BHS Annual Meeting
|
|
- Ronald Norman
- 5 years ago
- Views:
Transcription
1 BHS Annual Meeting Implementing next-generation deepsequencing assays in diagnostic algorithms in hematological malignancies Dr. Alexander Kohlmann
2 Medical Need for Molecular Characterization 1. Diagnosis/Classification 2. Prognosis 3. Targeted/individualized therapy 4. Minimal residual disease (MRD)
3 Developments in NGS and 2014 Outlook Adopted from Lex Nederbragt
4 Developments in NGS and 2014 Outlook HiSeq X Ten NextSeq MiSeqDx Junior+ MinION GeneReader Adopted from Lex Nederbragt
5 Editor's Summary: A Cancer Genome 6 Nov The technologies that made it possible to characterize individual African and Chinese genomes have broad application in the biomedical field. A demonstration of what can be achieved in a medical context is the first comprehensive sequence of an individual cancer genome, for a patient with AML
6 NGS and Hematological Malignancies Chronic Lymphocytic Leukemia, Nature 2011: NOTCH1 mutations Chronic Lymphocytic Leukemia, NEJM 2011: SF3B1 mutations Hairy Cell Leukemia, NEJM 2011: BRAF mutations Multiple Myeloma, Nature 2011: BRAF mutations non-hodgkin Lymphoma, Nature 2011: MLL2 mutations Burkitt Lymphoma, Nat Gen, Nature 2012: ID3 mutations MDS, Nature + NEJM 2011: SF3B1 + splicing machinery mutations AML, Blood 2011: BCOR mutations AML, Nature, Cell, NEJM 2012: clonal evolution, cohesin genes mutations WM, NEJM 2012: MYD88 mutations T-LGL, NEJM 2012: STAT3 mutations MPN, NEJM 2013: CALR mutations
7 MLL Munich Leukemia Laboratory NGS platforms GS FLX [3] 454 GS Junior [4] Illumina MiSeq [3] Ion Torrent PGM [1] NimbleGen Fluidigm RainDance Beckman Coulter [4] IT (Cluster)
8 Interactions in Routine Diagnostics General practioner Patient Biostatistician Hematologist Molecular biologist Pathologist Cytogeneticist Technician
9 Basic Principles of NGS Approaches [DNA] Whole -exome (WES) ~60 Mb region ~100X coverage Read: 2 x 100 bp Coding regions Gene panels >1000X coverage Deep-sequencing Up to few 100 kb region Read: 500 bp bidirectional Quantitative data Whole-genome (WGS) 3.3 Gb region ~30-40X coverage Read: 2 x 100 bp Structural aberrations
10 Accreditation: DIN EN ISO 15189:2007 Example analyses: TET2 CBL KRAS RUNX1
11 Mutation Analysis Using 454 Sequencing Amplicon deep-sequencing in routine diagnostics operations Target (gene / region)
12 Sample Preparation Options for NGS 96-well plates Access Arrays Microdroplets µl reaction volume 2000 ng / plate up to 95 amplicons / case nl reaction volume 50 ng / reaction 48 amplicons x 48 cases pl reaction volume 2000 ng / sample up to 4000 amplicons
13 454 Sequencing Candidate Genes: TET2 13 amplicons 6 amplicons E3 E4 E5 E6 E7 E8 E9 E10 E11 3,409bp 91bp 94bp 209bp 151bp 90bp 138bp 355bp 1,472bp 27 amplicons Median: 343 bp Minimum: 336 bp Maximum: 350 bp bi-directional sequencing
14 454 Life Sciences Titanium PicoTiterPlate 900,000 reads
15 Sequencing Methodologies: 454 Life Science T A C G Next-generation Sequencing Read: GS6YAAE01AK65W rank= x=124.5 y= Read length=412 TGTACTACTCTACGGTAGCAGAGACTTGGTCTG ACCGGGATCTCCTCTCTGGTTTCTCCTCTTTAG TAATCTCTATGGGCGTGTGTGGTATCAACATGG GATGCACCATGCCCAACCCCAGGGCATCTTGGT AGGTCACAAACTCTGGACGGCCGGTGGGAAGCC CATAGGGCAACCCAGGCTTTGGGGCAAGGTGCC CAGGAAACAGACTGCCATTGGGTAACAAAACTG GGTGAGGGTAGACAGGTCCTTTGCCATGTAAGG AGAGGGGACTTACAGCAATGCCCTCAGGGGCTG GGTAAGGGAGGTAACTCCTGGGGTAGGGAATTG GTGGGGACCTGAATGCCTCATTTGGAGACAGAA ATATAGAGCTTGGTGGAAGGCCTGTAGAACCAT GTCGTCAGTGTGAGTA
16 Illumina MiSeq Instrument Flow Cell (FC) 16,000,000 reads
17 Sequencing Methodologies: Illumina A C G T % Bases by cycle Quality by A4RR3:1:1101:15637:1456 1:N:0:1 CAGGAACTCACTGCCTCCCAGCTCTGA AACATACCATTGTTCAAGTTGAACAGA AAGCTGCACATGTATTTATCATACACT TTCCCTCTTCTGTCAGCTTCATCTTGA GAAATAATCTAAAAAGAAAGACACAGG AGAAAATTCTTTTGGATAAAGGTGATC AAGCCTGACAGTCAGATCGGAAGAGCA CACGTCTGAACTCCAGTCACGAGTGGA TCTCGTATGCCGTCTTCTGCTTGAAAA AAAAAAAA + BBBBBFFFFFFFCGGGGGGGGGHHHFB 5FFFHHHHFHHHHHHBFGGGHFHHHHH GHFHGBFFHGHHHFGHHHHHHHHHHHH HHHHHHGHHHHHHHHHHHHHFHHHHB5 EFBGGHFHHHFHFHFGGGHHHFHHGHH 0FHFGHHHHHHHHHGHHHHGHFHHFHH EFHGGHH2GFHHHHHGHGHG/F/<CFH GHHGHHHGEDHHHHFFGFHHGDG<GFH F0DGFEFHHGHGGGHGHHHGGGFF0FF GGGG?=--
18 NGS Data Analysis: MLL In-House Pipeline Kohlmann A. et al., Br J Haematol. 2013;160(6):
19 TET2 Variant Analysis Procedure (454) c.??? p.??? Roche Amplicon Variant Analyzer (AVA) software
20 TET2 Variant Analysis Procedure (454) c.5183_5187delagatg p.glu1728glyfsx10 JSI SeqPilot software
21 Utility of Amplicon Deep-Sequencing Assays Disease Characterization & Classification Predictive Information Prognostic Information
22 Deep-sequencing of RUNX1 mutations Amplicon design for deep-sequencing analysis Transcript ID: ENST E3 270bp E4 157bp E5 105bp E6 192bp E7 162bp E8 476bp 7 amplicons 454 sequencing fusion primers Median: 342 bp Minimum: 341 bp Maximum: 348 bp [FU] bp 424 RUNX1_ _ [bp] Grossmann V. et al., Haematologica. 2011;96(12):
23 Robustness of Amplicon Deep Sequencing Grossmann V. et al., J Mol Diagn. 2013;15(4):
24 Robustness of Mutation Calling Study Grossmann V. et al., J Mol Diagn. 2013;15(4):
25 Robustness of Mutation Calling Study Grossmann V. et al., J Mol Diagn. 2013;15(4):
26 IRON-I Study: Participants and Laboratories Prof. Haferlach, Munich Leukemia Laboratory, Munich Dr. Timmermann, Max Planck Institute for Molecular Genetics, Berlin Germany Germany Italy Prof. Basso, Università degli studi di Padova, Padova Prof. Young, St. Bartholomews, London GB USA Dr. Simen, 454 Life Sciences, Branford Dr. Gabriel, Blood Bank, Linz Austria Austria Belgium Prof. Vandenberghe, UZ Leuven, Belgium Prof. Martinelli, University of Bologna Italy Netherlands Brazil Dr. Garicochea, Pontifícia Universidade Católica do Rio Grande do Sul, Porto Alegre Dr. JH Jansen, Radboud University Medical Centre, Nijmegen
27 IRON-I: Inter-laboratory Reproducibility TET2 Thr1096Serfs*7 % mutated Coverage A. Kohlmann et al., Leukemia; 25: , 2011
28 Longitudinal Study on Detection Robustness TP53 mutation (p.leu194arg) studied during 11 distinct runs - routine operations from 19. June September independent PCR assays - three distinct molecular barcodes (MID-066, MID-067, MID-068) - three distinct sequencing instruments TP53 p.leu194arg
29 Performance: Reproducibility & Linearity KRAS: p.gly13asp CEBPA Distinct sample preparation assays are leading to robust results Serial dilutions of amplicons yield consistent results Grossmann V. et al., J Mol Diagn. 2013;15(4):
30 Serial Analyses of RUNX1 Mutations p.gln235* p.leu294serfs*7 p.arg444profs*128 p.arg139_ser140inspro Kohlmann A. et al., Leukemia Jan;28(1):
31 Detection of Residual Disease in AML RUNX1 double mutation (p.asp133*, p.pro157thrfs*29) c.396dupt 38.0% 2.0% 0.4% 1.4% 9.0% c.467dupc 37.0% 2.0% 0.8% 1.6% 12.0%
32 Mutation Load (%) Implication of residual RUNX1 mutations Mutation load reduction analysis of 103 cases at follow-up stage 3.61% good responders (n=76) poor responders (n=27) Kohlmann A. et al., Leukemia Jan;28(1):
33 Prognostic Model of Residual Mutation Load Significant differences in (a) EFS (median 21.0 vs 5.7 months, P<0.001) and (b) OS (median 56.9 vs 32.0 months, P=0.002) a p<0.001 b p=0.002 good responders (n=76; median 21.0 months) good responders (n=76; median 56.9 months) poor responders (n=27; median 5.7 months) poor responders (n=27; median 32.0 months) Kohlmann A. et al., Leukemia Jan;28(1):
34 Molecular Detection of Mutations in CML t(9;22)(q34;q11) in CML and targeted treatment regimens Baccarani et al., Haematologica. 2008;93(2):161-9.
35 Assay Design for Deep-Sequencing in CML 1. cdna Synthesis: 1 µg total RNA required 2. First amplification: BCR-ABL1 transcript breakpoint & kinase domain (KD) 3. Second amplification of first PCR product with 454 barcoded fusion primers G250E/R T315I L248V Q252R/H H396P/R V299L F317L M244V Y253F/H L387M/F F359V E255K/V M351T F486S P-loop TK domain A-loop Soverini S. et al., Blood. 2013;122(9):
36 IRON Study Phase II: BCR-ABL1 Data BCR-ABL1 TKD screening performed in Bologna, Brno, Istanbul, London, Madrid, Prague, Rome, Salamanca, Vienna (n=615) 100% M351T 59.55% M351T 89.99% The M351T-positive clone acquires an F317L mutation which confers greater selective advantage M351T+F317L 53.27% M351T M351T+F317L 85.32% 20% Lower limit of Sanger Sequencing 46.56% 0.05% male, 64 yrs DAS after IM failure Nov Dec IM Jan Feb Mar Apr CCyR May MMolR The M351T-positive clone re-emerges Jun M351T 0.53% Jul Aug Sep Oct DAS M351T 3.50% Nov Dec Jan Feb Mar Cytogenetic relapse 1 Data provided by Dr. Simona Soverini, Univ. of Bologna
37 What is the Future of NGS Diagnostics? Gene expression Methylation Digital PCR exome or genome sequencing deep-sequencing of gene panels
38 Gene Panels in Myeloid Malignancies Myeloid malignancies are clinical and biological heterogeneous diseases
39 Mutations in MDS and MDS/MPN Various combinations of founding driver mutations involving genes of RNA splicing (SRSF2, U2AF1) or DNA methylation (TET2, DNMT3A), and subclonal driver mutations involving genes like ASXL1, EZH2, RUNX1, or TP53 SF3B1 mutation: refractory anemia with ring sideroblasts Miscellaneous driver mutations: refractory cytopenia with unilineage dysplasia (refractory anemia) Refractory cytopenia with multilineage dysplasia Refractory anemia with excess blasts TET2/SRSF2 comutation: chronic myelomonocytic leukemia Various founding mutations plus subclonal SETBP1 mutation: atypical chronic myeloid leukemia SF3B1/JAK2 or SF3B1/MPL comutation: refractory anemia with ring sideroblasts associated with Marked thrombocytosis Activating GSF3R mutation: chronic neutrophilic leukemia Cazzola M. et al., Blood. 2013;122(25):
40 CALR (Calreticulin) Mutations in MPN CALR positive myeloproliferative neoplasms suggested to have a more benign clinical course than the corresponding disorders associated with JAK2 or MPL mutations Klampfl T. et al., N Engl J Med Dec 19;369(25):
41 Clinical Effect of Point Mutations in MDS Rafael Bejar et al., NEJM 2011: 18 genes in 439 MDS patients Evaluation of the mutation status of TP53, EZH2, ETV6, RUNX1, and ASXL1 would add the most information to clinical prognostic scores as currently assessed in patients with myelodysplastic syndromes. Bejar R. et al., N Engl J Med. 2011;364(26):
42 Splicing Machinery Mutations in MDS Kenichi Yoshida et al., Nature 2011: spliceosome in 582 MDS patients Our whole-exome sequencing study unexpectedly unmasked a complexity of novel pathway mutations found in approximately 45% to 85% of myelodysplasia patients depending on the disease subtypes. E/A splicing complex: SF3B1 SRSF2 U2AF1 ZRSR2 SF3A1 SF1 U2AF2 PRPF40B Yoshida K. et al., Nature. 2011;478(7367):64-9.
43 Clinical Effect of Point Mutations in MDS Elli Papaemmanuil et al., BLOOD 2013: 111 genes in 738 MDS patients Patients with cytogenetic aberrations: 33% Patients with molecular oncogenic aberrations: 78% Papaemmanuil E. et al., Blood. 2013;122(22):
44 Clinical Effect of Point Mutations in MDS Torsten Haferlach et al., LEUKEMIA 2013: 104 genes in 944 MDS patients Patients with cytogenetic aberrations: 31.4% Patients with molecular oncogenic aberrations: 89.5% Haferlach T. et al., Leukemia Nov 13. [Epub]
45 The Top Twelve Genes Mutated in MDS Papaemmanuil et al. Haferlach et al. 1 SF3B1 TET2 2 TET2 SF3B1 3 SRSF2 ASXL1 4 ASXL1 SRSF2 5 DNMT3A DNMT3A 6 RUNX1 RUNX1 7 U2AF1 U2AF1 8 TP53 ZRSR2 9 EZH2 STAG2 10 IDH2 TP53 11 STAG2 EZH2 12 ZRSR2 CBL Papaemmanuil E. et al., Blood Nov 21;122(22): Haferlach T. et al., Leukemia Nov 13. [Epub]
46 Prognostic Models in MDS Beyond IPSS-R Model 1 Model 2 14 genes + age + WBC, Hb, Plt, % blasts, Cytogenetics according IPSS-R 14 genes only (13/14 from Model 1) Haferlach T. et al., Leukemia Nov 13. [Epub]
47 Deep-Sequencing Myeloid Gene Panel 27-gene panel in routine Dx ASXL1 BCOR BRAF CBL CEBPA DNMT3A ETV6 EZH2 FLT3 (TKD) GATA1 GATA2 IDH1 IDH2 JAK2 KIT KRAS MPL NPM1 NRAS PHF6 RUNX1 SF3B1 SRSF2 TET2 TP53 U2AF1 WT1 Turn-around time: 6-7 days Input: 2.5 µg DNA Single-plex PCR libraries
48 Template Preparation Using Microdroplets Merging Pre-made patient customized DNA with library primer of individual library: PCR primer-pair droplets: 29 genes selected 29-gene Primer Pair Library Genomic DNA Template Mix Amplicon design pipeline 450 amplicons Median length: 164 bp Range: bp Primer synthesis Picoliter-volume droplets Single-plex PCR reaction Emulsion plate collects PCR droplets for amplification Tewhey R. et al., Nat Biotechnol. 2009;27(11):
49 Deep-Sequencing Using SBS Chemistry Assay overview for massively parallel deep-sequencing: Amplicon Generation SBS Chemistry SBS Sequencing
50 Targeted Deep-Sequencing Gene Panel 13-gene panel: ATM BIRC3 BRAF (V600) FBXW7 KLHL6 KRAS NOTCH1 (PEST) NRAS MYD88 POT1 SF3B1 (HEAT) TP53 XPO1 Quesada V. et al., Nat Genet. 2011;44(1): Puente XS. et al., Nature. 2011;475(7354): Wang L. et al., N Engl J Med. 2011;365(26): Landau DA., et al., Cell. 2013;152(4): Rossi D. et al., Blood. 2013;121(8): Turn-around time: 6-7 days Input: 2.2 µg DNA Single-plex PCR libraries 323 amplicons RainDance MiSeq
51 What is the Future of NGS Diagnostics? Gene expression Methylation Digital PCR exome or genome sequencing deep-sequencing of gene panels
52 Panels vs. Whole-exome & Whole-Genome GenomeWeb online, October 2012
53 Summary and Conclusions Next-generation sequencing can be routinely applied in hematological malignancies in diagnosis and prognosis Amplicon deep-sequencing is a technically challenging and complex workflow, including the need for bioinformatics data analysis support Laboratory-developed assays enable the characterization of hematological malignancies for targeted regions, mostly distinct genes or exons, e.g. RUNX1, BCR-ABL1, TP53, EZH2, KRAS, Whole-exome and whole-genome sequencing efforts in cancer patients lead to novel actionable gene panels for diagnostics At this stage, whole-exome/whole-genome diagnostic assessment either too costly, too difficult to analyze or not thoroughly regulated concerning ethical topics
Next Generation Sequencing in Haematological Malignancy: A European Perspective. Wolfgang Kern, Munich Leukemia Laboratory
Next Generation Sequencing in Haematological Malignancy: A European Perspective Wolfgang Kern, Munich Leukemia Laboratory Diagnostic Methods Cytomorphology Cytogenetics Immunophenotype Histology FISH Molecular
More informationIV Simposio International Sao Paulo Nov Hematologic malignant diseases molecular information, present and future
IV Simposio International Sao Paulo Nov 7 2012 Hematologic malignant diseases molecular information, present and future Dr. rer. nat. Alexander Kohlmann, MLL Munich Leukemia Laboratory Spectrum of Methods
More informationIllumina Trusight Myeloid Panel validation A R FHAN R A FIQ
Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol
More informationPlease Silence Your Cell Phones. Thank You
Please Silence Your Cell Phones Thank You Utility of NGS and Comprehensive Genomic Profiling in Hematopathology Practice Maria E. Arcila M.D. Memorial Sloan Kettering Cancer Center New York, NY Disclosure
More informationSupplemental Material. The new provisional WHO entity RUNX1 mutated AML shows specific genetics without prognostic influence of dysplasia
Supplemental Material The new provisional WHO entity RUNX1 mutated AML shows specific genetics without prognostic influence of dysplasia Torsten Haferlach, 1 Anna Stengel, 1 Sandra Eckstein, 1 Karolína
More informationMolecular profiling in confirming the diagnosis of early myelodysplastic syndrome
Molecular profiling of early MDS Hematopathology - March 2016 Article Molecular profiling in confirming the diagnosis of early myelodysplastic syndrome Maya Thangavelu 1,*, Ryan Olson 2, Li Li 2, Wanlong
More informationNext generation sequencing analysis - A UK perspective. Nicholas Lea
Next generation sequencing analysis - A UK perspective Nicholas Lea King s HMDC LMH is part of an integrated pathology service at King s Haematological Malignancy Diagnostic Centre (HMDC) HMDC serves population
More informationIntroduction of an NGS gene panel into the Haemato-Oncology MPN service
Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics
More informationThe Center for PERSONALIZED DIAGNOSTICS
The Center for PERSONALIZED DIAGNOSTICS Precision Diagnostics for Personalized Medicine A joint initiative between The Department of Pathology and Laboratory Medicine & The Abramson Cancer Center The (CPD)
More informationConcomitant WT1 mutations predicted poor prognosis in CEBPA double-mutated acute myeloid leukemia
Concomitant WT1 mutations predicted poor prognosis in CEBPA double-mutated acute myeloid leukemia Feng-Ming Tien, Hsin-An Hou, Jih-Luh Tang, Yuan-Yeh Kuo, Chien-Yuan Chen, Cheng-Hong Tsai, Ming Yao, Chi-Cheng
More informationMyelodysplastic syndromes and the new WHO 2016 classification
Myelodysplastic syndromes and the new WHO 2016 classification 32nd General Annual Meeting of the Belgian Hematology Society 10-11 February 2017 Gregor Verhoef, Departement of Hematology, University Hospital
More informationOverview. Methods 9/11/2017. Next Generation Sequencing and Precision Medicine in Hematological Malignancies. Genotyping in hematology
Overview Next Generation Sequencing and Precision Medicine in Hematological Malignancies Sharathkumar Bhagavathi, MD University of Iowa Carver College of Medicine NGS as a genotyping platform in hematopathology
More informationExamining Genetics and Genomics of Acute Myeloid Leukemia in 2017
Examining Genetics and Genomics of Acute Myeloid Leukemia in 2017 Elli Papaemmanuil, PhD Memorial Sloan Kettering Cancer Center New York, New York, United States Today s Talk Cancer genome introduction
More informationNeoTYPE Cancer Profiles
NeoTYPE Cancer Profiles Multimethod Analysis of 25+ Hematologic Diseases and Solid Tumors Anatomic Pathology FISH Molecular The next generation of diagnostic, prognostic, and therapeutic assessment NeoTYPE
More informationDISCLOSURE Luca Malcovati, MD. No financial relationships to disclose
ICUS, CCUS and CHIP Luca Malcovati, MD Department of Molecular Medicine, University of Pavia Medical School, & Department of Hematology Oncology, IRCCS Policlinico S. Matteo Foundation, Pavia, Italy DISCLOSURE
More informationLaboratory Service Report
Specimen Type Peripheral blood CR PDF Report available at: https://test.mmlaccess.com/reports/c7028846-ih2xuglwpq.ashx Indication for Test DS CR Pathogenic utations Detected CR 1. JAK2: c.1849g>t;p.val617phe
More informationMutational Impact on Diagnostic and Prognostic Evaluation of MDS
Mutational Impact on Diagnostic and Prognostic Evaluation of MDS Elsa Bernard, PhD Papaemmanuil Lab, Computational Oncology, MSKCC MDS Foundation ASH 2018 Symposium Disclosure Research funds provided by
More informationULTRA-DEEP SEQUENCING OF THE BCR-ABL KINASE DOMAIN FOR BETTER THERAPEUTIC TAILORING OF PHILADELPHIA CHROMOSOME-POSITIVE LEUKEMIA PATIENTS
ULTRA-DEEP SEQUENCING OF THE BCR-ABL KINASE DOMAIN FOR BETTER THERAPEUTIC TAILORING OF PHILADELPHIA CHROMOSOME-POSITIVE LEUKEMIA PATIENTS Simona Soverini, PhD Department of Experimental, Diagnostic and
More informationADRL Advanced Diagnostics Research Laboratory
ADRL Advanced Diagnostics Research Laboratory John DeCoteau, MD FRCP Department of Pathology, Division of Hematopathology University of Saskatchewan Saskatchewan Cancer Agency ADRL Project Objectives New
More informationOut-Patient Billing CPT Codes
Out-Patient Billing CPT Codes Updated Date: August 3, 08 Client Billed Molecular Tests HPV DNA Tissue Testing 8764 No Medicare Billed - Molecular Tests NeoARRAY NeoARRAY SNP/Cytogenetic No 89 NeoLAB NeoLAB
More informationLaboratory Service Report
Client C7028846-DLP Rochester Rochester, N 55901 Specimen Type Peripheral blood CR PDF Report available at: https://test.mmlaccess.com/reports/c7028846-zwselwql7p.ashx Indication for Test DS CR Pathogenic
More informationJuan Ma 1, Jennifer Dunlap 2, Lisong Shen 1, Guang Fan 2 1
Juan Ma 1, Jennifer Dunlap 2, Lisong Shen 1, Guang Fan 2 1 Xin Hua Hospital, Shanghai, China 2 Oregon Health & Science University, Portland, OR, United States AML is a hematopoietic neoplasms characterized
More informationPublished Ahead of Print on June 22, 2017, as doi: /haematol Copyright 2017 Ferrata Storti Foundation.
Published Ahead of Print on June 22, 2017, as doi:10.3324/haematol.2017.166173. Copyright 2017 Ferrata Storti Foundation. Molecular analysis of myelodysplastic syndrome with isolated del(5q) reveals a
More informationManagement of Myelodysplastic Syndromes
Management of Myelodysplastic Syndromes Peter L. Greenberg, MD Stanford Cancer Institute Myelodysplastic Syndromes: Clinical & Molecular Advances for Disease Classification and Prognostication MDSs: A
More informationMolecular. Oncology & Pathology. Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine. Liquid Biopsy.
Molecular Oncology & Pathology Hereditary Cancer Somatic Cancer Liquid Biopsy Next-Gen Sequencing qpcr Sanger Sequencing Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine
More informationAcute leukemia and myelodysplastic syndromes
11/01/2012 Post-ASH meeting 1 Acute leukemia and myelodysplastic syndromes Peter Vandenberghe Centrum Menselijke Erfelijkheid & Afdeling Hematologie, UZ Leuven 11/01/2012 Post-ASH meeting 2 1. Acute myeloid
More informationMolecular Advances in Hematopathology
Molecular Advances in Hematopathology HOW MOLECULAR METHODS HAVE CHANGED MY PRACTICE Objectives Understand the importance of cytogenetic/molecular studies in hematolymphoid diseases Know some of the important
More informationNeoTYPE Cancer Profiles
NeoTYPE Cancer Profiles 30+ Multimethod Assays for Hematologic Diseases and Solid Tumors Molecular FISH Anatomic Pathology The next generation of diagnostic, prognostic, and therapeutic assessment What
More informationSUPPLEMENTARY INFORMATION
Supplementary Information S1 Frequency of DNMT3A mutations in hematologic disorders and their associated clinical phenotypes. Disease Patient population Frequency (%) Associated Clinical Characteristics
More informationPatricia Aoun MD, MPH Professor and Vice-Chair for Clinical Affairs Medical Director, Clinical Laboratories Department of Pathology City of Hope
Patricia Aoun MD, MPH Professor and Vice-Chair for Clinical Affairs Medical Director, Clinical Laboratories Department of Pathology City of Hope National Medical Center Disclosures I have no disclosures
More informationMyelodysplastic syndromes
Myelodysplastic syndromes Robert P Hasserjian Massachusetts General Hospital, Boston, MA Disclosure of Relevant Financial Relationships Dr. Hasserjian declares he has no conflict(s) of interest to disclose.
More informationMyelodysplastic syndromes Impact of Biology. Lionel Adès Hopital Saint Louis Groupe Francophone des SMD. Épidémiologie
Myelodysplastic syndromes Impact of Biology Lionel Adès Hopital Saint Louis Groupe Francophone des SMD Épidémiologie Incidence : 3 à 6 / 100 000 hab. / An Prédomine chez les sujets âgés Augmentation de
More informationPrecision Medicine and Molecular Testing.
Precision Medicine and Molecular Testing. David A. Sallman, MD Assistant Member Department of Malignant Hematology Moffitt Cancer Center david.sallman@moffitt.org Disclosures Research funding for Celgene
More informationNew drugs in Acute Leukemia. Cristina Papayannidis, MD, PhD University of Bologna
New drugs in Acute Leukemia Cristina Papayannidis, MD, PhD University of Bologna Challenges to targeted therapy in AML Multiple subtypes based upon mutations/cytogenetic aberrations No known uniform genomic
More informationNovità nelle MDS. Matteo G Della Porta. Cancer Center IRCCS Humanitas Research Hospital & Humanitas University Rozzano Milano, Italy
Novità nelle MDS Matteo G Della Porta Cancer Center IRCCS Humanitas Research Hospital & Humanitas University Rozzano Milano, Italy matteo.della_porta@hunimed.eu Outline ARCH Predictive value of somatic
More informationAugust 17, Dear Valued Client:
August 7, 08 Re: CMS Announces 6-Month Period of Enforcement Discretion for Laboratory Date of Service Exception Policy Under the Medicare Clinical Laboratory Fee Schedule (the 4 Day Rule ) Dear Valued
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationACCME/Disclosures. History. Hematopathology Specialty Conference Case #4 4/13/2016
Hematopathology Specialty Conference Case #4 Sherrie L. Perkins MD, PhD University of Utah ACCME/Disclosures The USCAP requires that anyone in a position to influence or control the content of CME disclose
More informationWest Midlands Regional Genetics Laboratory
West Midlands Regional Genetics Laboratory Haemato-oncology service update letter October 2017 Dear colleagues, We are writing to outline the latest developments to our service, aiming to support the management
More informationMyelodysplastic Syndromes. Post-ASH meeting 2014 Marie-Christiane Vekemans
Myelodysplastic Syndromes Post-ASH meeting 2014 Marie-Christiane Vekemans Agenda New biological developments Risk assessment and prognostic factors New therapeutic options Agenda New biological developments
More informationOpportunities for Optimal Testing in the Myeloproliferative Neoplasms. Curtis A. Hanson, MD
Opportunities for Optimal Testing in the Myeloproliferative Neoplasms Curtis A. Hanson, MD 2013 MFMER slide-1 DISCLOSURES: Relevant Financial Relationship(s) None Off Label Usage None 2013 MFMER slide-2
More informationEnhancing Assessment of Myeloid Disorders in the Era of Precision Medicine
Enhancing Assessment of Myeloid Disorders in the Era of Precision Medicine Michelle Afkhami, M.D. Medical Director, Clinical Molecular Diagnostic Laboratory City of Hope National Medical Center Objectives
More informationPublished Ahead of Print on April 14, 2016, as doi: /haematol Copyright 2016 Ferrata Storti Foundation.
Published Ahead of Print on April 14, 2016, as doi:10.3324/haematol.2016.143214. Copyright 2016 Ferrata Storti Foundation. Immunohistochemical pattern of p53 is a measure of TP53 mutation burden and adverse
More informationSupplementary Figure 1
Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the
More informationMyelodysplastic syndrome is a highly heterogeneous hematopoietic
SHORT COMMUNICATION Clinical Characteristics and Prognosis of 48 Patients with Mutations in Myelodysplastic Syndrome Yulu Tian #, Ruijuan Zhang #, Linhua Yang* Yang L. Clinical Characteristics and Prognosis
More informationSESSION 1 Reactive cytopenia and dysplasia
SESSION 1 Reactive cytopenia and dysplasia Falko Fend, Tübingen & Alexandar Tzankov, Basel 1 Disclosure of speaker s interests (Potential) conflict of interest none Potentially relevant company relationships
More informationCBL and EZH2 as new molecular markers in MPN
CBL and EZH2 as new molecular markers in MPN Andy Chase University of Southampton and Wessex Regional Genetics Laboratory Salisbury, UK Munich 2011 * Myeloproliferative neoplasms MDS/MPN Myelodysplastic
More informationBlastic Plasmacytoid Dendritic Cell Neoplasm with DNMT3A and TET2 mutations (SH )
Blastic Plasmacytoid Dendritic Cell Neoplasm with DNMT3A and TET2 mutations (SH2017-0314) Habibe Kurt, Joseph D. Khoury, Carlos E. Bueso-Ramos, Jeffrey L. Jorgensen, Guilin Tang, L. Jeffrey Medeiros, and
More informationGenomic Medicine: What every pathologist needs to know
Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and
More informationEnhancing Assessment of Myeloid Leukemia in the Era of Precision Medicine
Enhancing Assessment of Myeloid Leukemia in the Era of Precision Medicine Michelle Afkhami, M.D. Medical Director, Clinical Molecular Diagnostic Laboratory City of Hope National Medical Center How the
More informationASBMT MDS/MPN Update Sunil Abhyankar, MD
ASBMT MDS/MPN Update Sunil Abhyankar, MD Professor of Medicine Medical Director, Pheresis and Cell Processing Division of Hematologic Malignancies and Cellular Therapeutics Department of Internal Medicine
More informationAcute Myeloid Leukemia with RUNX1 and Several Co-mutations
Case SH2017-0281 Acute Myeloid Leukemia with RUNX1 and Several Co-mutations James Bauer, MD, PhD David Yang, MD Erik Ranheim, MD, PhD Catherine Leith, MB, Bchir Clinical History Chief Complaint: 72 year
More informationAPPROACH TO MYELODYSPLASTIC SYNDROMES IN THE ERA OF PRECISION MEDICINE
APPROACH TO MYELODYSPLASTIC SYNDROMES IN THE ERA OF PRECISION MEDICINE Rashmi Kanagal-Shamanna, MD Assistant Professor Hematopathology & Molecular Diagnostics Department of Hematopathology The University
More informationEnhancing Assessment of Myeloid Leukemia in the Era of Precision Medicine
Enhancing Assessment of Myeloid Leukemia in the Era of Precision Medicine Michelle Afkhami, M.D. Medical Director, Clinical Molecular Diagnostic Laboratory City of Hope National Medical Center How the
More informationPathogenesis and management of CMML
Pathogenesis and management of CMML Raphaël Itzykson, Hôpital Saint-Louis, Paris International Conference of the Korean Society of Hematology March 29th 2018 대한혈액학회 Korean Society of Hematology COI disclosure
More informationClonal Cytopenia and Myeloid Neoplasms
Clonal Cytopenia and Myeloid Neoplasms Luca Malcovati, MD Department of Molecular Medicine, University of Pavia Medical School, & Department of Hematology Oncology, IRCCS Policlinico S. Matteo Foundation,
More informationSession 4: Summary and Conclusions
Session 4: Summary and Conclusions Total cases in Session 4 Myeloproliferative neoplasms 16 cases Oral #300 (CEL, NOS) Mastocytosis 2 cases Oral #156 (SM-AHN) Myeloid/lymphoid neoplasms with eosinophilia
More informationTargeted NGS in oncology and hemato-oncology using in-house designed gene panels. Joni Van der Meulen Molecular Diagnostics UZ Ghent (MDG) 24/03/2017
Targeted NGS in oncology and hemato-oncology using in-house designed gene panels Joni Van der Meulen Molecular Diagnostics UZ Ghent (MDG) 24/03/2017 MDG = Molecular Diagnostics UZ Ghent Center for Medical
More informationBCR-ABL1 Kinase Domain Mutation Status (including educational clinical scenario)
BCR-ABL1 Kinase Domain Mutation Status 171802 (including educational clinical scenario) Issue date: 23rd February 2018 Closing date: 23rd March 2018 Results for the BCR-ABL1 Kinase Domain Mutation Status
More informationPeking University People's Hospital, Peking University Institute of Hematology
Qian Jiang, M.D. Peking University People's Hospital, Peking University Institute of Hematology No. 11 Xizhimen South Street, Beijing, 100044, China. Phone number: 86-10-66583802 Mobile: 86-13611115100
More informationBeyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure
Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure I am receiving an honorarium from Sysmex for today s presentation. 1 Determining the Etiology for
More informationShould Mutational Status in Primary Myelofibrosis (PMF) Guide Therapy..YES!!!
Should Mutational Status in Primary Myelofibrosis (PMF) Guide Therapy..YES!!! Lindsay Anne Magura Rein, MD Division of Hematologic Malignancies and Cellular Therapy/BMT A Little Bit of History.. 1665 Advanced
More information[COMPREHENSIVE GENETIC ASSAY PANEL ON
2014 SN GENELAB AND RESEARCH CENTER DR. SALIL VANIAWALA, PH.D [COMPREHENSIVE GENETIC ASSAY PANEL ON MYELOPROLIFERATIVE NEOPLASMS] SN Genelab presents one of the most comprehensive genetic assay panel for
More informationNEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca
NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA
More informationCost-Effective Strategies in the Workup of Hematologic Neoplasm. Karl S. Theil, Claudiu V. Cotta Cleveland Clinic
Cost-Effective Strategies in the Workup of Hematologic Neoplasm Karl S. Theil, Claudiu V. Cotta Cleveland Clinic In the past 12 months, we have not had a significant financial interest or other relationship
More informationMolecular Genetic Testing to Predict Response to Therapy in MDS
Molecular Genetic Testing to Predict Response to Therapy in MDS Rafael Bejar MD, PhD Bone Marrow Failure Disease Scientific Symposium Rockville, MD March 18 th, 2016 Overview Response Criteria Lenalidomide
More informationThe Challenges of Precision Medicine: New Advances in Molecular Diagnostic Testing- Impact for Healthcare
The Challenges of Precision Medicine: New Advances in Molecular Diagnostic Testing- Impact for Healthcare Jessica Wang-Rodriguez, MD Chief, VISN22 Consolidated Pathology and Laboratory Medicine Services
More information7/12/2016 TESTING. Objectives. New Directions in Aplastic Anemia: What's on the Horizon? Better way to evaluate clonal evolution?
New Directions in Aplastic Anemia: What's on the Horizon? Amy E. DeZern, MD; MHS Assistant Professor Hematologic Malignancies Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins Baltimore, MD Objectives
More informationCurrent Techniques in Molecular Biology Friedel Nollet, Ph.D.
Current Techniques in Molecular Biology Friedel Nollet, Ph.D. Molecular Biology and Cytometry course May 16-17, 2013 Mol, SCK-CEN, Belgium Sanger DNA sequencing Kary Mullis received a Nobel Prize in chemistry
More informationTreatment of low risk MDS
Treatment of low risk MDS Matteo G Della Porta Cancer Center IRCCS Humanitas Research Hospital & Humanitas University Rozzano Milano, Italy matteo.della_porta@hunimed.eu International Prognostic Scoring
More informationObjectives and Financial Disclosure
Enhancing Assessment of Leukemia and Lymphoma with Next Generation Sequencing Michelle Afkhami, M.D. Medical Director, Clinical Molecular Laboratory Assistant Professor, Department of Pathology City of
More informationObjectives DISCLOSURES. Next-Generation Sequencing (NGS) Testing for Hematologic Malignancies
Next-Generation Sequencing (NGS) Testing for Hematologic Malignancies David Viswanatha, M.D. Division of Hematopathology Mayo Clinic, Rochester, Minnesota 2017 MFMER slide-1 DISCLOSURES Relevant Financial
More informationDeep-Sequencing of HIV-1
Deep-Sequencing of HIV-1 The quest for true variants Alexander Thielen, Martin Däumer 09.05.2015 Limitations of drug resistance testing by standard-sequencing Blood plasma RNA extraction RNA Reverse Transcription/
More informationFluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
More informationMyelodysplastic syndromes: revised WHO classification and distinction from non-neoplastic conditions
Myelodysplastic syndromes: revised WHO classification and distinction from non-neoplastic conditions Robert P Hasserjian, MD Associate Professor Massachusetts General Hospital and Harvard Medical School
More informationTEST MENU TEST CPT CODES TAT. Chromosome Analysis Bone Marrow x 2, 88264, x 3, Days
TEST MENU CANCER/LEUKEMIA CHROMOSOME ANALYSIS Chromosome Analysis Bone Marrow 88237 x 2, 88264, 88280 x 3, 88291 4 Days Chromosome Analysis Bone Marrow Core 88237 x 2, 88264, 88280 x 3, 88291 4 Days Chromosome
More informationObjectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013
Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie
More informationCML Treatment Failure: More Threatening Than It Appears. Mutation Testing
CML Treatment Failure: More Threatening Than It Appears Mutation Testing Content Mutations and treatment failure Single mutations Compound mutations Mutation testing Guideline recommendations Summary 2
More informationMolecular Markers in Acute Leukemia. Dr Muhd Zanapiah Zakaria Hospital Ampang
Molecular Markers in Acute Leukemia Dr Muhd Zanapiah Zakaria Hospital Ampang Molecular Markers Useful at diagnosis Classify groups and prognosis Development of more specific therapies Application of risk-adjusted
More informationImportance of minor TP53 mutated clones in the clinic
Importance of minor TP53 mutated clones in the clinic Davide Rossi, M.D., Ph.D. Hematology IOSI - Oncology Institute of Southern Switzerland IOR - Institute of Oncology Reserach Bellinzona - Switzerland
More informationMYELODYSPLASTIC SYNDROMES: A diagnosis often missed
MYELODYSPLASTIC SYNDROMES: A diagnosis often missed D R. EMMA W YPKEMA C O N S U LTA N T H A E M AT O L O G I S T L A N C E T L A B O R AT O R I E S THE MYELODYSPLASTIC SYNDROMES DEFINITION The Myelodysplastic
More informationKevin Kelly, MD, Phd Acute Myeloid and Lymphoid Leukemias
Kevin Kelly, MD, Phd Acute Myeloid and Lymphoid Leukemias Relevant financial relationships in the past twelve months by presenter or spouse/partner. Speakers bureau: Novartis, Janssen, Gilead, Bayer The
More informationDisclosure: Objectives/Outline. Leukemia: Genealogy of Pathology Practice: Old Diseases New Expectations. Nothing to disclose.
RC1 Leukemia: Genealogy of Pathology Practice: Old Diseases New Expectations RC2 Disclosure: Nothing to disclose Henry Moon Lecture: UCSF Annual Conference Kathryn Foucar, MD kfoucar@salud.unm.edu May
More informationMyelodysplastic Syndromes:
Incidence Rate per 100,000 7/21/2015 Myelodysplastic Syndromes: Current Thinking on the Disease, Diagnosis and Treatment Rafael Bejar MD, PhD Aplastic Anemia & MDS International Foundation Regional Patient
More informationAcute Myeloid Leukemia Progress at last
Acute Myeloid Leukemia Progress at last Bruno C. Medeiros, MD September 9, 217 Introduction Mechanisms of leukemogenesis Emerging therapies in AML Previously untreated AML Relapsed and refractory patients
More informationThe Evolving Role of Transplantation for MPN
The Evolving Role of Transplantation for MPN (PMF, PV, ET) H.Joachim Deeg MD Fred Hutchinson Cancer Research Center, University of Washington, Seattle WA, SCCA jdeeg@fhcrc.org 10 th J. Niblack Conference
More informationMRD in CML (BCR-ABL1)
MRD in CML (BCR-ABL1) Moleculaire Biologie en Cytometrie cursus Barbara Denys LAbo Hematologie UZ Gent 6 mei 2011 2008 Universitair Ziekenhuis Gent 1 Myeloproliferative Neoplasms o WHO classification 2008:
More informationTargeted Molecular Diagnostics for Targeted Therapies in Hematological Disorders
Targeted Molecular Diagnostics for Targeted Therapies in Hematological Disorders Richard D. Press, MD, PhD Dept of Pathology Knight Cancer Institute Knight Diagnostic Labs Oregon Health & Science University
More informationPediatric Oncology & Pathology Services
Pediatric Oncology & Pathology Services Anatomic Pathology Flow Cytometry Cytogenetics Pharma Services Diagnostic, Prognostic, Predictive, and Predisposition Testing Pediatric Oncology & Pathology Services
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Patel JP, Gönen M, Figueroa ME, et al. Prognostic relevance
More informationClonal Evolution of saml. Johnnie J. Orozco Hematology Fellows Conference May 11, 2012
Clonal Evolution of saml Johnnie J. Orozco Hematology Fellows Conference May 11, 2012 CML: *bcr-abl and imatinib Melanoma: *braf and vemurafenib CRC: *k-ras and cetuximab Esophageal/Gastric: *Her-2/neu
More informationThe MILE study: Expression microarray analysis for diagnosis of leukaemia. Ken Mills CCRCB Queen s University Belfast
The MILE study: Expression microarray analysis for diagnosis of leukaemia Ken Mills CCRCB Queen s University Belfast Outline MILE Prephase Stage I Stage II Implementation MDS Diagnosis into Prognosis Leukaemia
More informationThe preclinical efficacy of a novel telomerase inhibitor, imetelstat, in AML: A randomized trial in patient-derived xenografts
The preclinical efficacy of a novel telomerase inhibitor, imetelstat, in AML: A randomized trial in patient-derived xenografts Claudia Bruedigam, Ph.D Gordon and Jessie Gilmour Leukaemia Research Laboratory
More informationChronic Myelomonocytic Leukemia with molecular abnormalities SH
Chronic Myelomonocytic Leukemia with molecular abnormalities SH2017-0351 Madhu P. Menon MD,PhD, Juan Gomez MD, Kedar V. Inamdar MD,PhD and Kristin Karner MD Madhu P Menon, MD, PhD Henry Ford Hospital Patient
More informationMyelodysplastic syndromes: 2018 update on diagnosis, risk-stratification and management
Received: 2 October 2017 Accepted: 2 October 2017 DOI: 10.1002/ajh.24930 ANNUAL CLINICAL UPDATES IN HEMATOLOGICAL MALIGNANCIES Myelodysplastic syndromes: 2018 update on diagnosis, risk-stratification and
More informationMolecular Genetic Testing for the Diagnosis of Haematological Malignancies
Molecular Genetic Testing for the Diagnosis of Haematological Malignancies Dr Anthony Bench Haemto-Oncology Diagnostic Service Cambrıdge Unıversıty Hospitals NHS Foundatıon Trust Cambridge UK Molecular
More informationLeukemia and subsequent solid tumors among patients with myeloproliferative neoplasms
Leukemia and subsequent solid tumors among patients with myeloproliferative neoplasms Tiziano Barbui (tbarbui@asst-pg23.it Hematology and Research Foundation,Ospedale Papa Giovanni XXIII, Bergamo Italy
More informationGenetic complexity in MPN, MDS/MPN and MDS
Genetic complexity in MPN, MDS/MPN and MDS Nick Cross Wessex Regional Genetics Laboratory, Salisbury Faculty of Medicine, University of Southampton Genetic complexity in chronic myeloid neoplasms Classes
More informationIntegrated Diagnostic Approach to the Classification of Myeloid Neoplasms. Daniel A. Arber, MD Stanford University
Integrated Diagnostic Approach to the Classification of Myeloid Neoplasms Daniel A. Arber, MD Stanford University What is an integrated approach? What is an integrated approach? Incorporating all diagnostic
More information