SLIT2 PREVENTS RENAL ISCHEMIA REPERFUSION INJURY IN MICE. Swasti Chaturvedi. A thesis submitted in conformity with the requirements for

Transcription

1 SLIT2 PREVENTS RENAL ISCHEMIA REPERFUSION INJURY IN MICE Swasti Chaturvedi A thesis submitted in conformity with the requirements for the degree of MSc. Institute of Medical Science University of Toronto Copyright by Chaturvedi Swasti 2011

2 Slit2 Prevents Renal Ischemia Reperfusion Injury in Mice Swasti Chaturvedi Master of Medical Science (MSc) Institute of Medical Science University of Toronto 2011 ABSTRACT The Slit family of secreted proteins act as axonal repellents during embryogenesis. Slit2 via its receptor, Roundabout-1, also inhibits chemotaxis of multiple leukocyte subsets. Using static and microfluidic shear assays, we found that Slit2 inhibited multiple steps required to recruit circulating neutrophils. Slit2 blocked capture and firm adhesion of human neutrophils to and transmigration across inflamed primary vascular endothelial cells. To determine the response of Slit2 in renal ischemia reperfsuion injury, Slit2 was administered prior to bilateral renal pedicle clamping in mice. This led to significant decreases in both renal tubular necrosis score and neutrophil infiltration. Administration of Slit2 also prevented elevation of plasma creatinine following injury in a dose-dependent manner. Furthermore, administration of Slit2 did not increase hepatic bacterial load in mice infected with L.monocytogenes infection. Collectively, these data demonstrate Slit2 as an exciting therapeutic molecule to combat renal ischemia reperfusion injury without compromising protective host innate immune functions. ii

3 ACKNOWLEDGEMENTS I would like to express my sincere gratitude to my supervisor and mentor, Dr. Lisa Robinson, for her constant encouragement and guidance. I also owe my gratitude to my program advisory committee, Dr. James Scholey and Dr Philip Marsden for their encouragement, and constructive criticism. I am very thankful to all the members of the Robinson lab, particularly Sajeda Patel, Yi-wei Huang, Guang Ying Liu, Ilya Mukovozov and Harikesh Wong for their constant assistance, feedback and engaging discussions. I would also like to thank Michael Woodside and Paul Paroutis for their technical expertise and suggestions in optimization of the neutrophil flow assays. I would further like to acknowledge the friendly and supportive individuals of the 4 th floor. My appreciation and gratitude also extends to all the volunteers who have donated blood for this study. Most importantly, I would like to thank my Husband and my family for their unconditional love and support. iii

4 TABLE OF CONTENTS DATA ATTRIBUTION... vi TABLE OF FIGURES... vii LIST OF TABLES... viii LIST OF ABBREVIATIONS...ix CHAPTER INTRODUCTION Inflammation Acute kidney injury The leukocyte migratory cascade Chemoattractants The Neutrophil Capture and Rolling Adhesion Transmigration Slit2: a guidance cue for migrating cells Slit and Robo Structure Slit and Robo expression Slit and Robo Function Slit2/Robo1 intracellular signal transduction Slit/Robo in leukocyte trafficking Rho GTPases: Rac and Cdc Structure and Regulation The role of Rho-family GTPases in regulation of the actin cytoskeleton The role of Rho-family GTPases in regulation of innate immune function Rationale, Hypothesis and Objectives Rationale Hypotheses Objectives CHAPTER MATERIAL AND METHODS Reagents and antibodies Slit2 expression and purification Immunohistochemistry Isolation of primary human neutrophils Neutrophil endothelial adhesion Assays Hypoxia-reoxygenation (H/R) of endothelial cells Reverse transcriptase-polymerase chain reaction (RT-PCR) (4, 5-Dimethylthiazol-2-yl)-2, 5-Diphenyltetrazolium Bromide (MTT) assays Neutrophil adhesion under hydrodynamic shear flow conditions Neutrophil transmigration assay Mouse model of renal ischemia-reperfusion injury Histologic Scores iv

5 2.13 Flow cytometry analysis Murine infection with Listeria Monocytogenes CHAPTER RESULTS CHAPTER DISCUSSION & CONCLUSIONS REFERENCES v

6 DATA ATTRIBUTION The work presented here was performed in collaboration with a number of individuals. The purification of Slit2 was conducted in the laboratory of Dr. Yves Durocher (National Research Council Canada). Mouse acute kidney injury experiments were done in collaboration with Dr Mark Okusa s lab and his lab members Aman Bajwa and Liping. Yi-wei Huang did the RT-PCR and washed Slit experiments. Grace Lam and Yi-Wei Huang jointly did the mouse L. Monocytogenes experiment. vi

7 TABLE OF FIGURES Figure 1.1: Schematic overview of early immune response occurring in renal ischemia reperfusion injury....7 Figure 1.2: Leukocyte Adhesion Cascade Figure 1.3: Schematic of inside out and outside in signaling Figure 1.4: Schematic diagram of leukocyte paracellular transendothelial migration Figure 1.5: Schematic diagram of signaling events initiated downstream of ICAM-1 ligation Figure 1.6: Schematic diagram of leukocyte transcellular migration Figure 1.7: Structure of Mammalian Slit2 and Robo-1 proteins Figure 1.8: Slit/Robo intracellular signal transduction Figure 1.9: Structure of Cdc42/Rac Figure 1.10: Regulation of Rho GTPases Figure 3.1: Slit2 expression increases in kidney tissue in renal IRI Figure 3.2: Slit2 inhibits neutrophil adhesion to activated endothelial cells Figure 3.3: HUVEC s express Robo-1, 2 and 4 and Slit2 inhibits neutrophil-endothelial adhesion by its action on neutrophils Figure 3.4: Slit2 inhibits neutrophil capture and adhesion to stimulated endothelium under flow conditions Figure 3.5: Slit2 reduced neutrophil transendothelial migration Figure 3.6: Slit2 prevents renal dysfunction after IRI Figure 3.7: Slit2 improves acute tubular necrosis and reduces neutrophil infiltration in renal IRI Figure 3.8: Slit2 does affect hepatic bacterial load of L.monocytogenes vii

8 LIST OF TABLES Table 1 Acute kidney injury (AKI) classification in adults and children...4 Table 2 Summary of the primers used for RT-PCR viii

9 LIST OF ABBREVIATIONS AKI acute kidney injury ATP adenosine triphosphate CNS central nervous system DAG diacyl glycerol EGF epidermal growth factor EMT epithelial mesenchymal transition fmlp FormylMethionylLeucylPhenylalanine GDI GDP dissociation inhibitor GDNF glial derived neurotrophic factor GPCR G protein coupled receptor GAP GTP activating proteins GEF guanine nucleotide exchange factor HGF hepatocyte growth factor HUVEC human umbilical venous endothelial cells IL-1 interleukin-1 IL-8 interleukin-8 IGF-1 insulin like growth factor-1 IP3 inositol (1,4,5)-triphosphate IRI ischemia reperfusion Injury JAM junctional adhesion molecule LFA-1 lymphocyte function-associated Antigen-1 LRR leucine rich repeats Mac-1 macrophage-1 antigen MAPK mitogen activated protein kinase MCP-1 monocyte chemotactic protein-1 MLCK myosin light chain kinase MIP-1α macrophage inflammamtory protein- 1α MIP-1β macrophage inflammatory protein-1β MYPT-1 myosin-specific phosphatase-1 ICAM-1 intercellular adhesion molecule-1 PAI-1 plasminogen activator inhibitor-1 PAK P21-activated kinase PDGF platelet derived growth factor PECAM1 platelet /endothelial cell adhesion molecule 1 PLC phospholipase C ArfGAP ADP ribosylating factor GTPase activating protein PIX PAK interacting exchange factor PSGL-1 P selectin glycoprotein ligand-1 RANTES Regulated and normal T cell expressed and secreted TGF-β transforming growth factor-β TNF-α tumor necrosis factor-α VCAM-1 vascular cell adhesion molecule-1 VLA-4 vascular leukocyte adhesion molecule-4 VVOs vesiculo-vacuolor organelle ix

10 CHAPTER 1 INTRODUCTION 1.1 Inflammation Acute kidney injury Acute kidney injury (AKI) is a complex, sometimes life threatening illness defined by the presence of reduced glomerular filtration rate and azotemia (Star 1998). AKI develops in ~5% of hospitalized patients and leads to significant morbidity, mortality and financial costs (Brady and Singer 1995; Korkeila, Ruokonen et al. 2000; Bagshaw 2006). Despite significant advances in understanding the cellular and molecular events that cause AKI, specific therapy remains elusive and management is mainly supportive (Jo, Rosner et al. 2007). For a long time, the lack of universal definition of AKI acted as a major barrier in the ability to compare studies, predict clinical course, test therapeutic strategies and improve outcome. To overcome this limitation, nephrology and critical care groups proposed empiric working AKI definition in 2004 (Bellomo, Ronco et al. 2004), Table 1. The RIFLE (risk, injury, failure, loss, and end stage renal disease) has been extensively studied and demonstrate that AKI is an independent predictor of survival after correcting for co-morbities, complications and severity of illness (Chertow, Soroko et al. 2006; Hoste and Kellum 2006). A modified pediatric RIFLE (prifle) has been proposed for use in children (Akcan-Arikan, Zappitelli et al. 2007), 1

11 Table 1. In 2007, the Acute Kidney Injury Network (AKIN) developed a new streamlined scoring system, based in part on the RIFLE criteria (Mehta, Kellum et al. 2007), Table 1. Despite the use of standardised classifications, the diagnosis of AKI remains problembatic due to reliance on two functional abnormalities: changes in serum creatinine (a marker of glomerular filtration rate or GFR) and oliguria. Both of these changes appear late in the course of injury and have several significant shortcomings (Al-Ismaili, Palijan et al. 2011). For example: serum creatinine may not change until 25-50% of kidney function is already lost; serum creatinine concentarion varies with hydration status, muscle mass, age and gender; at lower GFR, serum creatinine will overestimate renal function due to tubular secretion of creatinine; different methods used to measure creatinine (enzymatic vs. Jaffe reaction) give different values and serum creatinine cannot be used for assessment of kidney function in patients on dialysis as serum creatinine is easily dialyzed (Al-Ismaili, Palijan et al. 2011). Ideally a biomarker for AKI should be up-regulated shortly after injury and be independent of the GFR besides being highly sensitive and specific. There are several novel AKI biomarkers under evaluation in humans (Devarajan 2011). The most promising of these biomarkers are neutrophil gelatinase-associated lipocalcin (NGAL), kidney injury molecule-1 (KIM-1), interleukin 18 (IL-18), and serum cystatin C (Mak 2008). Human NGAL is a 25kDa protein covalently bound to neutrophil gelatinase and is normally expressed at very low levels in kidney, lungs, stomach and colon. Its expression increases in epithelial injury and NGAL is a useful early biomarker of AKI in a wide range of clinical settings (Haase, Bellomo et al. 2009). KIM-1 is transmembrane glycoprotein expressed in low 2

12 levels by normal kidney. It is highly up-regulated in proximal tubule cells after an ischemic or nephrotoxic AKI and its proteolytically cleaved extracellular domain is detected in urine (Devarajan 2011). IL-18 is a pro-inflammatory chemokine produced systemically and in renal tubular epithelial cells in AKI (Leslie and Meldrum 2008). Cystatin C is a cysteine protease inhibitor synthesized by nucleated cells and released into the blood at a relatively constant rate. It is freely filtered by the glomerulus, completely absorbed by the proximal tubule, and not secreted. Its levels are not significantly affected by age, gender, race or muscle mass, thus making it a better predictor of glomerular function than serum creatinine (Dharnidharka, Kwon et al. 2002). 3

13 Table 1 Acute kidney injury (AKI) classification in adults and children Adult Pediatric AKIN AKIN/RIFLE RIFLE prifle Stage S.Cr Urine output Class Serum Cr or Class eccl by Urine GFR Schwartz output I S.Cr > 0.3 < 0.5ml kg per h x Risk S.Cr >150% or Risk eccl by < 0.5ml kg mg/dl or S.Cr 6 h GFR by 25% 25% per h x 8 h > % II S.Cr by < 0.5ml kg per h Injury S.Cr >200% or Injury eccl by < 0.5ml kg % > 12 h GFR by 50% 25% per h x 16 h III S.Cr > 300% < 0.3ml kg per h Failure S.Cr >300% or Failure eccl by < 0.3ml kg or S.Cr > 4.0 >24h or anuria for S.Cr > 4.0 mg/dl 25% per h for24h mg/dl with > 12h with acute rise of or anuria for acute rise of atleast 0.5 mg/dl > 12h atleast 0.5 or GFR by mg/dl >75% Loss Failure> 4 weeks Loss Failure> 4 weeks ESRD Failure > 3 months ESRD Failure > 3 months Cr- creatinine; GFR- Glomerular filtration rate; eccl- estimated creatinine clearance; ESRD-end stage renal disease 4

14 There are many causes of AKI including ischemia reperfusion injury (IRI), glomerulonephritis, interstitial nephritis, nephrotoxins, vascular lesions, renal developmental dysplasia, hypoplasia, obstructive uropathy, infection and sepsis (Lameire, Van Biesen et al. 2005). Ischemia reperfusion injury (IRI) is the leading cause of AKI in both native and transplanted kidneys (Star 1998; Devarajan 2006). Blood flow to the human adult kidney comprises ~ 25% of the cardiac output with the renal cortex receiving the majority of the renal blood supply (Janssen, Beekhuis et al. 1995). Blood flow to the renal medulla is via efferent arterioles of juxtamedullary glomeruli which give rise to vasa recta. During the ischemic phase of IRI, there is regional reduction in blood flow with the outer renal medulla being the worst affected (Okusa 2002). Reduced blood flow and oxygen delivery leads to ATP depletion, impaird oxidative metabolism, generation of reactive oxygen species and inhibition of Na/K ATPase pump which in turn results in epithelial and endothelial cell dysfunction, swelling and death (Okusa 2002; Legrand, Mik et al. 2008). There is increased renal synthesis of pro-inflammatory cytokines and chemokines, most notably tumor necrosis factor-α (TNF-α) and CXCL1 (interleukin-8; IL-8) (Baggiolini, Dewald et al. 1994; Daemen, van de Ven et al. 1999; Donnahoo, Meng et al. 1999; Donnahoo, Meldrum et al. 2000; Furuichi, Wada et al. 2002; Furuichi, Wada et al. 2003). Ischemia also activates the transcription factors including NF-Kb, heat shock factor-1, and hypoxia-inducible factor-1 (HIF-1) (Eickelberg, Seebach et al. 2002; Cao, Ding et al. 2004). HIF-1 in turn regulates critical biological processes important for survival of hypoxic cells such as anaerobic glycolysis, oxygen delivery through increased angiogenic growth factor production and erythropoiesis, as well as cellular proliferation and apoptosis (Gunaratnam and Bonventre 2009). 5

15 The reperfusion phase is characterised by leukocyte recruitment, endothelial cell activation and generation of inflammatory and vasoactive mediators which perpuate the tissue injury. These chemoattractants both attract and activate leukocytes and blocking these individual inflammatory cytokines leads to partial protection in mice subjected to renal IRI (Figure 1.1). For example, administration of anti-tnf-α antibodies improves renal injury following IRI (Daemen, van de Ven et al. 1999). Similarly neutralisation of IL-8 ameliorates renal damage after IRI (Miura, Fu et al. 2001). The early reperfusion phase is characterised by a massive influx of circulating neutrophils to the injured kidney (Figure 1.1) (Linas, Shanley et al. 1988; Hellberg and Kallskog 1989; Klausner, Paterson et al. 1989; Willinger, Schramek et al. 1992; Bonventre and Weinberg 2003). Indeed, neutrophil infiltration has been demonstrated in animal models of ischemic acute kidney injury and in renal biopsies from patients with acute kidney injury (Solez, Morel-Maroger et al. 1979; Linas, Shanley et al. 1988; Hellberg and Kallskog 1989). The recruited neutrophils then becomes activated and releases cytokines, chemokines, eicosanoids, proteases, and reactive oxygen species that perpetuate and promote the inflammatory damage (Bonventre and Weinberg 2003; Hayama, Matsuyama et al. 2006). Not surprisingly, neutrophil depletion and therapies targeting neutrophil migration cues have been found to be protective in renal IRI (Klausner, Paterson et al. 1989; Chiao, Kohda et al. 1997). Macrophages, T lymphocytes and dendritic cells are recruited in the later phases of inflammation (1-5 days after reperfusion) and exacerbate inflammation by activating adaptive immune responses (Figure 1.1) (Rabb, Daniels et al. 2000; De Greef, Ysebaert et al. 2001; Day, Huang et al. 2005; Jo, Sung et al. 2006; Schlichting, Schareck et al. 2006; Loverre, Capobianco et al. 2007). Individually blocking the recruitment of monocyte/macrophages or T cells partially 6

16 protects against IRI. Systemic macrophage depletion results in reduced inflammation and less tubular damage and apoptosis (Jo, Sung et al. 2006). Mice lacking CD4+/CD8+ T lymphocytes, or cell adhesion receptors on T lymphocytes that allow them to adhere to injured endothelium, are partially protected from IRI (Rabb, Daniels et al. 2000). Adherent leukocytes, platelets and red blood cells also cause capillary plugging and further compromise the microvascular flow in the vasa recta of the outer medulla (Okusa 2002). Figure 1.1: Schematic overview of early immune response occurring in renal ischemia reperfusion injury. In experimental ischemic acute kidney injury models, an ischemic insult precedes the reperfusion phase. During the reperfusion phase, leukocytes, including neutrophils, macrophages, lymphocytes, and dendritic cells are recruited to the injured kidney. Once recruited, these leukocytes then exacerbate the inflammatory damage. 7

17 After IRI, repair is initiated by dedifferentiated epithelial cells that express vimentin, an embryonic marker for multipotent renal mesenchymal cells (Devarajan 2006). Besides vimentin, several other embryonic genes are markedly induced during recovery phase. These include Wnt- 4, transcription factor Ets-1 and leukemia inhibitory factor (Yoshino, Monkawa et al. 2003; Terada, Tanaka et al. 2005). The change from differentiated phenotype to less differentiated phenotype recapitulates renal development (Hammerman 2000). The source of these cells is not entirely clear and is an area of intense research. A small subset may be bone-marrow derived cells (Duffield, Park et al. 2005; Krause and Cantley 2005). Another potential source of these cells could be resident stem cells with tubulogenic potential (Maeshima, Sakurai et al. 2006). However, the dedifferentiated resident tubular epithelial cells are perhaps the most important source of these reparative cells (Lin, Moran et al. 2005; Stokman, Leemans et al. 2005). In the next phase of recovery, there is upregulation of genes encoding growth factors, such as hepatocyte growth factor (HGF), insulin like growth factor-1 (IGF-1) and fibroblast growth factor on these dedifferentiated cells which migrate and rapidly proliferate to replace the irreversibly damaged tubular epithelial cells (Nigam and Lieberthal 2000). The final phase of the repair process is redifferentiation of the epithelial cells where most tubules regain the essential functions and re-establish cell polarity (Bonventre and Weinberg 2003). However, depending on the severity of the initial damage, recovery is frequently incomplete and may lead to progressive kidney dysfunction due to progressive interstitial fibrosis, peritubular capillary loss causing tubular damage, and loss of functioning nephrons (Azuma, Nadeau et al. 1997; Okusa, Chertow et al. 2009; Waikar and Winkelmayer 2009). Platelet-derived growth factor (PDGF) and transforming growth factor-β (TGF-β)-dependent cellular signaling cascades are the 8

18 key mediators of fibroblast proliferation, epithelial-to-mesenchymal-transition (EMT), enhanced matrix synthesis and reduced matrix turnover leading to enhanced inter-cellular matrix deposition (Tang, Ulich et al. 1996; Chai, Krag et al. 2003; Kalluri and Neilson 2003; Zeisberg, Hanai et al. 2003). Epithelial-mesenchymal transition is a process by which injured tubular epithelial cells undergo transition to a matrix producing fibroblast and myofibroblast thereby contributing to tissue fibrogenesis (Iwano, Plieth et al. 2002; Liu 2004). Thus, therapies inhibiting this process or perhaps even stimulating the conversion of myofibroblast back into epithelium again (mesenchymal-to-epithelial transition) may help delay the development of chronic kidney disease(liu 2004; Zeisberg, Shah et al. 2005). The recruited leukocytes not only exacerbate acute injury but also accelerate renal fibrosis and chronic kidney disease through release of fibrogenic growth factors including TGFβ, PDGF, plasminogen activator inhibitor-1 (PAI-1) and endothelin-1 (Isaka, Fujiwara et al. 1993; Bottinger and Bitzer 2002; Hirschberg and Wang 2005; Floege, Eitner et al. 2008). Inhibition of the early leukocyte infiltration reduces not only the acute inflammatory damage also ameliorates the development of renal tubulointerstitial fibrosis and preserves renal function (Forbes, Hewitson et al. 2000; Persy, Verhulst et al. 2003; Furuichi, Gao et al. 2006) The leukocyte migratory cascade Following IRI, leukocytes are recruited to the injured tissue in a series of precisely coordinated dynamic interactions with vascular endothelial cells. The classical leukocyte migratory cascade involves three main steps: leukocyte capture and rolling, adhesion to the activated endothelium and eventual leukocyte transendothelial migration (Fig. 1.2). In the first 9

19 step, circulating leukocytes are captured by and roll along the endothelial surface, a process mediated mainly by selectins (Chamoun, Burne et al. 2000). Selectin deficiency or blockade reduces acute renal injury as well as late renal dysfunction and tissue damage in animal models of renal IRI (Takada, Nadeau et al. 1997; Singbartl, Green et al. 2000). The next step is leukocyte arrest and firm adhesion on activated endothelium. This process is triggered by chemokines and other chemoattractants and mediated by the binding of leukocyte integrins to the immunoglobulin superfamily members intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1), expressed on endothelial cells (Campbell, Hedrick et al. 1998). Chemokines, including IL-8, are secreted by activated endothelial cells (Huber, Kunkel et al. 1991; Springer 1995). Platelets also secrete chemokines, such as CC-chemokine ligand 5 (CCL5; RANTES), CXC-chemokine ligand 4 (CXCL4) and CXCL5, thus triggering leukocyte arrest on the inflamed endothelial cells (von Hundelshausen, Koenen et al. 2005; Weber 2005). Binding of chemokines to their specific G protein coupled receptors (GPCR s), expressed on the surface of leukocytes leads to a rapid increase in integrin affinity due to a conformational change resulting in increased ligand binding energy and decreased ligand dissociation rate. Binding of chemokines to their receptors on the surface of leukocytes also increases the integrin valency (the density of integrins per area of plasma membrane involved in adhesion). This is referred to as inside-out signalling (Figure 1.3) (Shamri, Grabovsky et al. 2005). In contrast, outside-in signaling refers to downstream effects of integrin ligand binding and contributes to adhesion stability of leukocytes (Figure 1.3) (Kinashi 2005). Adhesion is the critical step in leukocyte tissue infiltration and ICAM-1 blockade has been shown to be protective in renal IRI (Kelly, Williams et al. 1994). 10

20 Following firm arrest on activated endothelium, leukocytes migrate across the three vascular barriers: endothelial cells, the underlying basement membrane, and the pericyte sheath (Nourshargh and Marelli-Berg 2005). Leukocytes can cross the endothelium either through the endothelial cell junctions (paracellular route) or directly through an endothelial cell (transcellular route) (Engelhardt and Wolburg 2004). Although the leukocyte adhesion cascade has been divided into distinct steps, these are not temporally exclusive, but instead work together to achieve the desired effect of leukocyte arrest and transendothelial migration. In the past decade, new insights have been gained into the signaling events that underlie integrin activation, postadhesion strengthening of leukocyte attachment, and the molecules involved in transendothelial migration. 11

21 Figure 1.2: Leukocyte Adhesion Cascade Leukocytes are recruited to the sites of inflammation in a series of coordinated interactions with endothelial cells (ECs) lining the vessel wall. The classical leukocyte adhesion cascade involves three main steps: leukocyte capture and rolling, activation and arrest, and transmigration. ECM- Extracellular Matrix Chemoattractants A variety of chemoattractants recruit leukocytes to sites of injury and inflammation. Chemoattractants are divided in two groups. The classical chemoattractants include bacterial derived N-formyl peptides, complement factors such as C3a and C5a, leukotrienes such as leukotriene B4 and platelet activating factor. These chemoattractants non-specifically recruit 12

22 leukocytes to inflammatory foci. On the other hand, chemokines are a family of small, secreted peptides of 70 to 80 amino acids that specifically recruit leukocyte subsets to the inflammatory site. There are approximately 50 human chemokines which are divided into 4 families (CC, CXC, CX 3 C and C) according to positioning of first 2, highly conserved cysteines of the amino acid sequence (Zlotnik and Yoshie 2000). Most chemokines belong to the CXC (α) or the CC (β) family. The CXC chemokines have one amino acid residue between the two conserved N-terminal cysteine residues and act primarily to recruit neutrophils. CXCL8 (IL-8) is the prototypic chemokine of this group. In CC chemokines, the first two of four N-terminal cysteine residues are adjacent to each other and attract mononuclear cells to sites of inflammation. These chemokines include CCL2 (monocyte chemoattractant protein-1, MCP-1), CCL3 (macrophage inflammatory protein-1α, MIP-1α), CCL4 (macrophage inflammatory protein 1-β, MIP-1β) and CCL5 (regulated and normal T cell expressed and secreted, RANTES). The CX 3 C chemokine family has only one member CX 3 CL1 (fractalkine) (Bazan, Bacon et al. 1997). The fourth family of C (γ) chemokines is composed of only 2 members: XCL1 (chemokine (C motif) ligand or lymphotactin) and XCL2 (Chemokine (C motif) ligand 2), which are lymphocyte specific chemokines (Kelner, Kennedy et al. 1994). Most chemokines are secreted, while two, CX 3 CL1 and CXCL16, also exist as transmembrane molecules which act as both chemoattractants and adhesion molecules (Charo and Ransohoff 2006). The specific effects of chemokines on different leukocyte subsets are mediated by binding to serpentine G-protein coupled receptors (GPCR s). Likewise, other soluble chemoattractants such as complement factors and leukotrienes also bind to and activate 13

23 serpentine GPCR on the surface of neutrophils. Coupled with the differences in receptor expression on leukocyte subsets, this diversity allows the immune system to activate specific leukocyte subsets during specific inflammatory conditions/processes. 1.2 The Neutrophil Polymorphonuclear leukocytes or neutrophils are the key players in innate immune responses and are the first line of defense against pathogens (Segal 2005). Indeed neutropenias can lead to severe infection and sepsis (Bodey, Buckley et al. 1966). Neutrophils are rapidly recruited to the site of inflammation by chemokines or bacterial products (Nathan 2006). Once recruited to the site of injury, neutrophils generate chemotactic signals to attract monocytes and dendritic cells. They also generate proteolytic enzymes and reactive oxygen species (Nathan 2006). These responses help to control infection and to promote tissue repair, but when unchecked can also lead to excessive tissue injury. Neutrophils have been implicated in several inflammatory diseases such as rheumatoid arthritis, chronic obstructive airway disease and ischemia reperfusion injury (Linas, Whittenburg et al. 1995; Pillinger and Abramson 1995; Stockley 2002). In order to understand the balance between the beneficial and deleterious effects of impact of neutrophil mediated destruction of pathogens and host tissue it is important to understand the steps involved in neutrophil recruitment Capture and Rolling Leukocyte capture and rolling is mediated by cell surface glycoproteins called selectins (Tedder, Steeber et al. 1995). The selectin family of leukocyte adhesion molecules consists of three known members: L-selectin, P-selectin, and E-selectin (Bevilacqua and Nelson 1993). L-selectin 14

24 is expressed on a multiple leukocyte subsets, including neutrophils. P-selectin is constitutively stored in the Weibel-Palade bodies of endothelial cells and in the alpha granules of platelets (Ley 2001). E-selectin is expressed on endothelial cells activated by the pro-inflammatory cytokines interleukin-1 (IL-1) and TNF-α (Ley 2003). All three selectins have a extracellular region composed of an N-terminal lectin domain, an epidermal growth factor (EGF) domain, two to nine short consensus repeat (SCR) units homologous to domains found in complement binding proteins, a transmembrane domain and a cytoplasmic domain (Patel, Cuvelier et al. 2002). Several ligands of L-selectin have been identified. These include: P-selectin glycoprotein ligand-1 (PSGL-1), GlyCAM-1, MAdCAM-1 and CD34 (Patel, Cuvelier et al. 2002). P-selectin ligands include PSGL-1 and CD24. Ligands proposed for E-selectin include PSGL-1, E-selectin ligand-1 (ESL-1) and CD44 (Sperandio 2006) PSGL-1 is the most important P-selectin and L- selectin ligand. E-selectin also binds to PSGL-1, however its major ligand remains to be discovered (Chamoun, Burne et al. 2000). PSGL-1 knockout mice show delayed neutrophil recruitment and moderate neutrophilia (Yang, Hirata et al. 1999; Xia, Sperandio et al. 2002). The binding of leukocyte L-selectin to PSGL-1 facilitates secondary leukocyte capture by adherent leukocytes (Sperandio, Smith et al. 2003). Generation of mice deficient in individual selectin molecules has provided important information about their individual roles. L-selectin knockout mice have the most severe phenotype and display impaired leukocyte recruitment in inflammation (Arbones, Ord et al. 1994; Tedder, Steeber et al. 1995). Lymphocytes from these mice fail to bind to high endothelial venules of the lymph nodes and there is reduced cellularity in peripheral lymph nodes (Arbones, 15

25 Ord et al. 1994; Tedder, Steeber et al. 1995). P-selectin deficient mice have mild neutrophilia and display reduced injury in models of atherosclerosis, transplantation and IRI (Connolly, Winfree et al. 1997; Johnson, Chapman et al. 1997; Naka, Toda et al. 1997). E-selectin deficient mice display no impairment in leukocyte recruitment in inflammation and contact hypersensitivity models but have higher rates of mortality secondary to bacteremia than wild type mice when exposed to Streptococcus pneumoniae (Labow, Norton et al. 1994; Munoz, Hawkins et al. 1997). Hydrodynamic shear flow is a critical determinant of neutrophil endothelial interactions within a given vascular bed. (Finger, Puri et al. 1996). Leukocytes must experience a minimum threshold wall shear stress to tether and roll on selectins. As the wall shear stress is increased, the number of rolling cells increases initially and then decreases in a biphasic manner. L-selectin requires threshold shear stress to support leukocyte rolling on P-selectin glycoprotein ligand-1 (PSGL-1). The bond lifetimes initially increases with force, indicating the presence of catch bonds. After reaching a maximum, the lifetime decreases with force, indicating slip bonds. (Marshall, Long et al. 2003). Besides selectins, integrins also take part in rolling. The coexpression of ICAM-1 with L-selectin ligand fucosyltransferase VII in human vascular endothelial cell line led to increased leukocyte rolling and slower rolling velocities (Kadono, Venturi et al. 2002). Monocytes also roll on immobilized VCAM-1 via very late antigen 4 (VLA-4; α4β1-integrin) engagement (Berlin, Bargatze et al. 1995). Additionally, slow rolling in vivo was shown not only to require selectins but also β2 integrins; LFA-1 and macrophage receptor 1 (Mac-1; αmβ2-integrin). LFA-1 and Mac-1 knockout mice display elevated leukocyte rolling velocity and subsequent reduced leukocyte adhesion (Dunne, Ballantyne et al. 2002). 16

26 1.2.2 Adhesion Firm adhesion of neutrophils on activated endothelial cells is a pre-requisite for eventual neutrophil transmigration towards inflammatory foci. This firm adhesion is integrin-mediated. Integrins are large transmembrane glycoproteins that connect the extracellular environment with the cytoskeleton of leukocytes. Integrins exist as heterodimers of α and β subunits. The β2 family of integrins is expressed only on leukocytes and play an important role in neutophil adhesion. The β2 integrins are composed of a variable α subunit (CD11a, -b, and -c) and a common β subunit (CD18). The two most important integrins on neutrophils are CD11a/CD18 (LFA-1, lymphocyte function associated antigen-1) and CD11b/CD18 (Mac-1 or complement receptor 3). Both LFA-1 and Mac-1 bind to ICAM-1. Mac-1 also binds to fibrinogen, heparin, factor X and ic3b fragment of complement factor 3 (Diamond, Staunton et al. 1991). Following binding of soluble chemoattractants to their GPCR on the surface of leukocytes, leukocytes become activated, initiating rapid inside-out signaling which ultimately leads to integrin activation. The intracellular signaling pathways from GPCR activation to integrin activation are ill understood and are shown in Figure 1.3 A. Phosphotidyl-inositol-3- kinase (PI3K) and phospholipase C (PLC) are activated downstream of GPCR binding. PI3K activation leads to activation of cytohesin-1(kinashi 2005). Cytohesin-1 in turn leads to integrin activation (Weber, Weber et al. 2001). Activation of PLC leads to production of inositol triphosphate (IP 3 ) and diacylglycerol (DAG), and an increase in intracellular calcium. This calcium flux and the production of DAG activates guanine nucleotide exchange factors (GEFs) such as CALDAG and Vav-1, which in turn activate RAP-1 and Rho-family GTPases (Anthis and Campbell ; Gakidis, Cullere et al. 2004). RhoA also activates protein kinase-ζ which leads 17

27 to integrin activation (Giagulli, Scarpini et al. 2004). The final common pathway involving integrin activation requires association actin binding protein talin, and lead to integrin affinity up-regulation (Sampath, Gallagher et al. 1998; Vielkind, Gallagher-Gambarelli et al. 2005; Wegener, Partridge et al. 2007). Talin is a 250 kda cytoskeletal protein that is a key player in integrin activation and links intergrin to actin cytoskeleton. Talin has an N- terminal head region and an elongated helical rod. The head contains a FERM (protein 4.1, ezrin, radixin and moesin) domain that directly associates with NPxY motif (where x denotes any amino acid) of the β-tail domain of the integrins (Moser, Legate et al. 2009). When the head of talin containing FERM domain is overexpressed, it increases adhesion of LFA-1 expressing cells to ICAM-1(Kim, Carman et al. 2003). The C-terminal end of talin has a F-actin binding site and thus provides a direct link between β-integrin tail and actin cytoskeleton (Moser, Legate et al. 2009). In addition to GPCR-dependent inside-out signaling, binding of ligands to integrins also induces outside-in signaling cascades, Figure 1.3 B (Hynes 1992). Paxillin is a signalling adaptor molecule which binds to integrins (Schaller 2001). Ligand induced integrin clustering activates several tyrosine kinases including FAK and Src-family kinases. These phosphorylate paxillin allowing the recruitment of downstream effectors, including ADP-ribosylating factor GTPase activating protein (ArfGAP) which restricts Rac activation to the laeading edge of the polarising cell (Nishiya, Kiosses et al. 2005). Paxillin also recruits PAK interacting exchange factor (PIX) which activates Cdc42 (DeMali, Wennerberg et al. 2003). Src-family kinases also activate Vav1 which leads to activation of Rho GTPases (DeMali, Wennerberg et al. 2003). 18

28 Activation of Rho GTPases leads to mobilization of the actin cytoskeleton and formation of adhesive contacts. Both GPCR- induced inside-out signaling and ligand-induced outside-in signaling link β2 integrins on the neutrophil surface to adhesion molecules on the endothelium, and/or extracellular matrix. 19

29 Figure 1.3: Schematic of inside out and outside in signaling A) Phosphotidyl-inositol-3-kinase (PI3K) and phospholipase C (PLC) are activated downstream of GPCR binding. PI3K activation leads to activation of cytohesin-1 which in leads to integrin activation. Activation of PLC leads to activaton of guanine nucleotide exchange factors (GEFs), such as CALDEG and Vav, and results in the recruitment and activation of Rap-1 and Rhofamily GTPases including Rho A. Rho A then activates PKC-ζ. The final common pathway involving integrin activation requires association actin binding protein talin, and lead to integrin affinity up-regulation B) Ligand-binding induces integrin clustering and intracellular signaling. Srcfamily kinases activate Rho GEFs either directly (Vav1) or through Paxillin (Pix). Paxillin also recruits ArfGAP, which suppresses Rac activity. Modulation of Rho GTPase activity allows for actin remodeling and development of adhesive contacts. 20

30 1.2.3 Transmigration Transmigration is the final step in neutrophil emigration into the inflamed tissue. Emigrating neutrophils cross three distinct barriers which include endothelial cells, the underlying basement membrane and the pericytes (Voisin, Woodfin et al. 2009) Crawling: During transendothelial transmigration, adherent leukocytes first crawl laterally to seek preferred sites of transendothelial migration, namely intercellular junctions. This intravascular crawling is Mac-1 and ICAM-1- dependent and its blockade seems to reduce overall transmigration (Phillipson, Heit et al. 2006). Mac-1 deficient mice show reduced transmigration which occurs preferentially through the transcellular as opposed to the paracellular route (Phillipson, Heit et al. 2006). The mechanisms that mediate the transition from firm adhesion to intraluminal crawling have not been fully elucidated. However, a role for the Rho-GEF Vav-1 has been recently suggested. Analysis of leukocyte responses in Vav-1 deficient mice by intravital microcopy demonstrated defective neutrophil arrest, reduced intra-luminal crawling and reduced transmigration (Phillipson, Heit et al. 2009). Endothelial cells are actively involved in facilitating leukocyte transmigration. Engagement of endothelial ICAM-1 by neutrophil LFA-1 induces formation of microvilli-like endothelial projections rich in ICAM-1, VCAM-1, cytoskeletal linker ERM (ezrin, radixin and moesin) proteins and cytoskeletal components (such as α-actinin, vinculin and talin-1). These docking structures or transmigratory cups then embrace the leukocytes and guide the leukocyte transmigration via paracellular or transcellular route (Barreiro, Yanez-Mo et al. 2002; 21

31 Carman and Springer 2004). Rho GTPases activate the ERM proteins and are involved in generating and maintaining these docking structures (Barreiro, Yanez-Mo et al. 2002) Paracellular Migration: During paracellular migration leukocytes must pass through endothelial cell-cell junctions (Figure 1.4). Multiple endothelial-leukocyte adhesion molecules are engaged and cluster by leukocyte binding, tranducing intracellular signals which ultimately conclude in cytoskeletal remodeling and junctional disruption. These include E-selectin, ICAM-1 and VCAM-1(Hordijk 2006). Besides being involved in leukocyte rolling, E-selectin also transduces signals into the endothelial cell. E-selectin- dependent leukocyte adhesion leads to activation of the mitogen-activated protein kinase (MAPK) signaling cascade in human umbilical venous endothelial cells thus suggesting its role in transendothelial migration (Hu, Kiely et al. 2000; Hu, Szente et al. 2001). ICAM-1 is the key integrin ligand involved in leukocyte transendothelial migration, particularly of neutrophils and lymphocytes. Ligation of leukocyte integrins with endothelial ICAM-1 is associated with increased intracellular calcium and activation of Rho GTPases (Huang, Manning et al. 1993; Adamson, Etienne et al. 1999; Etienne-Manneville, Manneville et al. 2000; Thompson, Randi et al. 2002; Greenwood, Amos et al. 2003). Figure 1.5 describes the signaling events downstream of ICAM-1 engagement. Rho A activates Rho-kinases (ROCK), which subsequently inactivate myosin-specific phosphatase-1 (MYPT-1) through phosphorylation of its regulatory unit (Riento and Ridley 2003). This leads to increased phosphorylation of myosin light chain (MLC) and triggers the formation of stress fibres and actomyosin contractility (Chrzanowska-Wodnicka and Burridge 1996; Riento and Ridley 2003). 22

32 This in turn leads to increased endothelial cell contractility and opening of inter-endothelial contacts thus facilitating leukocyte transendothelial migration (Garcia, Verin et al. 1998; Saito, Minamiya et al. 1998). Inhibition of Rho A activity is associated with reduced leukocyte migration (Adamson, Etienne et al. 1999; Wojciak-Stothard, Williams et al. 1999). In addition to activating RhoA, ICAM-1 cross-linking also leads to phosphorylation of many endothelial cell proteins including paxillin, FAK (focal adhesion kinase), Src, p38 MAPK, ezrin, cortactin and VE-cadherin (Etienne, Adamson et al. 1998; Wang and Doerschuk 2001; van Buul and Hordijk 2004; Yang, Kowalski et al. 2006; Allingham, van Buul et al. 2007; Wittchen 2009). Cortactin (cortical actin binding protein) is a scaffold protein that mediates actin remodeling via Arp 2/3 complex (Weaver, Young et al. 2003). Cortactin further links ICAM-1 engagement during leukocyte adhesion with downstream clustering of E-selectin and ICAM-1 on the endothelial cell surface (Yang, Kowalski et al. 2006). Tyrosine phosphorylation of the adherens junction protein VE-cadherin causes endothelial cell junctional disassembly (Lampugnani, Corada et al. 1997; Garcia, Schaphorst et al. 2000). FAK phosphorylation promotes focal adhesion turnover and perhaps reduced focal adhesions leading to increased transmigration (Mullaly, Moyse et al. 2002; Millan and Ridley 2005). VCAM-1 mediates adhesion of leukocytes expressing VLA-4 to the endothelium. VCAM-1 mediated Rac activation leads to ROS generation via NADPH oxidase and transient adherens junction disruption (van Buul and Hordijk 2004). Blockade of VCAM-1 alone is not sufficient to significantly reduce monocyte transmigration, but blocking both ICAM-1 and VCAM-1 has an additive effect (Ronald, Ionescu et al. 2001). 23

33 Besides endothelial-leukocyte adhesion molecules, many junctional molecules are involved in paracellular migration. The evidence in support of the role of these molecules in leukocyte transendothelial migration comes from use of neutralizing antibodies and genetargeted mice. There is redistribution of these junctional molecules in the inflamed endothelial cells that favours transendothelial migration. The molecules involved include junctional molecules belonging to immunoglobulin superfamily members, platelet endothelial cell adhesion molecule-1 (PECAM-1), junctional adhesion molecules (JAMs) and endothelial cell-selective adhesion molecule (ESAM) as well as non-immunoglobulin molecule CD99 (Wegmann, Petri et al. 2006; Bixel, Petri et al. 2007; Woodfin, Reichel et al. 2007; Woodfin, Voisin et al. 2009). PECAM-1 is expressed on endothelial cells, platelets, neutrophils, monocytes and some T cells (Newman, Berndt et al. 1990). Blocking antibodies to PECAM-1 inhibit neutrophil transendothelial migration in vivo (Vaporciyan, DeLisser et al. 1993). PECAM-1-deficient mice, however showed only limited problems in model of inflammation (Duncan, Andrew et al. 1999). Later studies have shown that this may be dependent on the mice strain (C57/BL6) used. C57/BL6 is uniquely able to compensate for the loss of PECAM function unlike other mice strains (Schenkel, Chew et al. 2004). Junctional adhesion molecules (JAM-A, JAM-B, JAM-C) are expressed in leukocytes, platelets, endothelial and epithelial surfaces. JAMs interact with tight junction associated proteins including zona occludens-1 (ZO-1), afadin (AF-6) and Multi-PDZ Domain Protein- 1(MUPP-1) via their intra-cellular domain (Ebnet, Suzuki et al. 2004). JAMs also engage with leukocyte integrins via their extracellular domain; JAM-A binds to LFA-1, JAM-B associates 24

34 with VLA-4 and JAM-C interacts with Mac-1 (Choi, Santoso et al. 2009). Antibody blocking JAM-A inhibits neutrophil recruitment in mice meningitis model (Del Maschio, De Luigi et al. 1999). JAM-A deficient neutrophils show reduced transendothelial migration in murine models of peritonitis and cardiac IRI (Corada, Chimenti et al. 2005). JAM-C deficient mice display delayed neutrophil recruitment, increased susceptibility to infection, growth retardation and poor survival (Imhof, Zimmerli et al. 2007). ESAM-1 is expressed on endothelial tight junctions and platelets. ESAM-1 deficient mice display reduced neutrophil transendothelial migration in murine models of peritonitis (Wegmann, Petri et al. 2006). CD99 is a heavily glycosylated protein expressed by most leukocytes and endothelial cells (Muller 2009). CD99 blocking antibodies inhibit transendothelial migration in vitro (Schenkel, Mamdouh et al. 2002). Different junctional molecules mediate leukocyte transmigration in either a stimulus-specific or leukocyte-specific manner. For instance, PECAM-1 and JAM-A mediate leukocyte transmigration in response to interleukin-1β (IL-1β) but not TNF (Nourshargh, Krombach et al. 2006). ESAM-1 does not show a stimulus specific role but appears to mediate neutrophil rather than T cell transmigration (Wegmann, Petri et al. 2006). Finally, adherens junction proteins play important role in transendothelial migration. Adherens junctions are present along the paracellular cleft and act as a major barrier to leukocyte transendothelial migration. VE-cadherin is the predominant transmembrane protein forming inter-cellular contacts. VE-cadherin blocking antibodies cause increased leukocyte transendothelial migration both in vitro and in vivo (Gotsch, Borges et al. 1997; Corada, 25

35 Marriotti et al. 1999; Hordijk, Anthony et al. 1999). The intracytoplamic domain of VE-cadherin complexes with α-, β-, and p120-catenin and subsequently associates with actin cytoskeleton (Hordijk, Anthony et al. 1999). VE-cadherin is physically displaced from adherans junctions during transendothelial migration and re-localises within minutes once the leukocyte transendothelial migration is completed (Shaw, Bamba et al. 2001). Tyrosine phosphorylation of VE-cadherins occurs downstream of ICAM-1 cross-linking and has been implicated in the junctional disassembly (Allingham, van Buul et al. 2007) Transcellular Migration In transcellular migration, leukocytes migrate directly through a single endothelial cell (Figure 1.6) (Feng, Nagy et al. 1998). This route represents a small percentage (5-20%) of all leukocyte migration (Carman and Springer 2004). During transcellular migration, ICAM-1 enriched caveolae link together to form vesiculo-vacuolar organelles (VVOs) in the endothelial cells, creating an intracellular passage through which leukocytes can migrate (Dvorak and Feng 2001). Transcellular pathway is more readily observed in vivo, while it is a less preferred route in vitro. Signaling pathways which preferentially drive paracellular vs. transcellular migration are not fully elucidated. Microvascular endothelial cells support transcellular migration more readily than macrovascular endothelial cells (Carman, Sage et al. 2007). Interestingly, incubation of endothelial cells with TNF-α for longer periods or overexpression of ICAM-1 has been shown to increase the relative contribution of the transcellular vs paracellular neutrophil transmigration (Yang, Froio et al. 2005). The transcellular pathway may also become more prominent when intravascular crawling is disabled in vivo (Phillipson, Heit et al. 2006). 26

36 Migration through the endothelial basement membrane and pericyte sheath: After penetrating the endothelial cell barrier, leukocytes then cross the endothelial basement membrane and the pericyte sheath. The endothelial basement membrane is composed of two protein networks composed of vascular laminins and collagen type IV, which are connected by interactions with proteins such as nidogen-2 and the heparan sulfate proteoglycan perlecan (Hallmann, Horn et al. 2005). Wang et al reported the existence of regions of low expression of matrix proteins (such as laminin 10 and collagen IV) within the endothelial basement membrane in unstimulated mouse cremastric venules (Wang, Voisin et al. 2006). These low- expression regions co-localized with gaps between pericytes, allowing neutrophil migration to occur via the path of least resistance, namely these gaps (Wang, Voisin et al. 2006). 27

37 Figure 1.4: Schematic diagram of leukocyte paracellular transendothelial migration Ligation of ICAM-1 is associated with increased intracellular calcium and activation of Rhofamily GTPases and p38 mitogen MAPK pathway which collectively lead to activation of myosin light chain kinase (MLCK). This may lead to endothelial cell contraction and opening of interendothelial junctions. Besides ICAM-1, several other junctional proteins participate in this process. 28

38 Figure 1.5: Schematic diagram of signaling events initiated downstream of ICAM-1 ligation Leukocyte binding to ICAM-1 triggers multiple intracellular signaling pathways within the endothelial cells. Rho family-gtpase activation, calcium signaling, production of ROS and phosphorylation of target proteins are the key pathways involved. These pathways then contribute to actin remodeling and / or junctional disruption that allows transendothelial migration 29

39 Figure 1.6: Schematic diagram of leukocyte transcellular migration Transcellular migration occurs through a single endothelial cell. During the transcellular migration, ICAM-1 translocates to regions rich in actin and caveolae. ICAM- containing caveolae link together to form vesiculo-vacuolar organelles (VVOs) that form an intracellular channel through which leukocytes can migrate. Ezrin, radixin and moesin (ERM) proteins may act as linkers between ICAM-1 and cytoskeletal proteins such as actin and vimentin, causing them to localize around the channel. 30

40 1.3 Slit2: a guidance cue for migrating cells During the development of the central nervous system (CNS), neurons navigate over long distances to make contact with their target cells. Neuronal migration is precisely regulated by repulsive or attractive cues which coordinate and direct the axonal path-finding (Tessier-Lavigne et al., 1996). The guidance cues can either promote or repel migration of neurons and axonal projections. Slit family of secreted proteins and their trans-membrane receptor Roundabout (Robo) were identified through large scale mutant screens for CNS midline crossing defects in Drosophila melanogaster (Rothberg, Hartley et al. 1988; Seeger, Tear et al. 1993). During development, axons normally cross the midline once before projecting towards their synaptic targets. However, the Drosophila Robo mutants exhibit repeated and random crossing of axons in the midline (Kidd, Brose et al. 1998). The Slit mutants demonstrate a complete collapse of commissural and longitudinal axon scaffold onto ventral midline (Rothberg, Jacobs et al. 1990). There are three known isoforms of Slit (Slit1, 2 and 3) and 4 known isoforms of Robo (Robo-1 to 4) and will be described in more detail later (Wu, Feng et al. 2001; Wong, Park et al. 2002) Slit and Robo Structure Slits are secreted glycoproteins (~ kda) and exhibit a high degree of evolutionary conservation between species (Brose, Bland et al. 1999). All Slit proteins possess an N-terminal signal peptide, a long stretch of epidermal growth factor (EGF) repeats, four leucine-rich repeats (LRRs), a further one or three EGF-like domains in invertebrates and vertebrates, respectively, and a C-terminal cysteine knot (Fig 1.3) (Hohenester 2008). The EGF repeats and LRR allow the Slit proteins to interact with extracellular matrix components, such as glypican-1 (Ronca, 31

41 Andersen et al. 2001). Slit2 is proteolytically cleaved after the fifth EGF repeat generating a 140 kda N-terminal (Slit-N) and a kda C-terminal (Slit-C) (Brose, Bland et al. 1999). The identity of protease/s cleaving Slit2 remains elusive. The Slit-N includes the four LRR and the first five EGF repeats. The four LRRs are necessary and sufficient for interaction with Robo and the downstream signaling (Battye, Stevens et al. 2001; Chen, Wen et al. 2001). Thus both full length Slit and the Slit-N retain their repellent activity (Nguyen Ba-Charvet, Brose et al. 2001). The cleaved fragments have different cell-association properties. Full length Slit2 and Slit-N are tightly membrane bound whereas Slit-C is diffusible. Furthermore, Slit-C binds with higher affinity than Slit-N to the heparin sulfate proteoglycan, glypican-1 (Liang, Annan et al. 1999). The Slit receptor, Robo, belongs to the immunoglobulin (Ig) superfamily of transmembrane signaling receptors. The extracellular region of Robo contains five immunoglobulin (Ig) repeats and three fibronectin type III domains. The large cytosolic domain of Robo contains four conserved sequence motifs designated CC0, CC1, CC2 and CC3 (Kidd, Brose et al. 1998; Legg, Herbert et al. 2008; Dickinson and Duncan 2010). The molecular weight of Robo-1 is kDa, and recent studies reveal that it is sequentially cleaved by metalloproteinases and then γ-secretase (Seki, Watanabe et al. 2010). Seki et al also demonstrated nuclear accumulation of Robo-1, which is abolished by either a metalloproteinase inhibitor TAPI-1 or a γ-secretase inhibitor suggesting that the released intracellular fragment of Robo-1 may translocate to the nucleus (Seki, Watanabe et al. 2010). Structural and biochemical analysis has revealed that the second LRR domain of Slit binds to the first and the second Ig domains of Robo (Howitt, Clout et al. 2004; Morlot, Thielens et al. 2007). The intracellular CC motifs of Robo mediate the repulsive response to Slit binding. Deletion of each of the CC motif compromises but does not 32

42 eliminate the repulsive response, suggesting their important but redundant role (Bashaw and Goodman 1999). Robo-4 (also known as magic roundabout) shows significant differences from other Robo members with the extracellular domain containing only two immunoglobulin and two fibronectin domains (Legg, Herbert et al. 2008). Figure 1.7: Structure of Mammalian Slit2 and Robo-1 proteins Mammalian Slit2 contains four leucine rich repeats (LRRs), nine epidermal growth factor (EGF) repeats, a laminin G (G) domain, and a cysteine rich C terminus. The Robo-1 receptor contains five immunoglobulin (Ig) repeats, three fibronectin (FN) type III, a transmembrane Domain (TM) and four conserved cytoplasmic (CC) signaling motifs 33

43 1.3.2 Slit and Robo expression The expression of the Slit genes has been demonstrated in many organisms, including Drosophila (Battye, Stevens et al. 1999), Caenorhabditis elegans (Hao, Yu et al. 2001), Xenopus (Chen, Wu et al. 2000), chickens (Holmes and Niswander 2001), mice (Holmes, Negus et al. 1998), rats (Marillat, Cases et al. 2002) and humans (Itoh, Miyabayashi et al. 1998). Invertebrates have a single Slit protein, however vertebrates have 3 isoforms of Slit, namely Slit 1, 2 and 3. Slit1 is predominantly expressed in the developing CNS while Slit2 and Slit3 are also expressed outside the CNS, in the lung, kidney and heart, and in immune cells (Yuan, Zhou et al. 1999; Wu, Feng et al. 2001). Robo expression has been demonstrated in Drosophila (Kidd, Brose et al. 1998), mice (Yuan, Zhou et al. 1999) and humans (Kidd, Brose et al. 1998). Caenorhabditis elegans has single Robo isoform, Drosophila has 3 Robo isoforms and vertebrates have four isoforms of Robo (Robo-1, Robo-2, Robo-3 and Robo-4) (Dickinson and Duncan 2010). Robo-1 is most highly expressed outside the CNS, including on immune cells (Wu, Feng et al. 2001). Robo-2 can be detected in the spleen, liver, thymus, kidney, ovaries and brain of adult organisms and in embryonic tissue (Dallol, Dickinson et al. 2005). Robo-3 is almost exclusively expressed in the brain (Liu, Hou et al. 2006). Robo4 is specifically expressed by endothelium and is implicated in angiogenesis (Park, Morrison et al. 2003; Suchting, Heal et al. 2005). The tissue expression of Slit and Robo are complementary, suggesting a functional ligand-receptor relationship (Yuan, Zhou et al. 1999). 34

44 1.3.3 Slit and Robo Function In addition to their role as axonal guidance cues, Slit and Robo also play a crucial role in development of other organ systems. For example, studies in Drosophila have demonstrated that Slit and Robo mutants have disruption of cardiac polarity, cell polarity and cell migration (Qian, Liu et al. 2005; MacMullin and Jacobs 2006). Slit1 homozygous mutant mice appear phenotypically normal while Slit2 homozygous deficiency is lethal (Plump, Erskine et al. 2002). Slit3 mice are viable but their morbidity and mortality increases beyond 30 post-natal days. These mice have higher incidences of congenital diaphragmatic hernia, renal agenesis and cardiac defects (Liu, Zhang et al. 2003; Yuan, Rao et al. 2003). Robo-1 homozygous mutant mice die at birth due to incomplete lung development (Xian, Clark et al. 2001). Robo-2 and Robo-3 homozygous mutant mice also die soon after birth (Grieshammer, Le et al. 2004; Sabatier, Plump et al. 2004). Slit and Robo play important roles in nephrogenesis. Renal abnormalities are observed in Slit2, Slit3 and Robo-2 deficient mice (Liu, Zhang et al. 2003; Grieshammer, Le et al. 2004). Kidney development is normal in Robo1 mutant homozygotes. During nephrogenesis, the ureteric bud arises from the nephric duct in response to glial cell line-derived neurotrophic factor (GDNF) secreted by the adjacent nephrogenic mesenchyme. Posterior restriction of GDNF is critical for correct ureteric bud positioning. Slit2 and Robo-2 deficient mice display abnormal patterns of GDNF secretion and supernumerary ureteric buds that remain inappropriately connected to nephric duct thus leading to hydroureter (Grieshammer, Le et al. 2004). Furthermore, variations in the human Robo-2 gene have been associated with familial 35

45 vesicoureteral reflux (Bertoli-Avella, Conte et al. 2008), a condition with improper insertion of ureters into the bladder resulting in retrograde flow of urine from the bladder to the kidney. Slit2/Robo1 expression persists in the adult organism, suggesting a role for Slit proteins beyond embryogenesis. Slit2/Robo has been shown to inhibit aortic smooth muscle cell migration toward a gradient of platelet-derived growth factor (PDGF) (Liu, Hou et al. 2006). Slit2 has also been shown to inhibit cancer cell migration, thus preventing cancer cell metastasis. Human breast cancer cells express both Robo and the chemokine receptor, CXCR4. Slit2 inhibited breast cancer cell chemotaxis towards the CXCR4 ligand, CXCL12 and cancer cell adhesion and chemo-invasion in one study (Prasad, Fernandis et al. 2004). Slit2 promoter gene is frequently inactivated due to hypermethylation thus suggesting a tumour suppressor role (Dallol, Da Silva et al. 2002; Dallol, Morton et al. 2003). Furthermore, Slit2 has been shown to inhibit colony formation in colorectal, breast and lung cancer cell lines (Dallol, Da Silva et al. 2002; Dallol, Morton et al. 2003). Collectively these studies suggest a critical role of Slit and Robo outside of the developing central nervous system Slit2/Robo1 intracellular signal transduction Studies in neuronal tissue have demonstrated that Robo-1 signals via cytoplasmic CC motifs through two major pathways: Enabled (Ena) protein and Rho GTPases. Ena and its mammalian homologue (Mena) modulate the actin cytoskeleton rearrangement by binding to prolifin, an actin binding protein which regulates actin polymerisation (Pantaloni and Carlier 1993). Ena has been demonstrated to be a substrate for the Abelson (Abl) kinase, and is implicated in normal axonal guidance (Gertler, Bennett et al. 1989). Genetic and biochemical evidence has revealed a 36

46 role for Abl and Ena in Slit/Robo signaling during axonal guidance (Bashaw, Kidd et al. 2000). Ena binds to Robo via the CC1 and CC2 motif whereas Abl binds the CC3 motif. Ena mediates part of Robo repulsive function whereas Abelson antagonises it (Bashaw, Kidd et al. 2000). Interruption in Ena binding to Robo leads to impaired Robo function, while a mutation in conserved cytoplasmic tryrosine, which can be phosphorylated by Abl, leads to Robo hyperactivity suggesting opposite roles of Ena and Abl on Slit-Robo signaling (Bashaw, Kidd et al. 2000). A second pathway through which Slit/Robo mediates cell repulsion is through modulation of Rho-family GTPase activity. Wong et al discovered a family of GTPase activating proteins, Slit Robo GTPase activating proteins (srgaps), which bind Robo (Wong, Ren et al. 2001). The srgaps contain a Fer-CIP4 homology (FCH) domain, a Src-homology 3 (SH3) domain and a Rho GTPase activating protein (Gamblin and Smerdon) domain. The SH3 domain is required for binding to the CC3 motif of Robo, the RhoGAP domain regulates the activity of Rho GTPase Rho, Rac and Cdc42. The function of FCH domain is unknown (Wong, Ren et al. 2001). In HEK 293 cells not expressing Robo-1, Slit2 did not change levels of the active form of Cdc42. However in HEK 293 cells expressing Robo-1, srgap bound to and inactivated Cdc42 and RhoA, but not Rac1. Furthermore, the expression of a srgap1 mutant lacking GAP abolished Slit regulation of RhoA and Cdc42 but not Rac1. In the same study, transfection of constitutively active Cdc42 was able to rescue the Slit2 mediated migratory defect of neurons (Wong, Ren et al. 2001). Collectively these data suggest a model where Slit and Robo binding leads to recruitment of srgap and inactivation of Rho GTPases, with subsequent inhibition of actin remodeling and cell motility. 37

47 Figure 1.8: Slit/Robo intracellular signal transduction Binding of Robo-1 to Slit2 results in recruitment of srgap, which converts active GTP bound form of Cdc42 to inactive GDP bound forms, thus inhibiting actin assembly. Enabled protein also binds to Robo-1 and may contribute to Robo-mediated repulsion whereas Abelson kinase can phosphorylate Robo and thus antagonise its action 38

48 1.3.5 Slit/Robo in leukocyte trafficking Both neuronal and leukocyte cell migration share similar features and require the recognition of guidance cues, generation of cell polarity and mobilization of the actin cytoskeleton machinery. Thus, not surprisingly, Slit has been also been found to inhibit leukocyte migration (Guan, Zu et al. 2003; Kanellis, Garcia et al. 2004; Prasad, Qamri et al. 2007). The effect of Slit2 on leukocyte chemotaxis was first described by Wu et al. This study used transwell migration assays to demonstrate that Slit2 inhibits the chemotaxis of rat lymphocytes to stromal derived factor-1α (SDF-1α) and neutrophil-like HL-60 cells to fmlp gradients (Wu, Feng et al. 2001). Similarly, Kanellis et al demonstrated that Slit2 inhibited RAW murine macrophages and rat glomerulonephritic inflammatory leukocytes towards monocyte chemoattractant protein-1 (MCP-1) and formyl methionyl-leucyl-phenylalanine (fmlp) respectively (Kanellis, Garcia et al. 2004). Another study showed that Slit2 inhibited migration of Langerhans dendritic cells (DCs) thus reducing contact hypersensitivity responses and decreasing inflammation (Guan, Zu et al. 2003). Prasad et al demonstrated that Slit2 inhibits chemotaxis of Jurkat T lymphocytes towards SDF-1α (Prasad, Qamri et al. 2007). Furthermore, our group demonstrated that Slit2 prevents chemotactic migration of neutrophils to diverse chemoattractants both in vitro and in vivo (Tole, Mukovozov et al. 2009). Collectively these data demonstrate that Slit2 may have a therapeutic role as a universal inhibitor of leukocyte migration. 39

49 1.4 Rho GTPases: Rac and Cdc42 The small GTPases of the Rho family are a part of the Ras superfamily of small GTPbinding proteins. To date, over 20 mammalian Rho-family GTPases have been characterized, and these can be grouped into several subfamilies: Rac (Rac1, Rac2, Rac3, RhoG), Rho (RhoA, RhoB, RhoC), Cdc42 (Cdc42, TCL/Rho J, TC10/Rho Q), Rnd (Rnd1, Rnd2, Rnd3/RhoE), RhoD, Rho BTB (RhoBTB1, RhoBTB2) and TTF/Rho H (Kjoller and Hall 1999; Heasman and Ridley 2008). Rho GTPases are pivotal regulators of signaling pathways that control diverse cellular functions including cell polarity, migration, vesicle trafficking and cell cycle progression (Hall 1998; Hall and Nobes 2000; Heasman and Ridley 2008) Structure and Regulation All Rho GTPases contain 2 main structural domains, a catalytic GTP domain and the C- terminal CAAX motif (cysteine (C) followed by two aliphatic amino acids (AA) and a terminal amino acid (X). The GTPases undergo post-translational modifications at the C-terminal CAAX motif, involving covalent addition of isoprenoid moieties to the cysteine residue, carboxy-terminal proteolysis of the AAX residues followed by carboxy-methylation. The modified C-terminal domain then allows the protein to associate with membrane lipids (Casey, Solski et al. 1989; Gutierrez, Magee et al. 1989; Fujiyama and Tamanoi 1990). The catalytic domain of Rho GTPases consists of switch I and switch II, corresponding to different conformations in GTP-bound and GDP-bound states (Karnoub, Symons et al. 2004). The N- terminal catalytic domain of GTPases allows for conformational changes, via binding to GDP or 40

50 GTP. Rho GTPases cycle between the inactive, GDP-bound state and the active GTP-bound forms (Olofsson 1999; DerMardirossian and Bokoch 2005). Figure 1.9: Structure of Cdc42/Rac1 Rho GTPases contain 2 main structural domains, a catalytic GTP domain at the N- terminal and the C-terminal CAAX motif (cysteine (C) followed by two aliphatic amino acids (AA) and a terminal amino acid (X). The N-terminal catalytic domain of GTPases allows for conformational changes, via binding to GDP or GTP. The catalytic domain of Rho GTPases consists of switch I and switch II, corresponding to different conformations in GTP-bound and GDP-bound states. The C-terminal domain allows the protein to associate with lipid. Attachment of the lipids at the C-terminal then facilitates membrane association and subcellular localisation of Rho GTPases. 41

51 The active GTP-bound form of the protein can transduce signals via interactions with downstream targets or effector molecules to produce a cellular response (Kjoller and Hall 1999; Heasman and Ridley 2008). Activity of Rho GTPases is tightly controlled by three classes of regulatory molecules: guanine nucleotide exchange factors (GEFs), guanine nucleotide dissociation inhibitors (GDIs) and GTPase-activating proteins (GAPs). GEFs catalyze the exchange of GDP for GTP, leading to activation of Rho GTPases. Rho GEFs are characterised by the presence of a DH (Dbl) homology domain followed by a PH (pleckstrin homology) domain. The DH domain of Rho GTPases is critical for the recognition of GEF s by their specific targets. The PH domain targets GEFs to specific subcellular membranes through interaction with lipids (Schmidt and Hall 2002; Rossman, Der et al. 2005). The second class of regulatory proteins, GDIs, sequester the Rho-family GTPases in the cytosol and inhibit their activity in several ways. First, GDIs maintain the GTPases in an inactive form by preventing dissociation of GDP from the GTPases. Second GDIs can bind to isoprenyl moieties in the C-terminus of GTPases in order to sequester them in the cytosol thus preventing their membrane localization (Olofsson 1999). Third, although Rho GDIs usually bind to GDP-bound GTPases with high affinity, they can also interact with the GTP-bound forms and prevent their activation by GEFs. All of these actions of GDIs prevent the activation of RhoGTPases. The third class of regulatory proteins, GAPs suppress activity of Rho-family GTPases by enhancing the intrinsic rate of GTP hydrolysis to GDP. To date, more than 70 eukaryotic Rho GAPs have been identified (Tcherkezian and Lamarche-Vane 2007). Although GTPases have 42

52 intrinsic GTPase activity (Vetter and Wittinghofer 2001), the rate of GTP hydrolysis is relatively very low, but can be accelerated by order of magnitude upon interaction with Rho GAPs (Vetter and Wittinghofer 2001). There exists a large diversity in primary sequence of the various GAPs, but their tertiary structure as well as the basic GTPase-activating mechanism is similar. Rho GAPs bind to the nucleotide-contacting core of Rho GTPases and lead to a conformational structural change. Consequently, an essential arginine residue of GAPs together with a glutamine residue of the GTPases is responsible for positioning a water molecule in the vicinity of GTP, thereby triggering hydrolysis to inactivate the GTPases (Moon and Zheng 2003; Bos, Rehmann et al. 2007). The specificity of individual GAPs for different Rho-family GTPases is thought to be determined by residues outside the nucleotide-binding core of the GTPases (Li, Zhang et al. 1997). 43

53 Figure 1.10: Regulation of Rho GTPases Rho GTPases cycle between active GTP bound forms and inactive GDP bound forms. Regulation of this molecular switch mechanism is controlled by opposing activities of guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs). GEFs catalyse the exchange of GDP for GTP whereas GAPs increase the rate of hydrolysis of GTP to GDP. Further GDP dissociation factors (GDIs) sequester Rho away from GDP-GTP cycle 44

54 1.4.2 The role of Rho-family GTPases in regulation of the actin cytoskeleton The movement of eukaryotic cells relies on coordinated extension of actin-rich lamellipodia in the leading edge and retraction of the uropod at the rear of the cell. The extension of the lamellae at the leading edge involves rapid turnover of actin filaments (Symons and Mitchison 1991). More stable actin-myosin cables can be found in more established protrusions in the middle and rear of the cell (DeBiasio, Wang et al. 1988). Thus, cell motility requires the co-ordinated polymerisation of actin in protrusions at the leading edge and contraction of actin-myosin cables at the middle and rear of the cell. Actin polymerisation is in turn regulated by Rho GTPases (Machesky and Hall 1997). Most of our understanding on the biological functions of Rho GTPases has been obtained from studies of RhoA, Rac1 and Cdc42, the three most extensively characterised family members of Rho GTPases. Activation of Rho A, Rac1 and Cdc42 in fibroblasts is observed to lead to formation of distinctive cytoskeletal structures. Rho A induces stress fibres and focal adhesions, while activation of Cdc 42 induces formation of filopodial microspikes (Nobes and Hall 1995; Hall 1998; Raftopoulou and Hall 2004). Finally, activation of Rac stimulates the formation of sheet-like lamellipodia (Nobes and Hall 1995; Hall 1998; Raftopoulou and Hall 2004). As critical regulators of actin cytoskeleton dynamics and cell morphology, Rho GTPases play an important role in regulation of neutrophil chemotactic migration and adhesion. For example generalised blockade of Rho GTPases in human neutrophils with Clostridium difficile toxin A leads to marked decrease in neutrophil chemotaxis and increased adhesion (Brito, Sullivan et al. 45

55 2002). Cdc 42 deficient mice neutrophils display markedly reduced chemotaxis (Szczur, Zheng et al. 2009). Rac2 is the predominant isoform in human neutrophils whereas murine neutrophils express similar amounts of Rac1 and Rac2 (Li, Yamauchi et al. 2002). Selective deletion in of Rac 1 in mouse neutrophils results in defective directional and display random migration. They have normal adhesion but increased cell spreading (Gu, Filippi et al. 2003; Sun, Magalhaes et al. 2007). Mice neutrophils deficient in Rac2 move slowly but are able to migrate towards chemoattractant gradient. Similar to Rac 1 deficient neutrophils, Rac2 deficient neutrophils display normal adhesion (Gu, Filippi et al. 2003) The role of Rho-family GTPases in regulation of innate immune function Rho GTPases play important role in innate immune responses such as neutrophil chemotaxis, phagocytosis and production of reactive oxygen species (Bokoch 2005). Neutrophil chemotaxis and phagocytic destruction of pathogens requires mobilisation of actin cytoskeleton and consequent cell shape changes mediated by Rho GTPases (Ridley, Schwartz et al. 2003). The production of reactive oxygen species depends on Rac activation which is modulated by antagonistic cross-talk with Cdc42 (Roberts, Kim et al. 1999; Kim and Dinauer 2001). 1.5 Rationale, Hypothesis and Objectives Rationale Infiltration of leukocytes, especially neutrophils, causes AKI associated with IRI (Okusa 2002).. Neutrophils are recruited to the injured kidney by a number of attractants produced locally, especially IL-8 (Furuichi, Wada et al. 2002). Macrophages, T lymphocytes and dendritic cells also play an important, albeit less prominent role. Once recruited to the injured kidney, neutrophils firmly adhere to the sticky endothelium activated by locally produced 46

56 TNF-α. Neutrophils eventually undergo trans-endothelial migration into the injured kidney and promote and perpetuate the organ damage by releasing inflammatory mediators (Furuichi, Wada et al. 2003; Friedewald and Rabb 2004; Fiorina, Ansari et al. 2006). Therapies targeting neutrophil adhesion are partially effective in ameliorating the injury associated with AKI (Kelly, Williams et al. 1994; Singbartl, Green et al. 2000). However given the diversity of the attractants which recruit neutrophils, and the involvement of leukocyte subsets other than neutrophils, it is unlikely that a single therapy will be entirely effective (Salmela, Wramner et al. 1999). Rho-family GTPases are involved in individual steps of neutrophil recruitment; capture/rolling, adhesion and transendothelial migration. We have shown that Slit2 inhibits neutrophil chemotaxis via inhibition of Rho-family GTPases (Tole, Mukovozov et al. 2009). We aimed to explore whether Slit2 will inhibit the subsequent steps of neutrophil recruitment and whether this will ameliorate renal damage post IRI. In addition, given the criticl role of Rhofamily GTPases in leukocyte innate immune functions, we aimed to explore the effect of Slit2 in an L. monocytogenes mice infection Hypotheses Slit-2/Robo-1 signaling can inhibit individual steps in neutrophil migratory cascade namely: capture and rolling, adhesion and transendothelial migration. Preadministration of exogenous Slit2 will ameliorate AKI associated with IRI Objectives 1) To determine the effect of Slit2 on neutrophil capture/rolling in inflammation under flow conditions. 2) To determine the effect of Slit2 on neutrophil adhesion 3) To determine the effect of Slit2 on transendothelial migration 47

57 4) To determine the effect of Slit2 in modulating acute kidney injury associated with IRI 5) To determine the effect of Slit2 on hepatic bacterial load of L.monocytogenes in mice. 48

58 CHAPTER 2 MATERIAL AND METHODS 2.1 Reagents and antibodies Unless otherwise stated, reagents were purchased from Sigma-Aldrich (St.Louis, MO). Polymorphprep neutrophil separation medium was purchased from Axis-Shield (Norway). Transwell inserts were purchased from Corning Costar, USA. Except as noted, all antibodies were purchased from ebioscience and used at concentration of 5µg/ml. 2.2 Slit2 expression and purification Production of full length human Slit2 was previously described (Tole, Mukovozov et al. 2009). A truncated N-terminal fragment of mouse Slit2 (N-Slit2, 874 AA, Gln26-Gln 900), was purchased from R& D systems (Minneapolis, MN). In some experiments, full length Slit2 was purified by myc antibody affinity purification, as previously described (Tole, Mukovozov et al. 2009). 2.3 Immunohistochemistry Immunoperoxidase staining was performed on formalin-fixed, paraffin-embedded tissue sections. Microwave antigen retrieval was carried out in citrate buffer for 20 min at mediumhigh setting (Panasonic NN-S758WC, 950-W maximum output, Panasonic, Mississauga, ON, Canada) followed by 30 min of cooling at room temperature (Waters, Wu et al. 2008). Sections were blocked in Universal Blocking Reagent (DAKO, Mississauga, ON, Canada) for 1 h then incubated with anti-slit2 antibody (Santa Cruz Biotech, 3.6µg/ml) at 4 C overnight. Biotinconjugated secondary antibody (1.5µg/ml) in blocking reagent was incubated at room temperature for 1 h. Immunoperoxidase staining was developed using the Vectastain ABC kit (Vector Laboratories). Slides were scanned with Zeiss Mirax Slide scanner using 20 x/

59 Zeiss objective. Mirax digital slide viewer was used for displaying the slides. Pictures were taken using digital zoom of 20x (Varga, Ficsor et al. 2009). 2.4 Isolation of primary human neutrophils Human whole blood was obtained from healthy volunteers, and neutrophils were isolated using the Polymorphprep gradient separation as previously described (Tole, Mukovozov et al. 2009). Prior to use, neutrophils were resuspended in HBSS containing 1 mm CaCl 2 and 1 mm MgCl 2. Experiments were performed within 1 2 h of isolation of neutrophils (Tole, Mukovozov et al. 2009). 2.5 Neutrophil endothelial adhesion Assays Freshly isolated human neutrophils were labeled with calcein and were incubated with medium alone or full length Slit2 (4.5 µg/ml) for 10 minutes (Tole, Mukovozov et al. 2009). Neutrophils (10 5 cells/well) were incubated with confluent HUVEC monolayer and allowed to adhere for 30 minutes (Foreman, Vaporciyan et al. 1994). Non-adherent cells were then removed by centrifuging the 96 well plates upside down at 100g for 1 minute. Neutrophil adhesion was quantified using the fluorescent plate reader at excitation and emission wavelengths of 494 and 517 nm. In some wells, HUVEC were incubated with TNF-α for 4 h prior to incubating with neutrophils. 2.6 Hypoxia-reoxygenation (H/R) of endothelial cells To simulate IRI in an in vitro system, HUVEC were grown in EBM-2 and maintained at 37 C in a standard incubator at room air oxygen tension (21% oxygen). Hypoxic conditions were induced by exposing cells to 1% oxygen, balance nitrogen at 37 C (Arnould, Michiels et al. 50

60 1994). Ambient PO 2 within the chamber was calibrated and monitored during the entire experiment using Proox 110 oxygen controller system (Biospherix, USA). Cells were exposed to 2 h of hypoxia followed by variable periods of re-oxygenation ranging from 0.5 h to 3 h. In some wells, HUVEC were incubated TNF-α (20ng/ml) for 4 to activate them (Fong, Robinson et al. 1998). 2.7 Reverse transcriptase-polymerase chain reaction (RT-PCR) Total RNA was isolated from HUVEC using one-step RNA reagent (BIO BASIC INC) following the manufacturer s instructions. RT-PCR was performed using QIAGEN one-step RT-PCR kit (QIAGEN) with 1 µg of total RNA. The primers for human Robo 1-4 and corresponding RT-PCR product sizes are summarized in table 1. Reaction mixtures were subjected to the amplification procedure as per manufacturer s instructions. PCR products were separated by 1.5 % agarose gel electrophoresis. 51

61 Table 2 Summary of the primers used for RT-PCR Name Primer PCR Product size Exon spanning (bp) h-robo1-f CTATCGGCCATCTGGAGCCAAC to 17 h-robo1-r GGAACAAGAAAGGGAATGACCACG h-robo2-f CAACTGGAGACCTCACAATCACC to 9 h-robo2-r GTGCCTTGCTCTTGAATTGTTGC h-robo3-f ATCACGATCCGTGGAGGGAAGC to 6 h-robo3-r TCATCTTCGGCACTCACATGC h-robo4-f AGACCCACACCACCTCCTGCC to 3 h-robo4-r TAAACTGCTCACCCACCACAGC (4, 5-Dimethylthiazol-2-yl)-2, 5-Diphenyltetrazolium Bromide (MTT) assays To determine the viability of cells following H/R injury, MTT assays were performed as per manufacturer s instructions (Pieters, Huismans et al. 1988). Mitochondrial dehydrogenases of viable cells cleave the tetrazolium ring, yielding purple formazan crystals which are insoluble in aqueous solutions. Crystals were dissolved in acidified isopropanol and results read spectrophotometrically at a wavelength of 570 nm. The background absorbance was measured at 670 nm and subtracted from 570 nm measurement. In some experiments cells were exposed to staurosporine (1µmolar) for 2 h. All experiments were carried out in triplicate. 52

62 2.9 Neutrophil adhesion under hydrodynamic shear flow conditions HUVEC were grown to confluence in channels of the Bioflux microfluidic system (Fluxion Biosciences, CA) coated with fibronectin (50µg/ml) for 1 h. HUVEC were incubated with TNF-α (20ng/ml) for 4 h. Calcein-labeled human neutrophils (3 x10 5 / well) were preincubated with Slit2 (4.5 µg/ml) for 10 min, then perfused through the channels at a shear rate of 0.5 dynes/cm 2 (Simon, Hu et al. 2000; Ahrens, Ellwanger et al. 2008). The system temperature was maintained at 37 C throughout the course of experiments. A Nikon TE2000 inverted microscope and Hamamatsu video camera was used to video record interactions between neutrophils and HUVEC. Sequential images were recorded every 6 s for 15 min in a representative field. At the end of this period, 4 additional fields were each recorded for 30s. Neutrophil adhesion was quantified with Bioflux Montage software. In other experiments, neutrophil-endothelial interactions were recorded at 1 min after starting flow and the number of neutrophils which were rolling and arrested determined. Only cells that remained stationary for at least 6 s were defined as stably adherent (Jones, Smith et al. 1996) 2.10 Neutrophil transmigration assay HUVEC were grown to confluence on fibronectin-coated polyester transwell inserts (diameter, 6.5 mm; pore size, 3 μm, Corning Costar) placed in a 24-well plate. Freshly isolated, human neutrophils (5 x10 6 cells/ml) were labeled with calcein, then incubated with Slit2 (4.5 µg/ml) for 10 min. Thereafter, neutrophils (5x10 5 ) were placed in the upper well of the transwell chamber and the chemokine interleukin-8 (IL-8, 50 ng/ml) added to the lower well (Bayat, Werth et al. 2010). Neutrophils were allowed to migrate for 3 h at 37 C. At the end of 3 h the neutrophils which had migrated from the upper to the lower well were permealized with 53

63 1% Triton and the resulting lysates transferred in triplicate to a 96 well plate. The fluorescence emitted was read using a fluorescent plate reader at excitation and emission wavelengths of 494nm and 517 nm respectively (Bayat, Werth et al. 2010) 2.11 Mouse model of renal ischemia-reperfusion injury Experiments were performed as previously described (Li, Huang et al. 2007; Li, Huang et al. 2008; Awad, Rouse et al. 2009; Li, Huang et al. 2010). All animals were handled and procedures were performed in adherence to the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and all protocols were approved by the University of Virginia Institutional Animal Care and Use Committee. Male C57BL/6 mice (8-12 weeks of age, Charles River Laboratories, Wilmington, MA) were subjected to bilateral clamping of the renal pedicles for 26 min followed by 24 h reperfusion, as previously described (Li, Huang et al. ; Li, Huang et al. 2007; Li, Huang et al. 2008). Control, sham-operated mice underwent a similar surgical procedure, however the renal pedicles were not clamped. Mice were injected intraperitoneally with full length Slit2 at the indicated doses, N-Slit2 (2 µg) or vehicle 1 h prior to induction of IRI. After 24 h, mice were sacrificed, and kidneys harvested. Prior to euthanasia, blood was drawn by cardiac puncture and plasma creatinine was determined using a colorimetric assay according to the manufacturer's protocol (Sigma Aldrich) (Li, Huang et al. 2008; Li, Huang et al. 2010) Histologic Scores Kidney sections (4 μm) were stained with hematoxylin and eosin and viewed by light microscopy (Zeiss AxioSkop), and images were taken using a SPOT-RT Camera (software 54

64 version 3.3; Diagnostic Instruments, Sterling Heights, MI) under X 200 magnification. For quantification of tubular injury score, sections were assessed by counting the percentage of tubules that displayed cell necrosis, loss of brush border, cast formation, and tubule dilation as follows: 1 = < 10%; 2 = 10 to 25%; 3 = 26 to 50%; 4 = 51 to 75%; 5 = > 75%. 2 to 3 fields from each outer medulla were evaluated and scored separately by 2 individuals blinded to treatment category (Li, Huang et al. 2010) Flow cytometry analysis After IRI, flow cytometry was used to quantify the infiltrating leukocyte subsets in the injured kidney (Li, Huang et al. 2007). In brief, kidneys were harvested, weighed, minced, and incubated with collagenase type IA (10µg/ml; Sigma-Aldrich) in cold Dulbecco s PBS buffer with EDTA (2 mm) for 15 min at 37 C. The digested kidney tissue suspension was teased through a 100µm BD Falcon cell strainer (Fisher Scientific) via the rubber end of a 1 ml syringe plunger, passed through a cotton column treated with 10% FCS, and centrifuged at 1200 rpm/min for 10 min. The cell pellet was washed with 1% BSA in PBS containing 0.1% sodium azide (Sigma-Aldrich). After blocking nonspecific Fc binding with anti-mouse CD16/32 (2.4G2), fresh cell suspensions were incubated with fluorophore-tagged anti-mouse CD45 (30- F11) to determine total leukocyte cell numbers. CD45-labeled samples were further labeled with different combinations of anti-mouse F4/80-APC (BM8), GR-1-FITC (Ly6G), CD11b-PE, CD11c-APC and IA-PE (MHCII) to identify dendritic cells (CD11b+ F4/80high), macrophages (CD11b+ F4/80 low), neutrophils (CD11b+ GR1+) and activated dendritic cells (CD11c+ MHCII+). 7-AAD (BD Biosciences, San Jose, CA) was added 15 min before analyzing the sample to separate live from dead cells (Li, Huang et al. ; Li, Huang et al. 2007). Appropriate 55

65 fluorochrome-conjugated, isotype-matched, irrelevant monoclonal antibodies were used as negative controls. Subsequent flow cytometry data acquisition was performed on BD FACS Calibur. Data were analyzed using FlowJo software 6.4 (Tree Star) Murine infection with Listeria Monocytogenes Six to eight week old C57BL/6J mice were purchased from Jackson Laboratory. N-Slit2 (2µg/mouse) or control vehicle was delivered via intravenous injection in the lateral tail vein. L. monocytogenes (5x10 4 CFU) in 200 µl of PBS was injected intravenously 1h later. Mice were sacrificed at the indicated time points and the livers were harvested. The left lobe of liver was homogenized in sterile PBS for quantification of bacterial colony forming units from serial dilutions on BHI-agar plates. Statistical analysis SPSS statistical software (Version 19.0) was used to analyze the data. Data were analyzed using 2-tailed t test or 1-way ANOVA with post-hoc analysis as appropriate. p < 0.05 was used to indicate significance. 56

66 CHAPTER 3 RESULTS 3.1 Slit2 expression increases in the kidney following IRI We postulated that during renal IRI, endogenous levels of Slit2 may decrease, thereby enabling robust recruitment of circulating neutrophils. To determine how AKI affects the levels of Slit2 found in kidney, we used a well-established mouse model of bilateral renal IRI (Li, Huang et al. 2007; Li, Huang et al. 2008; Li, Huang et al. 2010). Using immunohistochemistry we detected increased expression of Slit2 in kidneys subjected to IRI as compared to kidneys subjected to sham-surgery (Figure 3.1 a-c). The pattern of Slit2 expression was mostly in tubular epithelial cells. These results suggest that during IRI, production of Slit2 in the kidney increases in a compensatory effort to prevent excess recruitment of inflammatory cells. 3.2 Slit2 inhibits neutrophil adhesion to activated endothelial cells To determine whether administration of exogenous Slit2 can prevent neutrophil in filtration and kidney injury following hypoxic injury, we first established a cell culture model of IRI. We have previously shown that the Slit2 receptor, Robo-1, is expressed in neutrophils and that Slit2 inhibits the first step of the neutrophil recruitment cascade, namely chemotaxis of neutrophils towards diverse chemoattractants by preventing activation of small Rho-family GTPases (Tole, Mukovozov et al. 2009). The subsequent step in the leukocyte adhesion cascade, namely adhesion of neutrophils to activated endothelial cells, also involves activation of Rhofamily GTPases (Wojciak-Stothard, Williams et al. 1999; Chen, Zhang et al. 2003). We, therefore, next tested the effects of Slit2 on adhesion of fluorescently labeled human neutrophils 57

67 to primary human umbilical vascular endothelial cells (HUVEC). Since exposure of endothelial cells to IRI is associated with enhanced local production of the inflammatory cytokine tumor necrosis factor- α (TNF-α), we first tested Slit2 s effects on neutrophil adhesion to HUVEC activated by TNF-α. There was minimal neutrophil adhesion under basal conditions (Figure 3.2; mean fluorescence intensity 46.5 ± 10.6 arbitrary units, AU). Activation of HUVEC by TNF-α increased neutrophil adhesion by 3 fold (Figure 3.2; ± 28.5 AU, p < 0.05 vs. control). In the presence of Slit2, neutrophil adhesion was significantly decreased (Figure 3.2; TNF-α ± 28.5 AU vs. TNF-α + Slit ± 12.8 AU, p < 0.05). We postulated that observed effects of Slit2 could conceivably result from direct actions on either neutrophils and/or on HUVEC. We, therefore, next determined the expression of Robo isoforms by HUVEC using RT-PCR (Figure 3.3 a). In keeping with the results reported previously, we found that HUVEC express Robo-1, 2 and 4 (Dickinson, Myers et al. 2008). To determine whether the observed effects of Slit2 result from its actions on neutrophils vs. endothelial cells, neutrophils were incubated with Slit2 for 10 min and unbound Slit2 was washed away prior to performing the adhesion assays. When unbound Slit2 was removed, neutrophil adhesion was inhibited to the same extent as when Slit2 was present throughout the assay (Figure 3.3 b). Collectively, these data demonstrate that Slit2 acts directly on neutrophils rather than on endothelial cells to impair neutrophil adhesion to injured endothelium. 3.3 Slit2 inhibits neutrophil adhesion to endothelial cells subjected to hypoxic injury We next examined the effect of Slit2 on adhesion of neutrophils to primary endothelial cells exposed to simulated ischemia-reperfusion injury (SI/R) (Arnould, Michiels et al. 1994). We first ascertained that SI/R resulted in endothelial injury using (3-[4, 5-dimethylthiazol-2-yl]- 58

68 2, 5-diphenyl tetrazolium bromide) or MTT assay, as previously described (supplementary Figure 3.3 c) (Pieters, Huismans et al. 1988). We next tested the effects of Slit2 on neutrophil adhesion to HUVEC exposed to SI/R. When HUVEC were exposed to 2 h hypoxia followed by 0.5 h or 3 h of re-oxygenation, the mean fluorescence intensity increased from 46.5 ± 10.6 AU to 89.9 ± 13.4 AU and 80.2 ± 3.2 AU respectively (Figure 3.2; SI/R vs. control, p < 0.05). Neutrophils pre-incubated with Slit2 demonstrated significantly less adhesion to HUVEC exposed to SI/R following re-oxygenation periods of both 0.5 h (Figure 3.2; No Slit ± 13.4 AU vs. Slit ± 2.9 AU, p < 0.01) and 3 h (Figure 3.2; No Slit ± 3.2 AU vs. Slit ± 5.3 AU, p < 0.01). These data demonstrate that Slit2 prevents adhesion of neutrophils to endothelium following injury caused by hypoxia/re-oxygenation. 3.4 Slit2 reduces neutrophil capture by and adhesion to activated endothelial cells The static adhesion assays described above test Slit2 s effects on steps of the leukocyte adhesion cascade mediated by interactions between leukocyte integrins and their endothelial ligands. To test the steps upstream, namely capture of neutrophils by activated endothelial cells, we used a microfluidic system and examined neutrophil-endothelial interactions at an early time point, namely 1 min. Under basal conditions, there were 8 ± 1 neutrophil interacting with endothelium per high power field (hpf) (data not displayed). Following stimulation of HUVEC with TNF-α, the number of interacting neutrophils rose to 53 ± 4 cells/hpf (p < 0.01 vs. basal, Figure 3.4 a). In the presence of Slit2, the number of neutrophils interacting with activated endothelium was significantly reduced (Figure 3.4 a; TNF-α 53 ± 4 cells/hpf vs. TNF-α + Slit2 59

69 10 ± 5/hpf, p < 0.01). Slit2 treatment effectively decreased both the number of rolling and adherent neutrophils to levels seen when endothelial cells were not activated (Figure 3.4 a; rolling: TNF-α 25 ± 4 cells/hpf vs.slit2 5 ± 2 cells/hpf, p < 0.05; Adherent: TNF-α 28 ± 3 cells/hpf vs. TNF-α + Slit2 5 ± 2 cells/hpf, p < 0.01). Collectively, these data demonstrate that under physiologic flow conditions, Slit2 prevents the initial steps involved in neutrophil recruitment, namely neutrophil capture by and rolling on the inflamed endothelial cells. These effects resulted in a significant reduction in total neutrophil adhesion to endothelial cells at a later time point. At 12 min, under basal conditions, there was minimal neutrophil adhesion to the endothelial monolayer (Figure 3.4 b and c). Activation of HUVEC with TNF-α, robustly increased neutrophil adhesion to the endothelial monolayer (Figure 3.4 b and c; control 15 ± 8 cells/hpf vs. TNF-α 197 ± 6 cells/hpf, p < 0.001) and this was significantly reduced by preincubating the neutrophils with Slit2 (Figure 3.4 b and c; TNF-α + Slit2 22 ± 9 cells/hpf, p < 0.001). These data show that Slit2 effectively inhibits neutrophil adhesion to activated endothelial cells under shear flow conditions encountered within the renal vasculature (Zoja, Angioletti et al. 2002). 3.5 Slit2 reduces neutrophil transendothelial migration in inflammation In AKI, after neutrophils firmly adhere to the injured endothelium, they undergo transmigration across the endothelial barrier to infiltrate the injured kidney in response to release of inflammatory chemoattractants. Rho-family GTPases play an important role in neutrophil transmigration by modulating cytoskeletal remodeling of neutrophils and leukocyte adhesion molecule expression (Adamson, Etienne et al. 1999; van Wetering, van den Berk et al. 2003). (Bayat, Werth et al. 2010). Therefore we next tested the effect of Slit2 on transendothelial 60

70 migration of neutrophils across HUVEC monolayers in response to IL-8, a chemoattractant highly produced in ischemic AKI (Safirstein, Megyesi et al. 1991; Masayoshi, Fu et al. 2001; Thurman, Lenderink et al. 2007). There was minimal neutrophil transmigration under basal conditions (Figure 3.5; ± AU). Transendothelial migration increased 6 fold in the presence of IL-8 (Figure 3.5; 1228 ± AU, p < 0.01 vs. control) and Slit2 significantly reduced IL-8 induced transmigration (Figure 3.5; ± AU, p < 0.05 vs. untreated). These data demonstrate that Slit2 inhibits neutrophil transmigration that occurs in response to inflammatory chemoattractants encountered in AKI. 3.6 Slit2 protects renal function following renal IRI in vivo Our results showed that Slit2 inhibits neutrophil adhesion to injured endothelium as well as transendothelial migration of neutrophils, events which promote the inflammatory injury associated with AKI. To directly determine the effect of Slit2 on AKI, we next administered Slit2 to mice subjected to renal IRI. After 24 h, plasma creatinine was significantly higher in mice that underwent bilateral clamping of renal pedicles compared to sham- treated mice (Figure 3.6 a; vehicle 2.58 ± 0.03 mg/dl vs. sham 0.34 ± 0.02 mg/dl, p < 0.001). Slit2 administration prevented the rise in plasma creatinine in a dose-dependent manner (Figure 3.6 a; Slit2 0.5 µg ± 0.13 mg/dl; Slit2 1µg ± 0.13 mg/dl; Slit2 2µg 0.58 ± 0.03 mg/dl; vehicle vs. 1µg Slit2, p < 0.01; vehicle vs. 2µg Slit2, p < 0.001; Slit2 2 µg vs. 1µg, p < 0.01). We further tested truncated N-Slit2 which contains the leucine rich region of Slit2 that is sufficient to bind and activate the Robo receptor. Administration of N-Slit2 reduced plasma creatinine by four fold (Figure 3.6 b; vehicle 1.70 ± 0.06 mg/dl vs. 2 µg N-Slit ± 0.03 mg/dl, p < 0.001). 61

71 3.7 Slit2 prevents acute tubular necrosis (ATN) and reduces neutrophil infiltration to the kidney following IRI We next assessed the effects of Slit2 administration on renal morphometry following IRI. After IRI, there was a marked increase in renal tubules that displayed cell necrosis, loss of brush border, cast formation, and tubular dilatation, compared to mice subjected to sham treatment (Figure 3.7 a; ATN score- vehicle 2.90 ± 0.32 vs. sham 1.00 ± 0, p < 0.05). Since we previously found that administration of Slit2 at a dose of 2µg/mouse provided the most effective protection against the rise in serum creatinine, we tested the effects of this dose of Slit2 on the mean ATN score. Pre-administration of Slit2 2 µg significantly reduced the ATN score (Figure 3.7 a; 1.00 ± 0, vehicle, p < 0.05 vs. vehicle treated). We next quantitated neutrophil infiltration into the kidney after IRI. IRI incited a ten fold rise in renal neutrophil infiltration as compared to sham surgery (data not shown, p < 0.01). Preadministration of Slit2 reduced relative neutrophil infiltration to three fold (Figure 3.7 b; p < 0.01 vs. vehicle). Similarly pre-administration of N-Slit2 significantly reduced neutrophil infiltration (Figure 3.7 c; p < 0.01 vs. vehicle). These data demonstrate that administration of exogenous Slit2 inhibits recruitment of neutrophils to the post-ischemic kidney. 3.8 Slit2 does not increase hepatic load of L. monocytogenes To explore the effect of Slit2 on innate immunity in vivo, we inoculated mice with L.monocytogenes and measured hepatic bacterial at serial time points. At all time points ranging from 0.5 h to 48 h, the bacterial colony forming unit (cfu) counts in the liver were similar 62

72 between mice administered vehicle and those administered Slit2 (Figure 3.8; 0.5 h- vehicle 5.6 x10 4 cfu vs. Slit2 5.6 x 10 4 cfu, 24 h-vehicle 29.6 x10 4 cfu vs. Slit x 10 4 cfu, 48 h- vehicle x 10 4 cfu vs. Slit x10 4 cfu ). Our results demonstrate that exogenous Slit2 does not increase hepatic bacterial load at early time points after L. monocytogenes infection, indicating that Slit2 does not impair protective innate immune responses. 63

73 Figure 3.1 Sham IRI a b 64 Secondary Ab only c

74 Figure 3.1: Slit2 expression increases in kidney tissue in renal IRI To examine the expression of Slit2 in AKI, a mouse model of bilateral renal IRI was used. Immunoperoxidase staining was performed on formalin-fixed, paraffin-embedded tissue sections. Microwave antigen retrieval was carried out in citrate buffer. Sections were incubated with at 4 C overnight with anti-slit2 Ab (3.6 mg/ml). Slides were washed and incubated with biotin-conjugated secondary antibody (1.5 µg/ml) at room temperature for 1 h. Immunoperoxidase staining was developed using the Vectastain ABC kit. Slides were scanned with Zeiss Mirax Slide scanner using 20 x/0.80 Zeiss objective. Mirax digital slide viewer was used for displaying the slides. Pictures were taken using digital zoom of 20x. 65

75 Figure 3.2 Mean fluorescence intensity (AU) * * * * Normoxia TNF-α 0.5 h 3 h * Untreated Slit2 * SI/R

76 Figure 3.2: Slit2 inhibits neutrophil adhesion to activated endothelial cells Freshly isolated human neutrophils were labeled with calcein and were incubated with medium alone or Slit2. Neutrophils (10 5 cells/ well) were incubated with confluent HUVEC monolayers and allowed to adhere for 30 min. Non-adherent cells were removed by centrifuging the 96 well plates upside down at 100g for 1 min. Neutrophil adhesion was quantified using the fluorescent plate reader at excitation and emission wavelengths of 494 and 517 nm. In some wells, HUVEC were incubated with TNF-α for 4 h prior to incubating with neutrophils. Hypoxic conditions were induced by exposing HUVEC to 1% oxygen, balance nitrogen at 37 C. Cells were exposed to 2 h of hypoxia followed by the indicated periods of re-oxygenation. Data are expressed as mean ± SEM. *, p <

77 Figure 3.3 a bp Robo 1 Robo 2 Robo 3 Robo b c Mean fluorescence intensity (AU) *** * OD at 570 nm *** *** ** Control Slit2 Slit2 + wash Control Slit2 Slit2 + wash TNF-α 0 Control Staurosporin 0.5h 3h SI/R

78 Figure 3.3: HUVEC s express Robo-1, 2 and 4 and Slit2 inhibits neutrophil-endothelial adhesion by its action on neutrophils a) Total RNA was extracted from HUVECs and RT-PCR performed using gene specific primers. PCR products were separated by 1.5 % agarose gel electrophoresis b) To determine whether the observed effects of Slit2 result from its actions on neutrophils vs. endothelial cells, neutrophils were incubated with Slit2 for 10 min and unbound Slit2 was washed away prior to performing the adhesion assays c) The reduction in cell viability of the cells exposed to SI/R was confirmed using MTT assay. Normoxic cells and cells exposed to staurosporine were used as positive and negative controls respectively. Data are expressed as mean ± SEM. *, p < 0.05; **, p < 0.01***, p <

79 a 35 * ** Figure 3.4 Number of cells/hpf TNFα TNFα+Slit2 Rolling Adherent b 250 *** *** Number of cells/hpf Untreated Slit2 treated 0 Control TNF-α c Slit2 - + Control TNF-α