Typhoidal pathogens. - S. Typhi Vi-positive - S. Typhi Vi-negative. Journal of clinical microbiology, 2005,

Transcription

1 Typhoid Typhoid is an acute infectious febrile illness with anorexia, headache, malaise and abdominal discomfort Global burden is more than 27 million 0.2 Million deaths annually verall 90% cases reported in Asia Highest prevalence in South Asia, >100 / 100,000 persons* Typhoid is the 4th most common cause of death in akistan ** *Current pinion Infectious Diseases, 2012, ** WH Report

2 Typhoidal pathogens Salmonella enterica subspecies enterica serovar Typhi (Salmonella Typhi) Gram-negative, motile and facultative anaerobe Enterobacteriaceae family Humans are the sole reservoir Vi capsule [linear homopolysaccharide of (1 4) N-acetyl α-d-galactosaminuronic acid] - S. Typhi Vi-positive - S. Typhi Vi-negative Journal of clinical microbiology, 2005,

3 S. Typhi Vi-positive S. Typhi Vi-negative Journal of clinical microbiology, 2005,

4 CR identification of S. Typhi bp 599 bp Lane 1 and 5: Lane 2 and 3 Lane 4: Lane 6: Lane 7: Marker 100bp flic-d gene (495bp) of S. Typhi Negative Control tvia gene (599bp) S.Typhi vi positive strain S.Typhi vi negative strain rimers for flic-d and tvia genes ST1 (forward) 5 TATGCCGCTACATATGATGAT 3 ST2 (reverse) 5 TTAACGCAGTAAAGAGAG 3 Vi (Forward) 5 GTTATTTCAGCATAAGGAG 3 Vi (Reverse) 5 ACTTGTCCGTGTTTTACTC 3 4

5 Combat strategies reventive measures Improved sanitation ersonal Hygiene Vaccination Effective treatment floxacin (Tarivid) Cephalosporin Sulphamethaxazole 5

6 TRADITINAL VACCINES Vaccines Killed vaccines Attenuated vaccine (Ty21a) Vi capsule Current licensed vaccines MDERN VACCINES Conjugate vaccines* * New England Journal of Medicine, 2009,

7 Conjugate vaccines Conjugating polysaccharide antigen with a protein olysaccharide antigen Linker rotein This conjugation converts the T- cell independent carbohydrate antigen into a T-cell dependent antigen, with all the associated benefits in terms of immunological response* 1- Vi capsule based 2- -Specific polysaccharide (S) based * Medical Microbiology, 1998,

8 Gram-negative Gram-positive Capsular polysaccharide Lipopolysaccharide Capsular polysaccharide M-protein orin Lipoteichoic acid Teichoic acid hospholipid Lipoprotein eptidoglycan rotein eptidoglycan hospholipid rotein 8

9 Lipopolysaccharides (LS) Characteristic component of outer membrane of Gram-negative bacteria and occupy about 75% of the outer cell surface Essential for physical integrity, growth and reproduction Confer stability and protection against antibiotics, bacteriophages and host defense mechanisms during infection Endotoxic in nature and cause fever, septic shock, multiple organ failure and ultimately death Variation in LS structure significantly effects bacterial virulence Surface antigen (-antigen) Cause production of cytokines 9

10 Functions of LS 1. Stabilization of outer membrane (M) 2. -side chain composition can be changed to avoid host antibody detection 3. rovide net negative charge on the cell 4. rotective barrier 5. Inhibits or regulates toxic compounds, metabolites 6. ermits entry of small molecules through porin proteins 7. revents loss of periplasmic enzymes 10

11 Schematic representation of Gram-negative bacterial lipopolysaccharides (LS) -specific Chain Core n uter side Kdo Kdo NH 3 uter core Inner core olysaccharide Lipid A Glycophospholipid Inner side 11

12 Structural analysis of Lipopolysaccharides olysaccharide Glycophospholipid uter core Inner core NH 3 uter side n Kdo Kdo Inner side -specific Chain Core Lipid A 12

13 Lipid-A uter side Endotoxic center of LS Generally conserved Variations in structure result from: -specific Chain n uter core olysaccharide Type of aminosugars Degrees of phosphorylation resence of phosphate substituents Nature, chain length, number and location of fatty acyl chains Core Lipid A Kdo Kdo NH3 Inner core Glycophospholipid Inner side 13

14 Fatty acid analysis of Lipid A RT: H Me C14 3-H Me Me Me 80 Relative Abundance C C C Time (min) 14

15 LCMS analysis of Lipid-A (S. Typhi Vi-positive) H H 100 H H NH HN H H H B Relative Abundance C D B D C m/z 15

16 Lipid A structure (General structure is similar in both S. Typhi Vipositive & Vi-negative but show some heterogeneity) H H H NH H H HN H H Bisphosphorylated hepta-acylated β 1 6 diglucossamine 16 16

17 Mechanism of lipid-a endotoxicity Activation of proinflammatory cytokines Fig. Lipid A bound to MD-2 induce oligomerization of TLR4 leading to the production of inflammatory cytokines 17

18 Comparative endotoxicity of lipid A variants Endotoxicity profile of Lipid A H H H HN H H HN ta-acylated Lipid A H H H H H H NH HN H H Hexa-acylated Lipid A H H H H H NH H H HN H H H H H H H HN H H HN H H H enta-acylated Lipid A Tetra-acylated Lipid A European Journal of Biochemistry,

19 Figure: Intrinsic conformations of different lipid A structures with tilt angles confering endotoxic activity (A) highly active (B) medium active (C) inactive pentaacyl (D) inactive tetraacyl (E) inactive lipid A from C. violaceum (Seydel et al., 2000) 19

20 athogen recognition system of host can scan lipid A species with higher tilt angles n n n n Kdo NH 3 Kdo Kdo NH 3 Kdo Kdo NH 3 Kdo Kdo NH 3 Kdo TLR4 cell surface 20

21 uter side Core Conserved among Salmonella serovars Link between lipid-a and S Inner core lipid-a consists of unusual sugars like Kdo and heptoses uter core S consists of common hexoses like glucose, galactose -specific Chain Core Lipid A n Kdo Kdo NH 3 uter core Inner core olysaccharide Glycophospholipid Inner side 21

22 - specific olysaccharide (S) uter side Surface antigen Serologically specific Enormous structure variability Repeating units of 2-8 monosaccharides differing in Nature Ring form Sequence Substitution Type of linkage -specific Chain Core Lipid A n Kdo NH3 Kdo Inner side uter core Inner core 22 olysaccharide Glycophospholipid

23 Double-immunodiffusion assay for antigenicity LS of Vi-positive S of Vi-positive LS of Vi-negative S of Vi-negative recipitation of antigen antibody interaction Negative control olyclonal antisera against Vi positive S. Typhi Negative control olyclonal antisera against Vi positive S. Typhi Negative control 23