A clinical study may be an option after pancreatic cancer surgery. Ask if a clinical study is an option for you

Size: px
Start display at page:

Download "A clinical study may be an option after pancreatic cancer surgery. Ask if a clinical study is an option for you"

Transcription

1 A clinical study may be an option after pancreatic cancer surgery Ask if a clinical study is an option for you

2 What s inside? This brochure will help you learn about a clinical study called APACT. APACT stands for Adjuvant Pancreatic Adenocarcinoma Clinical Trial. The APACT study is open only to people whose pancreatic cancer has been removed with surgery. Is the APACT study right for me? Why might my doctor suggest more treatment after surgery? If you have early stage pancreatic cancer, surgery to try to remove or resect (ree-sekt) the whole tumor is an important step in your treatment plan. After you recover from surgery your doctor may offer additional treatment, called adjuvant therapy (A-joovunt THAYR-uh-pee). Adjuvant chemotherapy (kee-moh-thayr-uh-pee) uses medicines to try and kill any cancer cells that may remain in the body after surgery. A clinical study (or clinical trial) looks at potential new ways to treat disease or improve health. The goal of a clinical trial is to learn if a medicine works and is safe in certain people by studying those people under carefully managed conditions. People often think of clinical studies as a last resort. But joining a clinical study right after your tumor has been removed can be an important option to discuss with your doctor. A clinical study is one way to continue your cancer treatment after surgery. More treatment may be given after pancreatic surgery to try to keep the cancer from coming back. The APACT study aims to compare 2 therapies for people whose pancreatic cancer has been removed with surgery. A good time to talk to your doctor about adjuvant therapy is before you have your surgery. Ask your doctor to keep a sample of the tumor removed during your surgery for later use. Go to page 9 to learn why tumor samples are important. Clinical studies help doctors learn how therapies work. But it is not possible to know if the study therapy will work for you. 2 3

3 What is the APACT study? APACT is a worldwide clinical study for people with resectable pancreatic cancer. The APACT study is sponsored by Celgene. What is the goal of APACT? The APACT study compares 2 therapies for people whose pancreatic cancer has recently been removed: A chemotherapy called gemcitabine (jem-cy-tuh-been) Gemcitabine combined with another chemotherapy called nab -paclitaxel (nab-pak-li-tak-sel) nab-paclitaxel has not been approved for the treatment of pancreatic cancer after surgical resection. Its use in this study is investigational (in-ves-tih-gay-shuh-nul). The goal is to learn whether the combination therapy works better than the standard therapy or gemcitabine alone. In each group, researchers will be measuring How long people live without the cancer coming back How long people survive overall How safe it is to take the combination therapy Ask your doctor if joining the APACT study may be an option for you. Who can take part in the APACT study? You may be able to join the study if you Are 18 years of age or older Although there are no drugs currently FDA approved to treat pancreatic cancer after surgery, gemcitabine is a preferred drug that many doctors use. Now gemcitabine and nab-paclitaxel will be studied for use as adjuvant therapy. Have had, or will be having, surgery to remove a pancreatic tumor Can start treatment no later than 12 weeks after you have had a complete resection, or successful removal of your pancreatic cancer nab is a registered trademark of 4 Celgene Corporation. 5

4 How will the APACT study work? About 800 people who had surgery to remove their pancreatic tumors will be enrolled in APACT. Patients will be placed by chance into 1 of 2 groups. Each group will get a different treatment. Group 1 nab-paclitaxel + gemcitabine Group 2 gemcitabine You will have an equal chance of getting either of the 2 treatments. You and your doctor will know which treatment you are getting. How often are the treatments given? You will get weekly treatments for 3 weeks in a row, followed by 1 week of rest. This 4-week period is 1 treatment cycle. MON TUE WED THUR FRI SAT SUN Treatment Rest You have surgery You are screened to see if you meet the study requirements You are placed by chance into 1 of 2 treatment groups Group 1 nab-paclitaxel + gemcitabine Group 2 gemcitabine Study team follows up Samples of your pancreatic tumor tissue will be saved. If you qualify for the study, you will be asked to give your informed consent before you join (see page 10). The study team will draw blood and request tissue samples from your surgeon. Treatment should start within 12 weeks after your surgery. You will get up to 6 cycles of treatment in all, depending on how well you tolerate the therapy. You or your doctor may choose to stop treatment at any time for any reason. This stage will last for up to 5 years. Your healthcare team will check up on you about every 3 months. 6 7

5 What should I expect during the APACT study? Along with providing your treatment, your healthcare team will Ask you to come in for regular checkups and blood tests Why are my tissue samples important? The APACT team will study the samples of tumor and normal tissue taken during your surgery. Working with tissue samples can help researchers learn who will respond to adjuvant pancreatic cancer treatment and why. Do periodic scans to see if your cancer returns Test your blood and tissue samples for their research They will also answer your questions, check how well you are managing with daily activities, and monitor you for any side effects you may have. Studying your tissue samples may help improve the diagnosis and treatment of pancreatic cancer in the future. The medicines used in APACT may affect normal cells along with cancer cells. This can cause side effects. Talk to your doctor about what side effects you may have. What costs are covered during the study? The study medicines and tests will be provided at no cost to you. Your health plan may cover costs for your routine medical care. You will not be paid for being in the study, but local laws may allow you to be paid back for travel expenses to and from the study center. Check with your insurer and your doctor about any costs related to the study. 8 9

6 What are some possible benefits of joining the APACT study? You will get adjuvant treatment that may help keep your cancer from coming back. However, it is never certain that the study therapy will work for you. Both study groups will receive active treatment. The study is designed to show how well the study drugs work for people whose pancreatic cancer has been removed with surgery. You will be part of a community of people helping to advance pancreatic cancer treatment. You will be taking an active role in your own care and may help to improve treatment for others. Before you join the study, you must give your informed consent. This means that you understand the possible benefits and risks of the study and agree to take part. Speak to your doctor about the possible benefits and risks of joining the APACT study. What are some possible risks of joining the APACT study? As in all clinical studies, the study treatment you receive may not work for you. The study medicines may not work as well for you as other available adjuvant therapies. Because chemotherapy can affect normal cells as well as cancer cells, you may have side effects from the study medicines

7 The APACT clinical study is now enrolling patients after pancreatic surgery Learn more about the APACT study Call Visit Contact the study coordinator at the site listed below. Contact information: 2014 Celgene Corporation. 08/14

Keeping your diabetes support as mobile as you are,

Keeping your diabetes support as mobile as you are, Millions of people have diabetes. But we at Novo Nordisk know that managing diabetes is a personal journey. That is why we created the e-book Your guide to better office visits, with valuable insights

More information

LUNG CANCER CLINICAL TRIALS

LUNG CANCER CLINICAL TRIALS UNDERSTANDING SERIES LUNG CANCER CLINICAL TRIALS 1-800-298-2436 LungCancerAlliance.org A GUIDE FOR THE PATIENT THE BASICS ABOUT CLINICAL TRIALS WITH MORE INFORMATION YOU CAN MAKE BETTER CHOICES. The decision

More information

For People With Diabetes. Blood Sugar Diary. SCAN Health Plan

For People With Diabetes. Blood Sugar Diary. SCAN Health Plan For People With Diabetes Blood Sugar Diary SCAN Health Plan 78 A Circle of Help to Live a Healthy Life You are the center of a healthy life with diabetes. All the elements of good care begin and end with

More information

Taking Part in Cancer Treatment Research Studies

Taking Part in Cancer Treatment Research Studies Taking Part in Cancer Treatment Research Studies U.S. Department of Health & Human Services National Institutes of Health Taking Part in Cancer Treatment Research Studies If you have cancer, you may want

More information

UNDERSTANDING SQUAMOUS CELL LUNG CANCER

UNDERSTANDING SQUAMOUS CELL LUNG CANCER UNDERSTANDING SQUAMOUS CELL LUNG CANCER A guide for patients and caregivers FREE TO BREATHE SUPPORT LINE (844) 835-4325 A FREE resource for lung cancer patients & caregivers About this brochure This brochure

More information

Coach on Call. Thank you for your interest in Being Active and F.I.T.T. I hope you find this tip sheet helpful.

Coach on Call. Thank you for your interest in Being Active and F.I.T.T. I hope you find this tip sheet helpful. Coach on Call It was great to talk with you. Thank you for your interest in I hope you find this tip sheet helpful. Please call me if you have more questions about this or other topics. As your UPMC Health

More information

Understanding Clinical Trials

Understanding Clinical Trials Understanding Clinical Trials Together, we can change the course of the HIV epidemic one woman at a time. #onewomanatatime #thewellproject What Are Clinical Trials? Clinical trial: Describes many different

More information

Person to person spread Ken Eames, Adam Kucharski, Jenny Gage

Person to person spread Ken Eames, Adam Kucharski, Jenny Gage Modelling the spread of disease Microbes Viruses Bacteria Person to person spread Ken Eames, Adam Kucharski, Jenny Gage Microbes Viruses Bacteria Worms The swine flu pandemic Worms We also share microbes

More information

Logbook Dates FROM TO

Logbook Dates FROM TO LOGBOOK Logbook Dates FROM TO Contact Details NAME ADDRESS CITY STATE / POSTCODE PHONE DOCTOR S NAME DOCTOR S PHONE DOCTOR S EMAIL DIABETES EDUCATOR S NAME DIABETES EDUCATOR S PHONE DIABETES EDUCATOR S

More information

Patient Education. intermountainhealthcare.org/diabetes. BG Tracker. for people with diabetes MONITORING BLOOD GLUCOSE

Patient Education. intermountainhealthcare.org/diabetes. BG Tracker. for people with diabetes MONITORING BLOOD GLUCOSE Patient Education intermountainhealthcare.org/diabetes Tracker for people with diabetes MONITORING BLOOD GLUCOSE Title Case My name/phone: Contact numbers: Healthcare provider: Diabetes educator: Pharmacy:

More information

Team Progress Updates. SU2C Pancreatic Dream Team: Cutting Off the Fuel Supply: A New Approach in the Treatment of Pancreatic Cancer

Team Progress Updates. SU2C Pancreatic Dream Team: Cutting Off the Fuel Supply: A New Approach in the Treatment of Pancreatic Cancer SU2C Pancreatic Dream Team: Cutting Off the Fuel Supply: A New Approach in the Treatment of Pancreatic Cancer Cancer of the pancreas is one of the deadliest forms of cancer, with a five-year survival rate

More information

A GUIDE TO STARTING TREATMENT

A GUIDE TO STARTING TREATMENT A GUIDE TO STARTING TREATMENT Please see accompanying and Medication Guide. full Prescribing IDHIFA (enasidenib) is a prescription medicine used to treat people with acute myeloid leukemia (AML) with an

More information

Tip the Calorie Balance

Tip the Calorie Balance : Tip the Calorie Balance The Program involves 2 lifestyle changes: 1. Healthy eating. This includes eating less fat and more whole grains, fruits, and vegetables. 2. Being active. Both relate to weight

More information

PRECONCEPTION COUNSELING

PRECONCEPTION COUNSELING PRECONCEPTION COUNSELING A Counseling Guide for Healthcare Providers Preconception Care & Counseling 1 Introduction Pregnancy planning and preconception care are important in order to: 1. Ensure maternal

More information

My Whole Health Tracker

My Whole Health Tracker My Whole Health Tracker This Whole Health Tracker belongs to: Name: I started my whole health resiliency plan on: Date: My whole health and resiliency goal is: My support network: Name: Phone: Email: Other

More information

Deep Vein Thrombosis or Pulmonary Embolism

Deep Vein Thrombosis or Pulmonary Embolism What You Need to Know After Deep Vein Thrombosis or Pulmonary Embolism The content provided here is for informational purposes only. It is not intended to diagnose or treat a health problem or disease,

More information

YOUR GUIDE TO PATIENT SUPPORT SERVICES

YOUR GUIDE TO PATIENT SUPPORT SERVICES YOUR GUIDE TO PATIENT SUPPORT SERVICES Please see Important Safety Information About ONIVYDE (irinotecan liposome injection) on pages 6 7. WHAT IS PROVYDE (ONIVYDE ACCESS SERVICES)? PROVYDE is a team of

More information

What You Need to Know About ARZERRA (ofatumumab)

What You Need to Know About ARZERRA (ofatumumab) Starting your treatment for chronic lymphocytic leukemia (CLL) What You Need to Know About ARZERRA (ofatumumab) Approved Use ARZERRA is a prescription medication used: With a chemotherapy drug called chlorambucil

More information

Pancreatic Cancer: Medical Therapeutic Approaches

Pancreatic Cancer: Medical Therapeutic Approaches Pancreatic Cancer: Medical Therapeutic Approaches Vincent J Picozzi MD MMM Virginia Mason Medical Center Seattle WA 1 Pancreatic cancer is the hardest cancer of all to treat Pancreatic cancer: Why so difficult

More information

NEW YORK STATE PEF RETIREES DENTAL PROGRAM. Dental insurance from Sun Life RETIREES

NEW YORK STATE PEF RETIREES DENTAL PROGRAM. Dental insurance from Sun Life RETIREES NEW YORK STATE PEF RETIREES DENTAL PROGRAM Dental insurance from Sun Life RETIREES Smile brighter knowing that you re protecting your teeth with affordable dental care. * Dental insurance can help lower

More information

treatment calendar Hilde D. EMPLICITI patient Looking forward to what s ahead

treatment calendar Hilde D. EMPLICITI patient Looking forward to what s ahead treatment calendar Hilde. MPLICITI patient Looking forward to what s ahead The story behind the selfie: Hilde Hilde. MPLICITI patient njoying custard at our favorite shop My family is really important

More information

See Important Reminder at the end of this policy for important regulatory and legal information.

See Important Reminder at the end of this policy for important regulatory and legal information. Clinical Policy: (Abraxane) Reference Number: CP.PHAR.176 Effective Date: 07.01.15 Last Review Date: 05.18 Line of Business: HIM, Medicaid Coding Implications Revision Log See Important Reminder at the

More information

Faculty of Business and Information Technology Timetable 2018

Faculty of Business and Information Technology Timetable 2018 Business Diplomas Faculty of Business and Information Technology Timetable 2018 Q1 Quarter 1 Q2 Quarter 2 Q3 Quarter 3 Q4 Quarter 4 Orientation Day Q1-16 February 2018 Q2 4 May 2018 Q3 20 July 2018 Q4-5

More information

ARCHDIOCESE OF PHILADELPHIA Performance Assessment Level 4 Physical Education

ARCHDIOCESE OF PHILADELPHIA Performance Assessment Level 4 Physical Education Performance Assessment Level 4 Name Date Teacher selects an aerobic activity to correlate with the assessment. 1. Complete the chart Take Pulse Beats per minute Calculate the range (bpm) between readings

More information

Home Delivery Pharmacy Program. mycigna.com k 1/07

Home Delivery Pharmacy Program. mycigna.com k 1/07 Home Delivery Pharmacy Program mycigna.com 572507k 1/07 Stop Waiting in Line You need a reliable source for the prescription medications you and other covered family members take regularly. The CIGNA

More information

Guide to Tobacco Incentives. Tools to Implement a Policy at Your Organization

Guide to Tobacco Incentives. Tools to Implement a Policy at Your Organization Tools to Implement a Policy at Your Organization Contents Introduction... Sample Tobacco Surcharge Policy... Sample Non-Tobacco User Discount Policy... Definition of a Tobacco User... Sample Tobacco Use

More information

X FACTORS. 30 Day Evaluation (Emotional vs Logical Evaluation) CEO MENTALITY Leader Crock Pot Average

X FACTORS. 30 Day Evaluation (Emotional vs Logical Evaluation) CEO MENTALITY Leader Crock Pot Average X FACTORS 30 Day Evaluation (Emotional vs Logical Evaluation) CEO MENTALITY Leader Crock Pot Average X FACTORS SATURDAY TRAININGS (Closing out w/ PBR scheduling) Kingdom Weekly Team Call (Sunday 10pm)

More information

Recrui ng now. Could you help by joining this study?

Recrui ng now. Could you help by joining this study? Pancrea c cancer POLO study Recrui ng now AstraZeneca is looking for people with BRCA-mutated metasta c pancrea c cancer to join POLO, a clinical study to help scien sts find be er treatments for this disease

More information

Chemotherapy Suite: Ward [Mon - Fri 2pm - 4pm] Your oncologist s secretary:...

Chemotherapy Suite: Ward [Mon - Fri 2pm - 4pm] Your oncologist s secretary:... Coping, now your chemotherapy is finishing [ovarian cancer] Patient Information Series PI 41a East and North Hertfordshire NHS Trust 2 Contacts Chemotherapy Suite:... 020 3826 2236 [Mon - Fri, 8.00am -

More information

Let s Talk About Clinical Trials: A Discussion Guide for Patients

Let s Talk About Clinical Trials: A Discussion Guide for Patients Let s Talk About Clinical Trials: A Discussion Guide for Patients Participating in a clinical trial helps researchers studying Crohn s disease and ulcerative colitis answer important questions about the

More information

The Johns Hopkins Bloomberg School of Public Health

The Johns Hopkins Bloomberg School of Public Health The Johns Hopkins Bloomberg School of Public Health CONSENT FORM A / NEW RESEARCH PROJECT Title of Research Project: A Randomized Trial of HAART in Acute/Early HIV Infection Version 3.0 Principal Investigator:

More information

Personal Calendar Tracker

Personal Calendar Tracker Personal Calendar Tracker The Personal Calendar Tracker was created as a companion to the Patient and Family Reference Handbook, which was developed for people living with kidney cancer and their families.

More information

CANADIAN FORCES AWARD FOR AEROBIC EXCELLENCE

CANADIAN FORCES AWARD FOR AEROBIC EXCELLENCE Ref: A. CF Award for Aerobic Excellence. Policy December 2006 pdf AIM The Canadian Forces Award for Aerobic Excellence has been created to recognize the efforts of military personnel who attain and maintain

More information

Workbook GET YOUR BODY BUZZING. Module Five Exercise for Peak Performance

Workbook GET YOUR BODY BUZZING. Module Five Exercise for Peak Performance GET YOUR BODY BUZZING Module Five Exercise for Peak Performance Workbook Julie Meek. Performance Specialist. julie@juliemeek.com.au. www.juliemeek.com.au Exercise for Peak Performance Outcomes At the end

More information

Best Doctors Service Card. Connecting Canadians to the world s best medical information

Best Doctors Service Card. Connecting Canadians to the world s best medical information Best Doctors Service Card Connecting Canadians to the world s best medical information If the worst happens, help is only a phone call away Having the best medical knowledge for any important healthcare

More information

What You Need to Know About Clinical Trials A Guide for People With Cancer

What You Need to Know About Clinical Trials A Guide for People With Cancer Developed by Pfizer in partnership with the Colon Cancer Alliance. What You Need to Know About Clinical Trials A Guide for People With Cancer THE VOICE OF SURVIVORS Why You Need to Know About Clinical

More information

Alcohol & Drugs. Contents:

Alcohol & Drugs. Contents: Contents: Alcohol & Drugs Figure 1.1a Total Collisions Involving Alcohol by Year 72 1.1b Total Injury Collisions Involving Alcohol by Year 73 1.1c Total Fatal Collisions Involving Alcohol by Year 73 1.2a

More information

Instructions Functional Strength Workouts Do workouts 2 3 times per week alternating between Workout A and Workout B. For example, if you are working out 3 times per week, in week 1 you will do A,B,A,

More information

SmileNet SM Dental Discount Program

SmileNet SM Dental Discount Program SmileNet SM Dental Discount Program We want to catch you smiling. for Individuals and Families SpecialOffers This program is provided by Anthem Blue Cross Life and Health Insurance Company as a service

More information

FORMS 1) PAR Q & YOU:

FORMS 1) PAR Q & YOU: Personal Training New Client Registration Congratulations on taking the first step to healthier and better you! The certified trainers are screened by the Vanderbilt Recreation & Wellness Center (the Rec)

More information

#40plusfitness Online Training: October 2017

#40plusfitness Online Training: October 2017 #40plusfitness Online Training: October 2017 Are you building strong a strong foundation? If you ve been a member of this group for awhile, you ll have noticed that I m a big fan of planks, squats, rows

More information

Relief, true to form

Relief, true to form For adults with Chronic Idiopathic Constipation (CIC) or Irritable Bowel Syndrome with Constipation (IBS-C) Relief, true to form When It Comes to Constipation Relief, Form Matters Trulance can help you

More information

Treating Prostate Cancer

Treating Prostate Cancer Treating Prostate Cancer A Guide for Men With Localized Prostate Cancer Most men have time to learn about all the options for treating their prostate cancer. You have time to talk with your family and

More information

PATIENT AUTHORIZATION AND NOTICE OF RELEASE OF INFORMATION (PAN)

PATIENT AUTHORIZATION AND NOTICE OF RELEASE OF INFORMATION (PAN) XOLAIR Access Solutions is a free program for you from Genentech. We work to help you pay for your XOLAIR (omalizumab) for subcutaneous use. We can help in many different ways. We assist people who have

More information

Now Available: Final Rule for FDAAA 801 and NIH Policy on Clinical Trial Reporting

Now Available: Final Rule for FDAAA 801 and NIH Policy on Clinical Trial Reporting A service of the U.S. National Institutes of Health Now Available: Final Rule for FDAAA 801 and NIH Policy on Clinical Trial Reporting Trial record 1 of 1 for: Keynote 355 Previous Study Return to List

More information

YOUR REHABILITATION AFTER CRITICAL CARE

YOUR REHABILITATION AFTER CRITICAL CARE YOUR REHABILITATION AFTER CRITICAL CARE Exercise Programme & Exercise Diary Name: Date Commenced: Ref: West Yorkshire Critical Care Network Rehabilitation Group November 2010 CONTENTS PAGE Item Page(s)

More information

Can you imagine reversible birth control that s more than 99% effective and 100% hormone free, too?

Can you imagine reversible birth control that s more than 99% effective and 100% hormone free, too? Can you imagine reversible birth control that s more than 99% effective and 100% hormone free, too? BIRTH CONTROL THAT FITS YOUR LIFE, NATURALLY. ParaGard is a registered trademark of Teva Women s Health,

More information

This is a guide for volunteers in UTS HELPS Buddy Program. UTS.EDU.AU/CURRENT-STUDENTS/SUPPORT/HELPS/

This is a guide for volunteers in UTS HELPS Buddy Program. UTS.EDU.AU/CURRENT-STUDENTS/SUPPORT/HELPS/ VOLUNTEER GUIDE This is a guide for volunteers in UTS HELPS Buddy Program. UTS.EDU.AU/CURRENT-STUDENTS/SUPPORT/HELPS/ CONTENTS 1 2 3 4 5 Introduction: Your role as a Buddy Getting started Helping with

More information

Advanced Bodyweight M.A.S.S. Phase 1. Advanced Phase 1

Advanced Bodyweight M.A.S.S. Phase 1. Advanced Phase 1 Advanced Phase 1 The way our body lays down new muscle tissue is quite simple: we introduce a stimulus our body adapts to the given stimulus by creating new, stronger muscle tissue. As long as we can continue

More information

Pancreatic Cancer Committee meeting 9 Day 1 & 2

Pancreatic Cancer Committee meeting 9 Day 1 & 2 Committee meeting 9 Day 1 & 2 Date: 20/03/17 & 21/03/2017 Location: Minutes: RCOG, London Confirmed Committee members present: John Primrose (Chair) (Attended item 1 14) John Neoptolemos (Clinical Lead)

More information

In this program you will learn

In this program you will learn 1 In this program you will learn How to gather information to help you make treatment decisions Questions to ask about the benefits and risks of any treatment How new blood cancer treatments are developed

More information

IMPORTANT DATES. Advertisement Rates. Help us save paper and stamps!

IMPORTANT DATES. Advertisement Rates. Help us save paper and stamps! Spring 2017 2 IMPORTANT DATES March 28th 29th April 11th 13th Friday, April 14th Monday, April 17th Monday, May 22nd Friday, June 16th June 20th 22nd Saturday, June 24th Last week of Winter groups First

More information

Office of Clinical Research. Information for Participants

Office of Clinical Research. Information for Participants Office of Clinical Research Information for Participants Research and You Welcome to one of the best health systems in the nation. It is one of the best because as well as highquality, state-of-the-art

More information

working with your doctor for depression

working with your doctor for depression tips for working with your doctor for depression 2011 www.heretohelp.bc.ca Talking to your health professional about depression is a very important first step. It s the beginning of your journey to wellness.

More information

Commonly asked questions about genetic testing for hereditary cancer

Commonly asked questions about genetic testing for hereditary cancer Commonly asked questions about genetic testing for hereditary cancer Understanding genetic testing for hereditary cancer What is hereditary cancer? In some cases, cancer is caused by genetic changes (or

More information

Returning to running after an injury

Returning to running after an injury Returning to running after an injury This leaflet provides you with a plan for returning to your running activities. It s designed for runners who are either restarting training, or recovering from an

More information

How Clinical Trials Work

How Clinical Trials Work A Guide to: How Clinical Trials Work Clinical trials are rigorously controlled tests designed to examine the safety and / or effectiveness of medicines, devices, treatments, or preventive measures in humans.

More information

An educational guide from Genomic Health

An educational guide from Genomic Health Active Surveillance or Immediate Treatment? The Oncotype DX Prostate Cancer Assay helps you and your doctor choose with confidence. For more information, visit OncotypeDX.com. An educational guide from

More information

$ $ $550.00

$ $ $550.00 Affiliate Events Rules & Regulations Events planned independently of AASLD are categorized as Affiliate Events. These activities provide opportunities for colleagues to gather and/or network with others

More information

Media Release. Basel, 20 March 2018

Media Release. Basel, 20 March 2018 Media Release Basel, 20 March 2018 Phase III IMpower131 study showed Roche s TECENTRIQ (atezolizumab) plus chemotherapy (carboplatin and Abraxane) reduced the risk of disease worsening or death in the

More information

Weight Training. How do we get stronger?

Weight Training. How do we get stronger? How do we get stronger? Weight Training A muscle will only strengthen when forced to operate beyond its customary intensity (overload). Overload can be progressed by increasing the: resistance e.g. adding

More information

What is Serco Wellness?

What is Serco Wellness? What is Serco Wellness? Since 2015, the Serco Wellness program has been delivering monthly wellness challenges for every Serco employee to participate in under a platform we call Rise to the Challenge.

More information

Instructions Functional Strength Workouts Do workouts 2 3 times per week alternating between Workout A and Workout B. For example, if you are working out 3 times per week, in week 1 you will do A,B,A,

More information

Medication Tracker for ZYTIGA (abiraterone acetate)

Medication Tracker for ZYTIGA (abiraterone acetate) Medication Tracker for YTIGA (abiraterone acetate) See the next page to help set up a medication schedule that works for you, as directed by your doctor. Write in the administration times that suit you

More information

BASIC HEALTH CARE SERVICES Community Health Free Clinic

BASIC HEALTH CARE SERVICES Community Health Free Clinic BASIC HEALTH CARE SERVICES Community Health Free Clinic 947 14 th Ave SE Cedar Rapids, IA 52401 www.communityhfc.org 363-0416 Monday 8:00 AM to 5:30 PM Tuesday 8:00 AM to 12:00 PM Clinic Hours: Mon: 8:00

More information

TGTTAGATTCAGAGTCGCTAGCTAGCTAGCTATATTCTCGTATAGACTATCGTAGCGC-3 3 -ACAATCTAAGTCTCAGCGATCGATCGATCGATATAAGAGCATATCTGATAGCATCGCG-5

TGTTAGATTCAGAGTCGCTAGCTAGCTAGCTATATTCTCGTATAGACTATCGTAGCGC-3 3 -ACAATCTAAGTCTCAGCGATCGATCGATCGATATAAGAGCATATCTGATAGCATCGCG-5 LS1a Problem Set #5 Due Friday 11/3 by noon in your TF s drop box on the 2 nd floor of the Science Center All questions including (*extra*) ones must be answered 1. If you recall from last week, nerve

More information

Clinical Trials: Improving the Care of People Living With Cancer

Clinical Trials: Improving the Care of People Living With Cancer CLINICAL TRIALS Clinical Trials: Improving the Care of People Living With Cancer Presented by Mary McCabe, RN, MA Memorial Sloan-Kettering Cancer Center Carolyn Messner, DSW CancerCare Learn about: Stages

More information

Rapid Fitness & Fat Loss Cardio - 16 week programme

Rapid Fitness & Fat Loss Cardio - 16 week programme Rapid Fitness & Fat Loss Discover How To Get Twice The Fat Loss In Less Than Half The Time! WHY DOES THIS WORK SO WELL? By Robin Buck, BSc Physio, CSCS www.fitnessbootcamp.co.za The traditional approach

More information

October 2017 Mon Tue Wed Thu Fri :30-10:30 am Art for Everyone

October 2017 Mon Tue Wed Thu Fri :30-10:30 am Art for Everyone October 2017 Mon Tue Wed Thu Fri 2 3 4 5 6 1:00-2:00 pm Nutrition 101- Practice Making Healthy Snacks 2:30-4:00 pm Legal Aid Clinic Expungement 6:00-7:00 pm Art and About 5:30-6:30 p.m. Identifying Your

More information

President s Message: Is Health Care Reform Really Cooked?

President s Message: Is Health Care Reform Really Cooked? november 2009 PO BOX 801345, DALLAS, TX 75380 www.dahu.org President s Message: Is Health Care Reform Really Cooked? As we approach Thanksgiving, the Democrats continue to apply the heat to get out Health

More information

Getting started on Otezla

Getting started on Otezla Getting started on Otezla Your guide to starting and staying on treatment Otezla (apremilast) is a prescription medicine approved for the treatment of patients with moderate to severe plaque psoriasis

More information

An introduction to the multidisciplinary team for Urological Cancers

An introduction to the multidisciplinary team for Urological Cancers An introduction to the multidisciplinary team for Urological Cancers Introduction This leaflet introduces the multidisciplinary team (MDT) for urological cancers. The urological cancer team work at both

More information

As you have a degree of basic fitness and confidence, 3 months or so of training should prepare you for your challenge.

As you have a degree of basic fitness and confidence, 3 months or so of training should prepare you for your challenge. The one thing you should be reassured of is is nothing to be afraid of, as people from all walks of life register for the challenge. Although you don t have to be a Professional Athlete to walk, jog or

More information

Vanderbilt University Institutional Review Board Informed Consent Document for Research. Name of participant: Age:

Vanderbilt University Institutional Review Board Informed Consent Document for Research. Name of participant: Age: This informed consent applies to: Adults Name of participant: Age: The following is given to you to tell you about this research study. Please read this form with care and ask any questions you may have

More information

Technology appraisal guidance Published: 6 September 2017 nice.org.uk/guidance/ta476

Technology appraisal guidance Published: 6 September 2017 nice.org.uk/guidance/ta476 Paclitaxel as albumin-bound nanoparticles with gemcitabine for untreated metastatic pancreatic cancer Technology appraisal guidance Published: 6 September 2017 nice.org.uk/guidance/ta476 NICE 2018. All

More information

Ray Kelly

Ray Kelly SPRINT TRIATHLON BEGINNER PLAN WEEK 1-4 Provided by Tri-Trainer.com The duration of workouts is in Hours and Minutes i.e. 0.30 is 30 minutes You should cosult your doctor before attempting this plan as

More information

Dr Roopinder Gillmore July 2017

Dr Roopinder Gillmore July 2017 Dr Roopinder Gillmore July 2017 Resectable Borderline / locally advanced Metastatic 15-20% 15-20% 60-70% 22-28 months 9-15 months 6-12 months Does the patient have resectable disease?? Definitely not

More information

Whole Health Action Management

Whole Health Action Management Whole Health Action Management My Goal and Weekly Action Plans NAME This booklet is provided by the SAMHSA-HRSA Center for Integrated Health Solutions (www.integration.samhsa.gov). CIHS promotes the development

More information

Oncology Programme 2017

Oncology Programme 2017 Oncology Programme 2017 Who we are Remedi Medical Aid Scheme (referred to as 'the Scheme"), registration number 1430, is a non-profit organisation, registered with the Council for Medical Schemes. Discovery

More information

How is primary breast cancer treated?

How is primary breast cancer treated? How is primary breast cancer treated? The treatment team This information is for anyone who has primary breast cancer and wants to know more about how it is treated. It is written by Breast Cancer Care,

More information

UNDERSTANDING CLINICAL TRIALS FOR CANCER FIND OUT MORE

UNDERSTANDING CLINICAL TRIALS FOR CANCER FIND OUT MORE UNDERSTANDING CLINICAL TRIALS FOR CANCER FIND OUT MORE We know that people affected by cancer have a lot of questions. We can help you find reliable, clear and easy to understand answers. In this leaflet

More information

UNIVERSITY OF PENNSYLVANIA RESEARCH SUBJECT INFORMED CONSENT FORM

UNIVERSITY OF PENNSYLVANIA RESEARCH SUBJECT INFORMED CONSENT FORM UNIVERSITY OF PENNSYLVANIA RESEARCH SUBJECT INFORMED CONSENT FORM Protocol Title: Principal Investigator: Emergency Contact: AN OPEN LABEL TRIAL OF MECASERMIN FOR HIV ASSOCIATED METABOLIC DISEASE Roy Kim

More information

Affordable Solutions

Affordable Solutions Affordable Solutions For the Under & Un-Insured Don t Miss Out Dental Office Guide to DentalPlans.com Free Gift Inside Get to Know DentalPlans.com DentalPlans.com, a Henry Schein One Company, helps people

More information

Thursday s in May from 5:00pm to 7:00pm Thursday May 5th, 12th, & 26th.

Thursday s in May from 5:00pm to 7:00pm Thursday May 5th, 12th, & 26th. Urban League of Greater Pittsburgh Arthur J. Edmonds Center Northview Heights Family Support Center 101 Hazlett Street Pittsburgh, PA 15214 Mail To: Thursday s in May from 5:00pm to 7:00pm Thursday May

More information

National Horizon Scanning Centre. GV1001 for advanced and/or metastatic pancreatic cancer. April 2008

National Horizon Scanning Centre. GV1001 for advanced and/or metastatic pancreatic cancer. April 2008 GV1001 for advanced and/or metastatic pancreatic cancer April 2008 This technology summary is based on information available at the time of research and a limited literature search. It is not intended

More information

Instructions Functional Strength Workouts Do workouts 2 3 times per week alternating between Workout A and Workout B. For example, if you are working out 3 times per week, in week 1 you will do A,B,A,

More information

HOW TO USE. 75 mg capsules. and make the most out of your cutaneous T-cell lymphoma (CTCL) treatment

HOW TO USE. 75 mg capsules. and make the most out of your cutaneous T-cell lymphoma (CTCL) treatment HOW TO USE 75 mg capsules and make the most out of your cutaneous T-cell lymphoma (CTCL) treatment TARGRETIN capsules should not be used by women who are pregnant, believe they may be pregnant, or are

More information

About this consent form

About this consent form Protocol Title: Development of the smoking cessation app Smiling instead of Smoking Principal Investigator: Bettina B. Hoeppner, Ph.D. Site Principal Investigator: n/a Description of Subject Population:

More information

Sigmund Freud University SUMMER SCHOOL 2017 Intensive Basics in Psychotherapy Science

Sigmund Freud University SUMMER SCHOOL 2017 Intensive Basics in Psychotherapy Science Version 07.09.2016 Sigmund Freud University SUMMER SCHOOL 2017 Intensive Basics in Psychotherapy Science As every year when it becomes summer, the Sigmund Freud University opens its door for interested

More information

The Eat a Rainbow 2015 Chatham County Fruit and Vegetable Challenge Packet

The Eat a Rainbow 2015 Chatham County Fruit and Vegetable Challenge Packet Please join us in this year s Eat a Rainbow Week Challenge September 20 th -26 th! The Eat a Rainbow 2015 Chatham County Fruit and Vegetable Challenge Packet Are YOU ready to take on the Challenge? Brought

More information

Appendix 2. Adjuvant Regimens. AC doxorubin 60 mg/m 2 every 3 weeks x 4 cycles Cyclophosphamide 600 mg/m 2

Appendix 2. Adjuvant Regimens. AC doxorubin 60 mg/m 2 every 3 weeks x 4 cycles Cyclophosphamide 600 mg/m 2 Appendix 2 Adjuvant Regimens AC doxorubin 60 mg/m 2 every 3 weeks x 4 cycles Cyclophosphamide 600 mg/m 2 CMF IV cyclophosphamide 600 mg/m 2 days 1 & 8 every 4 weeks methotrexate 40 mg/m 2 for 6 cycles

More information

Travis County Sheriff s Office Victim Services

Travis County Sheriff s Office Victim Services Travis County Sheriff s Office Victim Services December 2017 December is National Impaired Driving Prevention Month By: Sonya Villarreal Next Volunteer Meeting January 17th Services for Veterans and Suicide

More information

WAIVER AND RELEASE FROM LIABILITY

WAIVER AND RELEASE FROM LIABILITY COACHING CONTRACT I hereby contract Start-Tri.Com as my personal coach for endurance sports. I agree to pay for coaching services up front at the rate of $255/month for the Tier I package, $165/month for

More information

5-year survival results

5-year survival results First glance at Optune FDA-approved for GBM Discovering Optune Inside: 5-year survival results in newly diagnosed GBM Brian, Xuan, Pat, Marcia, and Eugene are on Optune 1. How would Optune fit into my

More information

and Beyond. Ruckus Publishing and Kill Mode Training Co., Inc.

and Beyond. Ruckus Publishing and Kill Mode Training Co., Inc. 1 Dan Long s 8 Week Hardcore Do Anywhere Bodyweight Training Program with Follow- Along Video Dan Long s Kill Mode Mindset If I told you that hundreds of my clients not only hit their goals, but they SHATTERED

More information

Dental and vision coverage for your total health

Dental and vision coverage for your total health Dental and vision coverage for your total health The mouth and eyes are important parts of your body, and your health. Regular dental and vision checkups can help nd early warning signs of disease. So

More information

Fuel your determination to live longer with KYPROLIS. Look inside to learn more.

Fuel your determination to live longer with KYPROLIS. Look inside to learn more. F O R R E L A P S E D MULT IP L E M Y E L OM A APPROVED USES KYPROLIS is a prescription medication used to treat patients with relapsed or refractory multiple myeloma who have received one to three previous

More information

WHAT IF WE HAVE A FUN DAY WITHOUT UC GETTING IN THE WAY? INDICATIONS IMPORTANT RISK INFORMATION

WHAT IF WE HAVE A FUN DAY WITHOUT UC GETTING IN THE WAY? INDICATIONS IMPORTANT RISK INFORMATION WHAT IF WE HAVE A FUN DAY WITHOUT UC GETTING IN THE WAY? Learn how DELZICOL can help you manage your ulcerative colitis INDICATIONS DELZICOL (mesalamine) delayed-release capsules is a prescription medication

More information

What is HIV? H = Human. I = immuno-deficiency. V = Virus

What is HIV? H = Human. I = immuno-deficiency. V = Virus Class-1 What is HIV? H = Human I = immuno-deficiency V = Virus What is AIDS? Acquired Immune Deficiency Syndrome Syndrome Questions What is the relationship between HIV and AIDS? HIV is the cause of AIDS

More information