, Prine Philip Hospital, Hywel Dda NHS Trust, Llanelli, Wales, UK; 2 Shool of Mediine, University of Swansea, Singleton Park, Swansea, West Glamorgan, Wales, UK Correspondene to: Dr R
More informationDefective neutrophil function in low-birth-weight,
J Clin Pathol 1981 ;34:366-37 Defetive neutrophil funtion in low-birth-weight, premature infants H AL-HADITHY, IE ADDISON, AH GOLDSTONE, JC CAWLEY, AND JC SHAW From the Departments of Haematology and Paediatris,
More informationHIV testing trends among gay men in Scotland, UK ( ): implications for HIV testing policies and prevention
See Editorial, p 487 1 MRC Soial and Publi Health Sienes Unit, Glasgow, UK; 2 Division of Psyhology, Shool of Life Sienes, Glasgow Caledonian University, Glasgow, UK; 3 Centre for Sexual Health and HIV
More informationGranulocytosis and Lymphocytopenia in the Blood as Indicators for Drug Adverse Reaction during Calcitonin
Ata Media et Biologia Vol. 44, No.4, 209-213, 1996 Granuloytosis and Lymphoytopenia in the Blood as Indiators for Drug Adverse Reation during Calitonin Therapy in Patients with Osteoporosis after Gastretomy
More informationpersistence of Clostridium difficile during vancomycin
Giat 1983. 24 26212 Relapse of antibioti assoiated olitis: endogenous persistene of lostridium diffiile during vanomyin therapy B A J WALTERS. R ROBERTS. R STAFFORD AND E SENEVIRATNE From tlie Departmtietnt
More informationCaroline P D Wheeler-Jones
1366 Take the online multiple hoie questions assoiated with this artile (see page 1374) T Basi siene CELL SIGNALLING IN THE CARDIOVASCULAR SYSTEM: AN OVERVIEW Caroline P D Wheeler-Jones Heart 2005; 91:1366
More informationTranslocation of a hydrocarbon fluorescent probe between Epstein-Barr virus and lymphoid cells: An assay for
Pro. Natl. Aad. Si. USA Vol. 75, No. 1, pp. 576-58, Otober 1978 ell Biology Transloation of a hydroarbon fluoresent probe between Epstein-Barr virus and lymphoid ells: An assay for early events in viral
More informationRole of the actin cytoskeleton on epithelial Na
Kidney International, Vol. 48 (1995), pp. 970 984 Role of the atin ytoskeleton on epithelial Na hannel regulation Hoiio F. ANTIELLO Renal Unit, Massahusetts General Hospital and Department of Mediine,
More informationOVERVIEW OF THE DIAGNOSIS AND MANAGEMENT OF BRAIN, SPINE, AND MENINGEAL METASTASES
OVERVIEW OF THE DIAGNOSIS AND MANAGEMENT OF BRAIN, SPINE, AND MENINGEAL METASTASES INITIAL See end of artile for authors affiliations Correspondene to: Dr K N Franks, Cookridge Hospital, Leeds Teahing
More informationEugene Crystal, Stuart J Connolly
General ardiology ROLE OF ORAL ANTICOAGULATION IN MANAGEMENT OF ATRIAL FIBRILLATION PREVENTION See end of artile for authors affiliations Correspondene to: Eugene Crystal, MD, Division of Cardiology, Sunnybrook
More informationQuantitative Structure-Activity Relationship Study on Phthalimide Derivatives as HIV-1 Reverse Transcriptase Inhibitors
SieneAsia 27 (2001) : 245-250 Quantitative Struture-Ativity Relationship Study on Phthalimide Derivatives as HIV-1 Reverse Transriptase Inhibitors Jiraporn Ungwitayatorn a, *, Chutima Matayatsuk a, Pathanakarn
More informationMethylglyoxal impairs insulin signalling and insulin action on glucose-induced insulin secretion in the pancreatic beta cell line INS-1E
Diabetologia () 5:9 95 DOI.7/s5--8-8 ARTICLE Methylglyoxal impairs insulin signalling and insulin ation on gluose-indued insulin seretion in the panreati beta ell line INS-E F. Fiory & A. Lombardi & C.
More informationPrognostic value of tissue-type plasminogen activator (tpa) and its complex with the type-1 inhibitor (PAI-1) in breast cancer
British Journal of Caner (999) 80(/2), 286 294 999 Caner Researh Campaign Artile no. bjo.998.0353 Prognosti value of tissue-type plasminogen ativator (tpa) and its omplex with the type- inhibitor (PAI-)
More informationOne objective of quality family-planning services is to. Onsite Provision of Specialized Contraceptive Services: Does Title X Funding Enhance Access?
JOURNAL OF WOMEN S HEALTH Volume 23, Number 5, 204 ª Mary Ann Liebert, In. DOI: 0.089/jwh.203.45 Onsite Provision of Speialized Contraeptive Servies: Does Title X Funding Enhane Aess? Heike Thiel de Boanegra,
More informationM ore than 25% of the U.S. population
C O N S E N S U S R E P O R T Diabetes in Older Adults M. SUE KIRKMAN, MD 1 VANESSA JONES BRISCOE, PHD, NP, CDE 2 NATHANIEL CLARK, MD, MS, RD 3 HERMES FLOREZ, MD, MPH, PHD 4 LINDA B. HAAS, PHC, RN, CDE
More informationComparative in Vitro Cytotoxicity Study of Silver Nanoparticle on Two Mammalian Cell Lines
Dublin Institute of Tehnology ARROW@DIT Artiles Shool of Physis 28 Comparative in Vitro Cytotoxiity Study of Silver Nanopartile on Two Mammalian Cell Lines Gordon Chambers Dublin Institute of Tehnology,
More informationLung function studies before and after a work shift
British J6urnal ofindustrial Mediine 1983;40:153-159 Lung funtion studies before and after a work shift R G LOVE From the Institute of Oupational Mediine, Edinburgh EH8 9SU, UK ABSTRAT The lung funtion
More informationA novel approach to regulate cell membrane permeability for ATP and NADH. formations in Saccharomyces cerevisiae induced by air cold plasma 1
A novel approah to regulate ell membrane permeability for ATP and NADH formations in Saharomyes erevisiae indued by air old plasma 1 Xiaoyu DONG ( 董晓宇 ), Tingting LIU ( 刘婷婷 ), Yuqin XIONG ( 熊玉琴 ) Shool
More informationMenopausal Hormone Therapy Use and Risk of Invasive Colon Cancer
Amerian Journal of Epidemiology ª The Author 2010. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg Shool of Publi Health. All rights reserved. For permissions, please e-mail:
More informationDepartment of Medicine, University of California, Irvine, California, U.S.A.
PPR 16 RSTRUTON O LOO LOW N TRNSCNNTL MTTON R. VNN,.. WLSON, W.R. SMT, and M. MORTON epartment of Mediine, University of California, rvine, California, U.S.. Mar ked dereases in hepati and renal blood
More informationIn vivo covalent cross-linking of photon-converted rare-earth nanostructures for tumour localization and theranostics
Reeived 27 May 2015 Aepted 7 De 2016 Published 20 Jan 2016 DOI: 10.1038/nomms10432 OPE In vivo ovalent ross-linking of photon-onverted rare-earth nanostrutures for tumour loalization and theranostis Xiangzhao
More informationcholerae Non-Ol and Comparison with a Protease of V. cholerae 01
INFECTION AND IMMUNITY, Sept. 1989, p. 2799-283 Vol. 57, No. 9 19-9567/89/92799-4$2./ Copyright C) 1989, Amerian Soiety for Mirobiology Purifiation and Charaterization of a Protease Produed by Vibrio holerae
More informationProtection Against Experimental Bordetella bronchiseptica
INFECTION AND IMMUNITY, Aug. 1983, p. 598-603 0019-9567/83/080598-06$02.00/0 Copyright C 1983, Amerian Soiety for Mirobiology Vol. 41, No. 2 Protetion Against Experimental Bordetella bronhiseptia Infetion
More information% of Nestin-EGFP (+) cells
8 7 6 3 Nestin CD % of Nestin-EGFP (+) ells 8 6 Nestin-EGFP Marge Nestin-EGFP Marge Expression levels of Expression levels of Tumorigeniity y stemness markers ifferentiation markers limiting ilution assay
More informationFunding: MPIC/Agrochemical Industry USDA/ARS
Evaluation and omparison of iofungiides and fungiides for the ontrol of post harvest potato tuer diseases. E. Gahango, W. W. Kirk, P. S. Wharton, R. Shafer and P. Tumalam. Department of Plant Pathology,
More informationAre piglet prices rational hog price forecasts?
AGRICULTURAL ECONOMICS ELSEVIER Agriultural Eonomis 13 (1995) 119-123 Are piglet pries rational hog prie foreasts? Ole GjQ)lberg * Department of Eonomis and Soial Sienes, The Agriultural University of
More informationThe burden of smoking-related ill health in the United Kingdom
The burden of smoking-related ill health in the United Kingdom S Allender, R Balakrishnan, P Sarborough, P Webster, M Rayner Researh paper Department of Publi Health, University of Oxford, Oxford, UK Correspondene
More informationiii Neurones carry information in the form of electrical impulses. Sensory neurones carry impulses from receptors to the central nervous system.
Page 4 Coordination 1 a Brain (1); spinal ord (1) i Motor (1) i Neurones arry information in the form of eletrial impulses. Sensory neurones arry impulses from reeptors to the entral nervous system. (3)
More informationAmelioration of Carcinogen-Induced Toxicity in Mice by Administration of a Potentized Homeopathic Drug, Natrum Sulphuricum 200
Advane Aess Publiation 19 June 2007 ecam 2009;6(1)65 75 doi:10.1093/eam/nem067 Original Artile Amelioration of Carinogen-Indued Toxiity in Mie by Administration of a Potentized Homeopathi Drug, Natrum
More informationM E Guicciardi, G J Gores
1024 RECENT ADVANCES IN BASIC SCIENCE APOPTOSIS: A MECHANISM OF ACUTE AND CHRONIC LIVER INJURY See end of artile for authors affiliations Correspondene to: Dr G J Gores, Mayo Clini College of Mediine,
More informationDexamethasone modulation of tumour necrosis factor-a (cachectin) release by activated normal human alveolar macrophages
ur Resplr J 1992, 5, 67-72 Dexamethasone modulation of tumour nerosis fator-a (ahetin) release by ativated normal human alveolar marophages N. Martinet, P. Vaillant, Th. Charles, J. Lambert, Y. Martinet*
More information