SALSA MLPA probemix P175-A3 Tumour Gain Lot A3-0714: As compared to the previous version A2 (lot A2-0411), nine probes have a small change in length.

Transcription

1 SALSA MLPA probemix P175-A3 Tumour Gain Lot A3-0714: As compared to the previous version A2 (lot A2-0411), nine probes have a small change in length. This SALSA probemix is for basic research only! This probemix does not include any reference probes. As a result it can be very difficult to determine the normal copy number level in tumour samples harbouring multiple copy number changes. This can lead to false positive calls on your samples. This probemix enables you to detect copy number changes in 24 different genes. The occurrence or relevance of copy number changes of these genes is not yet well-established in various types of tumour. Hence, it will not always provide you with clear cut answers, and interpretation of results can be complicated. In case interesting results are obtained by users, it is possible to develop probemixes specific for a certain tumour type in collaboration with. The P175-A3 Tumour Gain MLPA probemix contains two or three probes for each of 24 different genes that are commonly amplified or gained in tumour samples, including MYCN/ALK/RET that are amplified in specific tumour types, and ERBB2/TOP2A, MYC, CCND1, EGFR and MET that are amplified in various tumour types. In addition to the 49 probes detecting gains/amplifications of genomic regions, one probe is included specific for the V600E BRAF activating mutation which gives a probe signal when this mutation is present in a DNA sample. Genes/regions included in the P175 Tumour Gain probemix: MDM4, MYCN-ALK, PDGFRA, KIT, KDR, DHFR, EGFR, MET, SMO, BRAF/BRAF V600E mutation, FGFR1, MYC, ABL1, RET, CCND1, CCND2, CDK4, MDM2, AURKB, ERBB2-TOP2A, AURKA and AR. This SALSA probemix is designed to detect copy number changes of one or more sequences in the above mentioned genes and chromosomal regions and to detect the presence of the aforementioned mentioned (point) mutation in a DNA sample. Heterozygous deletions of autosomal recognition sequences should give a 35-50% reduced relative peak height of the amplification product of that probe. Deletions of a probe s recognition sequence on the X-chromosome will lead to a complete absence of the corresponding probe amplification product in males, whereas female heterozygotes are recognisable by a 35-50% reduction in relative peak height. Results depend on the percentage of tumour cells in the sample. The MLPA results indicate the average copy number change of the probe target sequences in the cells in the sample. A high percentage of normal cells in tumour samples result in a smaller change in probe signal. Samples may also contain a mixture of different populations of tumour cells, which can complicate analysis. SD029 Sample DNA Please note that the mutation-specific probe has only been tested on control plasmids and not on positive human DNA samples with the V600E BRAF point mutation! This SD029 sample DNA is provided with each probemix vial and can be used in data binning in the fragment analysis and as a positive control for the mutation-specific probe (see next page). Note that a mutation or polymorphism in the sequence detected by a probe can also cause a reduction in relative peak height, even when not located exactly on the ligation site! In addition, some probe signals are more sensitive to sample purity and small changes in experimental conditions. Therefore, deletions and duplications detected by a single MLPA probe should always be confirmed by other methods. Not all deletions and duplications detected by MLPA will be pathogenic; users should always verify the latest scientific literature when interpreting their findings. SALSA probemixes and reagents are sold by for research purposes and to demonstrate the possibilities of the MLPA technique. They are not CE/FDA certified for use in diagnostic procedures. Purchase of the SALSA test probemixes and reagents includes a limited license to use these products for research purposes. The use of a SALSA probemix and reagents requires a thermocycler with heated lid and sequence type electrophoresis equipment. Different fluorescent PCR primers are available. The MLPA technique has been first described in Nucleic Acid Research 30, e57 (2002). SALSA probemix P175 Tumour Gain Page 1 of 10

2 Related SALSA probemixes (see also information in Table 2A). P294 Tumour Loss: 1p36, 13q14 (RB1), AMER1, APC, BRCA1/2, CAMTA1, CDKN2A/B, CHD5, FKBP8, NF1, PTCH1, PTEN, SMAD4, SMARCB1, STK11, TP53, TSC1/2, VHL, and WT1. References for SALSA P175 Tumour Gain probemix Ooi A et al Semi-comprehensive analysis of gene amplification in gastric cancers using multiplex ligation-dependent probe amplification and fluorescence in situ hybridization. Modern Pathology. 28: Oyama T et al Overexpression and gene amplification of both ERBB2 and EGFR in an esophageal squamous cell carcinoma revealed by fluorescence in situ hybridization, multiplex ligation-dependent probe amplification and immunohistochemistry. Pathol Int. 65: Gessi M et al MYCN amplification predicts poor outcome for patients with supratentorial primitive neuroectodermal tumors of the central nervous system. Neuro Oncol. 16: Stoczynska-Fidelus E et al The failure in the stabilization of glioblastoma-derived cell lines: spontaneous in vitro senescence as the main culprit. PLoS One. 9(1):e Tajiri R et al Intratumoral heterogeneous amplification of ERBB2 and subclonal genetic diversity in gastric cancers revealed by multiple ligation-dependent probe amplification and fluorescence in situ hybridization. Hum Pathol. 45: Salvi S et al Copy number analysis of 24 oncogenes: MDM4 identified as a putative marker for low recurrence risk in non muscle invasive bladder cancer. Int J Mol Sci. 15: Gessi M et al H3.3 G34R mutations in pediatric primitive neuroectodermal tumors of central nervous system (CNS-PNET) and pediatric glioblastomas: possible diagnostic and therapeutic implications? J Neurooncol. 112: Gessi M et al Genome-wide DNA copy number analysis of desmoplastic infantile astrocytomas and desmoplastic infantile gangliogliomas. J Neuropathol Exp Neurol. 72: Monticone M et al Identification of a novel set of genes reflecting different in vivo invasive patterns of human GBM cells. BMC Cancer. 12:358. More information Website : info@mlpa.com (information & technical questions); order@mlpa.com (for orders) Mail : bv; Willem Schoutenstraat 1, 1057 DL Amsterdam, the Netherlands Interpretation of the results - Data analysis The P175-A3 Tumour Gain probemix contains 50 MLPA probes with amplification products between 121 and 489 nt. Please note that one of these probes (226 nt) is mutation-specific and will only generate a probe signal when the V600E BRAF mutation is present. In addition, the P175-A3 probemix contains 9 control fragments generating an amplification product smaller than 120 nt: four DNA Quantity fragments (Qfragments) at nt, three DNA Denaturation control fragments (D-fragments) at nt, one X-fragment at 100 nt and one Y-fragment at 105 nt. More information on how to interpret observations on these control fragments can be found in the MLPA protocol. SD029 Sample DNA The SD029 Sample DNA provided with this probemix can be used as Binning DNA sample for binning of the V600E BRAF mutation-specific probe (BRAF exon 15 probe SP0039-L08904). Inclusion of one reaction with SD029 Sample DNA in MLPA experiments is recommended as it can be used to aid in data binning of the peak pattern using Coffalyser.NET software and as an artificial positive control for the specific point mutation. Please note that SD029 Sample DNA consists of female DNA mixed with a plasmid that contains the target sequence detected by the above mentioned probe + the sequence of the 105 nt chromosome Y specific control fragment. The amount of plasmid used (relative to the genomic DNA) results in a relative probe signal for the 105 nt probe on this female DNA which is identical to the relative probe signal obtained on male DNA samples. As a result, the 100 and 105 nt control fragments indicate the presence of two copies chromosome X and one copy chromosome Y and one copy of the mutation-specific probe (heterozygous mutation). The product description of the SD029 can be found on This product is for research use only. SALSA probemix P175 Tumour Gain Page 2 of 10

3 Data generated by this probemix should be normalised with a more robust method, as gains and losses are frequent in tumours. (1) Intra-sample normalisation should be performed by dividing the signal of each probe by the signal of every other probe in that sample, thus creating as many ratios per probe as there are other probes. Please note that the mutation specific probe BRAF V600E and the chromosome X specific probes (AR) should not be used as reference probes in normalisation of MLPA results. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. (2) Secondly, inter-sample comparison should be performed by dividing the Normalisation Constant of each probe in a given sample by the average Normalisation Constant of that probe in all the reference samples. Data normalisation should be performed within one experiment. Always use sample and reference DNA extracted with the same method and derived from the same source of tissue. Confirmation of deletions, duplications and amplifications can be done by e.g. Southern blotting, long range PCR, qpcr and FISH. Note that Coffalyser, the MLPA analysis tool developed at, can be downloaded free of charge from our website Warning: MLPA analysis on tumour samples provides information on the average situation in the cells from which the DNA sample was purified. Gains or losses of genomic regions or genes may not be detected if the percentage of tumour cells is low. When in doubt, users should always verify the latest updates of the database and scientific literature when interpreting their findings. This probemix was developed at in collaboration with the Translational Research Laboratory of the Massachusetts General Hospital Cancer Center (Boston, USA, Dr. Darrell Borger). Info/remarks/suggestions for improvement: info@mlpa.com. SALSA probemix P175 Tumour Gain Page 3 of 10

4 Table 1. SALSA MLPA P175-A3 Tumour Gain probemix Length Chromosomal location SALSA MLPA probe (nt) Band MV location (HG18) Q-fragments: DNA quantity; only visible with less than 100 ng sample DNA D-fragments: Low signal of 88 or 96 nt fragment indicates incomplete denaturation 100 X-fragment: Specific for the X chromosome 105 Y-fragment: Specific for the Y chromosome 121 DHFR probe S0428-L q AURKA probe S0429-L q ± AR probe L27346 Xq12 X PDGFRA probe L q ± CDK4 probe L q ERBB2 probe L q MYC probe L q ABL1 probe L q ALK probe L p ± CCND2 probe L p FGFR1 probe L p MDM4 probe L q AURKB probe L p MET probe L q SMO probe L q MET probe L q BRAF probe L q EGFR probe L p BRAF probe SP0039-L08904 V600E mutation specific RET probe L q MYC probe L q DHFR probe L q BRAF probe L q TOP2A probe L q CCND1 probe L q ± CDK4 probe L q MDM2 probe L q CCND1 probe L q KDR probe L q ABL1 probe L q AR probe L14065 Xq12 X MDM4 probe L q ERBB2 probe L q KIT probe L q CCND2 probe L p RET probe L q MYCN probe L p FGFR1 probe L p PDGFRA probe L q SMO probe L q MDM2 probe L q ALK probe L p EGFR probe L p ± MYCN probe L p KDR probe L q AURKB probe L p CCND1 probe L q KIT probe L q TOP2A probe L q AURKA probe L q Mutation-specific probe. This probe will only generate a signal when the V600E BRAF mutation is present. Changed in version A3 (from lot 0714 onwards). Small change in length, no change in sequence detected. ± These probes are located within, or close to, a very strong CpG island. A low signal of these probes can be due to incomplete sample DNA denaturation, e.g. due to the presence of salt in the sample DNA. SALSA probemix P175 Tumour Gain Page 4 of 10

5 Table 2. P175 probes arranged according to chromosomal location Length SALSA MLPA Partial sequence Distance to Gene Location (nt) probe (24 nt adjacent to ligation site) next probe MDM4 gene, at 1q32.1. Frequently gained or amplified in glioblastoma and bladder tumours. No other MDM4 probes are in our collection at this moment L03594 MDM4 Exon 2 TTCACTACCAAA-ATGACATCATTT 17.3 kb L02525 MDM4 Exon 8 GGAGTGGGATGT-AGCTGGCCTGCC - MYCN gene, at 2p24.3. Frequently gained or amplified in neuroblastoma tumours. More MYCN probes in the P037, P252 and P377 probemixes L09025 MYCN Exon 3 CTGTCACCACAT-TCACCATCACTG 0.2 kb 436 ± L02466 MYCN Exon 3 TGCACCCCCACA-GAAGAAGATAAA kb to ALK gene ALK gene, at 2p23.2. Frequently gained or co-amplified with MYCN in neuroblastoma tumours. More ALK probes in the P252 and P377 probemixes L08193 ALK Exon 6 TCACTTGTTGGA-ATGGGACAGTCC kb L08192 ALK Exon 4 ACACCTCAGCTG-ACTCCAAGCACA - PDGFRA gene, at 4q12. Frequently gained or co-amplified with KIT and KDR gene in gliomas. One more PDGFRA probe is present in the P105 and P171 probemixes L10719 PDGFRA Exon 3 GGAGAGTGAAGT-GAGCTGGCAGTA 29.2 kb L13878 PDGFRA Exon 22 ACAATGCATACA-TTGGTGTCACCT 405 kb to KIT gene KIT gene, at 4q12. Frequently gained or co-amplified together with PDGRA and KDR in gliomas (especially in anaplastic astrocytomas) and melanomas. More KIT probes can be found in the P354 probemix L14066 KIT Exon 2 CGTGCACCAACA-AACACGGCTTAA 41.4 kb L13877 KIT Exon 20 ACATAATGAAGA-CTTGCTGGGATG 359 kb to KDR gene KDR gene, at 4q12. Frequently gained or co-amplified together with PDGFRA and KIT in gliomas. No other KDR probes are in our collection at this moment L14064 KDR Exon 19 TGGTGACCAATA-TGAATGAGGATC 6.2 kb L13874 KDR Exon 14 GAAACCTGGAGA-ATCAGACGACAA - DHFR gene, at 5q14.1. Amplifications and activating mutations of DHFR have been implicated in drug resistance of aminopterin. No other DHFR probes are in our collection at this moment. 121 S0428-L27347 DHFR Exon 2 CGCTGTTTCTCT-AACTTGTAGGAA 0.8 kb L13869 DHFR Exon 1 GGCTTCCCGTAG-ACTGGAAGAATC - EGFR gene, at 7p11.2. Frequently gained or amplified in non-small cell lung cancer and colorectal cancer. More EGFR probes are in the P105 and P315 probemixes L03283 EGFR Exon 8 AGCTATGAGATG-GAGGAAGACGGC 25.5 kb L05383 EGFR Exon 20 CCTCCTGGACTA-TGTCCGGGAACA kb to MET gene MET gene, at 7q31.2. Frequently gained or amplified in a variety of tumours, like in lung cancer, melanoma and gastric cancer. More MET probes in the P308 probemix L10828 MET Exon 4 TATCACTGGGAA-GAAGGTAAGCTG 19.3 kb L10834 MET Exon 10 AGCACAATAACA-GGTGTTGGGAAA kb to SMO gene SMO gene, at 7q32.1. Activating mutations (possibly also through gains and amplifications) are detected in medulloblastoma and in basal cell carcinomas. No other SMO probes are in our collection at this moment L13866 SMO Exon 4 CCCTGCTGTTAT-TCTCTTCTACGT 6.8 kb L13873 SMO Exon 12 TCGGTGAGGAAG-AAGAGCCTTGAA kb to BRAF gene BRAF gene, at 7q34. Frequently gained, amplified or mutated e.g. in colon cancer and melanoma. More BRAF probes are in the P298 and P370 probemixes L11060 BRAF Exon 15 TATTTTTCCACT-GATTAAATTTTT 0.1 kb SP0039- L08904 BRAF V600E=T1799A mutation specific, Exon 15 TTCTTCATGAAG-ACCTCACAGT AAAAATAGGTGATTTTGGTCTA GCTACAGA-GAAATCTCGATG L14063 BRAF Exon 13 CTTGTATCACCA-TCTCCATATCAT Mutation-specific probe. This probe will only generate a signal when the V600E mutation is present kb SALSA probemix P175 Tumour Gain Page 5 of 10

6 Length SALSA MLPA Partial sequence Distance to Gene Location (nt) probe (24 nt adjacent to ligation site) next probe FGFR1 gene, at 8p Frequently gained or amplified in gliomas, breast cancer, gastric cancer and oral squamous cell cancer. More FGFR1 probes are in the P078, P133 and P370 probemixes L03583 FGFR1 Exon 5 CAAATGCCCTTC-CAGTGGGACCCC 29.5 kb L01837 FGFR1 Exon 2 CAACCTCTAACT-GCAGAACTGGGA kb to MYC gene MYC gene, at 8q Frequently amplified in many types of tumours, including breast, cervical and colon cancers, as well as in squamous cell carcinomas of the head and neck, myeloma, non-hodgkin's lymphoma, gastric adenocarcinomas and ovarian cancer. More probes for MYC can be found in P027, P078, P171 and P377 probemixes L27351 MYC Exon 3 AGGACTATCCTG-CTGCCAAGAGGG 0.2 kb L27349 MYC Exon 3 GAACGAGCTAAA-ACGGAGCTTTTT - ABL1 gene, at 9q ABL1 is frequently involved in translocations (e.g. BCR/ABL1 fusion gene) in different hematologic malignancies, and sometimes in subsequent amplifications of these fusion genes. More probes for ABL1 are in P383 probemix L27350 ABL1 Exon 1 CTTTATGTGTGA-GAATTGAAATGA kb L13566 ABL1 Exon 12 TCGAAAAGAGCG-AGGTCCCCCGGA - RET gene, at 10q Frequently gained or amplified in thyroid cancer. More RET probes are in the P169 probemix L23322 RET Exon 8 TGCAGTCAGCAA-GAGACGGCTGGA 7.6 kb L13858 RET Exon 14 CTCATCTCATTT-GCCTGGCAGATC - CCND1 gene, at 11q13.3. Frequently gained or amplified in breast cancer and in head and neck cancers. One more CCND1 probe can be found in P078 probemix L04807 CCND1 Exon 2 TCGCTGGAGCCC-GTGAAAAAGAGC 0.7 kb L27353 CCND1 Exon 3 CCTGGTGAACAA-GCTCAAGTGGAA 7.3 kb L00148 CCND1 Exon 5 CCCTGCTGGAGT-CAAGCCTGCGCC - CCND2 gene, at 12p One more CCND2 probe is in the P172 and ME003 probemixes. 172 ± L02516 CCND2 Exon 1 AGACCAGTTTTA-AGGGGAGGACCG 26.2 kb L00084 CCND2 Exon 5 ATGCCAGTTGGG-CCGAAAGAGAGA kb to CDK4 gene CDK4 gene, at 12q14.1. Frequently gained or amplified in glioma, melanoma and in soft tissue and bone tumours. More probes for CDK4 probes can be found in the P419 probemix. 274 ± L20043 CDK4 Exon 8 TGCTGACTTTTA- ACCCACACAAGC 2.7 kb 142 ± L02512 CDK4 Exon 3 AACCCTGGTGTT-TGAGCATGTAGA kb to MDM2 gene MDM2 gene, at 12q15. Frequently gained or amplified in soft tissue tumours, in osteosarcoma and in pituitary adenoma. More MDM2 probes can be found in the P323 probemix L06788 MDM2 Exon 3 ACCAACAGACTT-TAATAACTTCAA 3.4 kb L06789 MDM2 Exon 4 TGGACTAAACTG-AAGAATTACCTG - AURKB gene, at 17p13.1. Frequently gained or amplified in hepatocellular and oral squamous cell cancer. No other AURKB probes are in our collection at this moment L13865 AURKB Exon 5 CCTTCCTCCACT-TTCTAAGCAGGC 0.2 kb L13875 AURKB Exon 4 GCACTTACGTTA-AGATGTCGGGTG kb to ERBB2 gene ERBB2 gene, also known as HER-2/neu, at 17q12. Frequently gained or amplified in breast cancer and associated with poor prognosis and good response to trastuzumab treatment. In addition, ERBB2 amplifications are detected in oral squamous cell cancer and gastric cancer. More ERBB2 probes can be found in the P004 and P078 probemixes L00572 ERBB2 Exon 7 GGTGCAGGGCTA-CGTGCTCATCGC 18.5 kb L27352 ERBB2 Exon 29 TCACTGCTGGAG-GACGATGACATG kb to TOP2A gene TOP2A gene, at 17q21.2. Frequently gained or amplified in breast cancer and is often accompanied by ERBB2 (HER-2) amplification. TOP2A amplification is the molecular target of anthracycline drugs. More TOP2A probes can be found in the P004 and P078 probemixes L14067 TOP2A Exon 33 TAAGGGCAGTGT-ACCACTGTCTTC 21.3 kb L00628 TOP2A Exon 7 AAGCCCTTCAAT-GGAGAAGATTAT - AURKA gene, at 20q Frequently gained or amplified in breast, ovarian, bladder, pancreatic and colon cancer and its expression in tumours is often associated with genetic instability and poor prognosis. More AURKA probes can be found in P157 and P172 probemixes. 124 S0429-L27348 AURKA Exon 10 TACAAAAGAATA-TCACGGGTAAGA 11.1 kb SALSA probemix P175 Tumour Gain Page 6 of 10

7 Length SALSA MLPA Partial sequence Distance to Gene Location (nt) probe (24 nt adjacent to ligation site) next probe L14068 AURKA Exon 8 AGGCATCCTAAT-ATTCTTAGACTG - AR gene, at Xq12. Frequently gained or amplified in prostate cancer. More AR probes in the P074 probemix. 130 ± L27346 AR Exon 1 CATGCAACTCCT-TCAGCAACAGCA kb L14065 AR Exon 8 CATCAGTTCACT-TTTGACCTGCTA - ± This probe is located within, or close to, a very strong CpG island. A low signal of this probe can be due to incomplete sample DNA denaturation, e.g. due to the presence of salt in the sample DNA. Note Exon numbering might be different as compared to literature! Complete probe sequences are available on request: info@mlpa.com. Please notify us of any mistakes: info@mlpa.com. Some genes might be deleted or duplicated in healthy persons. The database of genomic variants can provide more information on this. In some cases analysis of DNA from blood may help with interpretation of results from low-level amplifications (gains). The AR gene will appear duplicated in Klinefelter individuals. One X chromosome (AMOT gene) and Y chromosome (UTY gene) probe are present in the control fragments ( nt). SALSA probemix P175 Tumour Gain Page 7 of 10

8 SALSA MLPA probemix P175-A3 Tumour Gain sample pictures D ye S ign al Size (nt) Figure 1. Capillary electrophoresis pattern from a sample of approximately 50 ng human male control DNA analysed with SALSA MLPA probemix P175-A3 Tumour Gain (lot A3-0714) D ye S ign al Size (nt) Figure 2. Capillary electrophoresis pattern from a sample of approximately 50 ng human female control DNA analysed with SALSA MLPA probemix P175-A3 Tumour Gain (lot A3-0714). SALSA probemix P175 Tumour Gain Page 8 of 10

9 D ye S ign al Size (nt) Figure 3. Capillary electrophoresis pattern of SD029 sample DNA (approximately 50 ng) analysed with SALSA MLPA probemix P175-A3 Tumour Gain (lot A3-0714). The location of the V600E BRAF mutationspecific probe at 226 nt is indicated. SALSA probemix P175 Tumour Gain Page 9 of 10

10 Implemented Changes compared to the previous product description version(s). Version January 2017 (T08) - Warning added in Table 1 and Table 2, 436 nt probe L Version May 2016 (T08) - Related SALSA probemixes added on page 2. - New references added on page 2. - Small typos corrected. Version 08 (53) - Product description adapted to a new product version (version number changed, lot number added, small changes in Table 1 and Table 2, new pictures included). - Various textual and lay-out changes. - New reference in literature added for P175 on page 1 and 2. - Exon numbering updated in Table 2 according to the latest NM and NG sequence information. - SD029 information added on page 1 and 2. Version 07 (48) - Warning added on page 1 about the putative false positive calls in case of multiple copy number changes leading to difficulties in determining the normal copy level. Version 06 (48) - Warning added in Table 1, 142 nt probe L02512 and 463 nt probe L Version 05 (48) - Electropherogram pictures using the new MLPA buffer (introduced in December 2012) added. Version 04 (48) - Small correction of chromosomal locations in Table 1. - Various minor textual changes. Version 03 (45) - Product description adapted to a new product version (version number changed, lot number added, small changes in Table 1 and Table 2, new pictures included). - Warning added on page 2 below the data analysis section about the effect of tumour percentage to MLPA analysis. - Additional information added to Table 2 about the prevalence of gene amplifications in different tumour types. - Data analysis method has been modified. - Warning added in Table 1, 129 nt probe L00423 and 383 nt probe L Version 02 (45) - Basic research remark added on page 1, minor textual changes on page 1. - Tables have been numbered. - Data analysis method has been modified. Sentence when only small numbers of samples are tested, visual comparison of peak profiles should be sufficient removed from data analysis section. SALSA probemix P175 Tumour Gain Page 10 of 10