Metabolic Engineering of Microbes for Production of Terpenoid Drugs

Transcription

1 Metabolic Engineering of Microbes for Production of Terpenoid Drugs Jay D. Keasling Synthetic Biology Dept., LBNL Chemical Engineering Dept., UC Berkeley, CA 94720

2 Malaria Caused by Plasmodium, a singlecell protozoan Transmitted by Anopheles mosquito Destroys red blood cells

3 Malaria million people die of malaria every year 90% of the victims are children 40% of the world s population is at risk Economists have proposed that malaria decreases the GDP of affected countries by as much as 50%.

4 Chloroquine-based drugs Most widely-used drugs to treat malaria Cl N Plasmodium in South America and Southeast Asia is largely resistant to chloroquine H 3 C H 3 C H 3 C NH

5 Artemisia annua Artemisinin

6 Terpenoids > 50,000 known molecules Chemotherapeutics Essential oils H Menthol C-10 Monoterpene Eleutherobin C-20 Diterpene Carotenoids Lycopene C-40 Tetraterpene Taxol C-20 Diterpene

7 P(H)P(H) 2 Isopentenyl pyrophosphate (IPP) Terpenoid metabolic pathways P(H)P(H) 2 Dimethylallyl pyrophosphate (DMAPP) P(H)P(H) 2 Geranyl pyrophosphate (GPP) Monoterpenes P(H)P(H) 2 Farnesyl pyrophosphate (FPP) Sesquiterpenes P(H)P(H) 2 Geranyl pyrophosphate (GGPP) Carotenoids Diterpenes

8 P(H)P(H) 2 Isopentenyl pyrophosphate (IPP) Artemisinin metabolic P(H)P(H) 2 pathways Dimethylallyl pyrophosphate (DMAPP) P(H)P(H) 2 Geranyl pyrophosphate (GPP) Amorphadiene P(H)P(H) 2 Farnesyl pyrophosphate (FPP) Artemisinin

9 GGPP Diterpenes DHAP Glycolysis G6P FDP G3P PEP PYR AcCoA Pathways for terpenoid precursor biosynthesis DXP Non-mevalonate (DXP) pathway MEV IPP DMAPP AA MAL TCA Cycle Mevalonate pathway CIT GPP FPP Monoterpenes Sesquiterpenes

10 Artemisinin-based drugs The current cost for an artemisininbased drug is approximately $2.25. Artemisinin generally adds $ to the cost for drugs Most developing countries spend less than $4/person/year on health care As many as treatments are needed for each person annually World Health rganization estimates that 700 tons will be needed annually

11 Goal Reduce the cost of artemisinin-based antimalarial drugs by an order of magnitude. Approach Engineer a bacterium to produce artemisinin from an inexpensive, renewable resource. E. coli

12 Microbial production of artemisinin Advantages Microbial fermentations are relatively simple to scale up Inexpensive starting materials can be used Production not affected by weather conditions Pure product can be made (free of other contaminating terpenes)

13 Microbial production of artemisinin Challenges Need the genes for all of the enzymes in the pathway Not always simple to express in microbes the genes from very different organisms Need to balance metabolic pathways to optimize production Need a good platform organism with appropriate gene expression tools

14 Synthesis of artemisinin in E. coli Identify the enzymes

15 Amorphadiene and artemisinin biosynthetic pathway PP Farnesyl diphosphate (FPP) Amorphadiene Synthase Amorphadiene Cytochrome P450 Artemisinin H Artemisinic Acid

16 Synthesis of artemisinin in E. coli Clone the genes

17 Cell growth (D600nm) Cell growth (D600nm) Cell growth (D600nm) Poor performance of plant sesquiterpene cyclases Time (hrs) epi-aristolochene (µg/l) Cadinene (µg/l) Vetispiradiene (µg/l) 5-epi-aristolochene Cadinene Vetispiradiene Low yields: 0.05 to 0.7 ng/ml/d Expression of rare E. coli codon trna did not much help Martin et al., Biotech. Bioeng. 2001

18 Amorphadiene and artemisinin biosynthetic pathway PP Farnesyl diphosphate (FPP) Amorphadiene Synthase Amorphadiene Cytochrome P450 Artemisinin H Artemisinic Acid

19 Assembly of rcamorphadiene cyclase Take gene sequence from patent ptimize sequence for expression in desired host Synthesize 84 oligonucleotides of ~40 basepairs each Assemble into complete gene using the polymerase chain reaction (PCR)

20 Terpene cyclase gene assembly 84 primers ~40-mers 1 st round of PCR 2 nd round of PCR Rescue gene with end primers 1.7 kb Screen, sequence and fix

21 Amorphadiene production by the synthetic amorphadiene cyclase Amorphadiene production (ug/ml/d600) Time (Hours) 142-fold improvement over other native cyclases (100 ng/ml/d)

22 Synthesis of artemisinin in cells Supply of intracellular precursors

23 DHAP G6P FDP G3P PEP PYR DXP DXP Pathway Non-mevalonate (DXP) pathway AcCoA IPP DMAPP AA CIT GPP MAL FPP Amorphadiene

24 G6P FDP Eliminating bottlenecks in the DXP pathway DHAP G3P PEP DXS DXP PYR AcCoA IPP IdI DMAPP AA CIT IspA GPP MAL FPP Amorphadiene

25 Amorphadiene production by the synthetic amorphadiene cyclase Amorphadiene production (ug/ml/d600) Time (Hours) Native DXP pathway Engineered DXP pathway Additional 3-fold (300 ng/ml/d)

26 DHAP G6P FDP G3P Enhancing all of the steps in the DXP pathway pyridoxine thiamine PEP DXP PYR AcCoA IPP IdI DMAPP AA CIT IspA GPP MAL FPP Amorphadiene

27 G6P FDP Introducing an entirely new pathway DHAP G3P PEP DXP PYR AcCoA MEV Mevalonate pathway IPP DMAPP AA CIT GPP MAL FPP Amorphadiene

28 Construction of synthetic mevalonate pathway operons MevT atob HMGS thmgr Acetyl-CoA P (1.2kb) (1.5kb) (1.6kb) Mevalonate MBI Mevalonate P MK (1.2kb) PMK (1.3kb) MPD (1.3kb) idi (0.5kb) IPP DMAPP E. coli genes Yeast genes

29 Amorphadiene production (ug/ml/d600) Amorphadiene from the full mevalonate pathway DXP pathway Mevalonate pathway Time (Hours) 30-fold improvement (3 mg/l/d)

30 Construction of synthetic mevalonate pathway operons MevT atob HMGS thmgr Acetyl-CoA P (1.2kb) (1.5kb) (1.6kb) Mevalonate MBI Mevalonate P MK (1.2kb) PMK (1.3kb) MPD (1.3kb) idi (0.5kb) IPP DMAPP

31 G6P FDP ptimizing the MEV pathway DHAP G3P PEP DXP PYR AcCoA MEV IPP DMAPP AA CIT GPP MAL Exogenous MEV FPP Amorphadiene

32 G6P FDP ptimizing the MEV pathway DHAP G3P PEP DXP PYR AcCoA MEV IPP DMAPP AA CIT GPP MAL Exogenous MEV FPP Amorphadiene

33 Increasing concentrations of mevalonate inhibit growth 1.2 Cell Growth (D600) [Mevalonate] 5 mm 10 mm 20 mm 40 mm Time (hours) Martin et al Nat. Biotechnol. 21:

34 G6P FDP ptimizing the MEV pathway DHAP G3P PEP DXP PYR AcCoA MEV IPP DMAPP AA CIT GPP MAL Exogenous MEV FPP Amorphadiene

35 Co-expression of sesquiterpene cyclase alleviates growth inhibition FPP P P Amorphadiene Cyclase (ADS) Amorphadiene 1.2 No ADS 1.2 With ADS Cell Growth (D 600 ) Cell Growth (D 600 ) [Mevalonate] 5 mm 10 mm 20 mm 40 mm Time (hours) Martin et al Nat. Biotechnol. 21: Time (hours)

36 Intracellular prenyl pyrophosphates in MevB-supplemented strains Counts (CPM) 8,000 7,000 6,000 5,000 4,000 3,000 2,000 1,000 Mevalonate 0 IPP / DMAPP MevB Time (hrs) DMAPP IPP 1,400 1,200 1, FPP FPP Time (hrs)

37 Intracellular prenyl pyrophosphates in MevB-supplemented strains Counts (CPM) 8,000 7,000 6,000 5,000 4,000 3,000 2,000 1,000 Mevalonate 0 IPP / DMAPP MevB Time (hrs) idi DMAPP IPP ispa 1,400 1,200 1, FPP FPP Time (hrs)

38 Intracellular prenyl pyrophosphates in MevB-supplemented strains Counts (CPM) 8,000 7,000 6,000 5,000 4,000 3,000 2,000 1,000 Mevalonate 0 IPP / DMAPP MevB Time (hrs) idi DMAPP IPP ispa 1,400 1,200 1, FPP FPP Time (hrs)

39 Intracellular prenyl pyrophosphates in MevB-supplemented strains Counts (CPM) 8,000 7,000 6,000 5,000 4,000 3,000 2,000 1,000 Mevalonate 0 IPP / DMAPP MevB Time (hrs) idi DMAPP IPP ispa 1,400 1,200 1, FPP FPP Time (hrs) ADS Amorphadiene

40 G6P FDP Accumulation of IPP/DMAPP inhibits growth DHAP G3P PEP DXP PYR AcCoA MEV IPP DMAPP AA CIT GPP MAL Exogenous MEV FPP

41 G6P FDP Accumulation of FPP also inhibits growth DHAP G3P PEP DXP PYR AcCoA MEV IPP DMAPP AA CIT GPP MAL Exogenous MEV FPP Amorphadiene

42 G6P FDP Production of amorphadiene relieves inhibition DHAP G3P PEP DXP PYR AcCoA MEV IPP DMAPP AA CIT GPP MAL Exogenous MEV FPP Amorph

43 Construction of synthetic mevalonate pathway operons MevT atob HMGS thmgr Acetyl-CoA P (1.2kb) (1.5kb) (1.6kb) Mevalonate MBI Mevalonate P MK (1.2kb) PMK (1.3kb) MPD (1.3kb) idi (0.5kb) IPP DMAPP

44 Balancing enzymatic reactions in the cell atob hmgs gene 2 AtoB HmgS HmgR Ac-CoA AcAc-CoA HMG-CoA Mev

45 Balancing enzymatic reactions in the cell atob hmgs gene 2 AtoB HmgS HmgR Ac-CoA AcAc-CoA HMG-CoA Mev

46 Using individual promoters of different strengths to balance a pathway P 1 P 3 P 2 atob hmgs hmgr mrna AtoB HmgS HmgR Ac-CoA AcAc-CoA HMG-CoA Mev

47 P Synthetic operons atob hmgs hmgr DNA mrna AtoB HmgS HmgR Ac-CoA AcAc-CoA HMG-CoA Mev

48 Balancing reaction using ribosome binding site (RBS) strength Ribosomes Proteins weak RBS weak RBS Strong RBS AtoB HmgS HmgR Ac-CoA AcAc-CoA HMG-CoA Mev

49 Balancing reaction using mrna stability RNase mrna AtoB HmgS HmgR Ac-CoA AcAc-CoA HMG-CoA Mev

50 A family of synthetic hairpins ptc40 g ag u cg php8 ua g c g u c a g u u u a c g php9 php16 c c u a a a a u g a g g c g a a uu u ag a u u c g a t c g c g u a c u u a g a a cu g c g g u u a c g u a a ua c g a u g a u g a c u u a u a php14 ac gguaccguauuuu g c u u u u a c g c g g ag c g u a a u t c php15 g a 1/2 = 6.1 min c g u g u u c g a g u php4 c g u c g a u a a u g u a c u a g c a g g c u u c c gu ac gguaccguauuuu g g u a a ac gguaccguauuuu u u uu c g c g u a c a g t u 1/2 = 5.5 min u a a t 1/2 = 19.8 min c g g c g u u a u a u u a php10 u u a c g g c a u u a u a ac gguaccguauuuu c g g a g a g c uu u u a c gguaccguauuuu a t 1/2 = 4.9 min c g c g g u u a a t 1/2 = 12.5 min c g c g u a a g c u g u c g a u u a ac gguaccguauuuu a g c u a c gguaccguauuuu t 1/2 = 2.1 min c g a t g u 1/2 = 8.3 min c g u a g c ac gguaccguauuuu t 1/2 = 6.8 min acgucgacagguaccguauuuu t 1/2 = 2.6 min php17

51 P Synthetic operons atob hmgs hmgr DNA mrna AtoB HmgS HmgR Ac-CoA AcAc-CoA HMG-CoA Mev

52 Glucose G6P FDP Increasing flux into the mevalonate pathway DHAP G3P PEP DXP PYR AcCoA MEV Mevalonate pathway IPP DMAPP AA CIT GPP MAL FPP Amorphadiene

53 Increasing flux into the mevalonate pathway Amorphadiene production (ug/ml/d600) LB LB + Glycerol TB Time (Hours) ~3-fold improvement (10 mg/l/d)

54 Amorphadiene production (ug/ml/d600) Amorphadiene is lost from bioreactors Time (hr) 2

55 Amorphadiene is lost from bioreactors 2 Condenser Amorphadiene

56 Amorphadiene production in a two-phase fermentation Amorphadiene concentration (mg/l) million fold improved production! Time (hr)

57 What s left? Amorphadiene Artemisinic Acid H H H H H Artesunate (Artesunic Acid) H H H H H H H H H H Artemisinic Acid H H H H Me H H H H H Et H H H H H H H Artelinate (Artelinic Acid) Arteether Artemether

58 Artemisinin costs Artesunate treatment SP + Artesunate treatment Current cost of drug $ Cost with new process, including capital costs, yield 50 g/l Cost with new process, with donated capital, yield 50 g/l $.17/.10 $.27/.15 $.11/.07 $.21/.12

59 GGPP Diterpenes G6P FDP Enzyme engineering to produce mono- and diterpenes DHAP G3P PEP DXP PYR AcCoA MEV IPP DMAPP AA CIT GPP Monoterpenes MAL FPP Sesquiterpenes

60 Design of GPP and GGPP synthases WT ipsa 75-ECIHAYSLIHDDLPAMDDDDLRRGLP-100 Y80D 75-ECIHADSLIHDDLPAMDDDDLRRGLP-100 S81F 75-ECIHAYFLIHDDLPAMDDDDLRRGLP XXxxxDDxxxxD -- Type 2 5 th 4 th

61 G6P FDP Production of monoterpenes in Escherichia coli DHAP G3P PEP DXP PYR AcCoA MEV IPP DMAPP AA MAL CIT GPP Myrcene Arabidopsis thaliana

62 G6P FDP Production of diterpenes in Escherichia coli DHAP G3P PEP PYR DXP ent-kaurene fungi AcCoA MEV IPP DMAPP AA MAL CIT GGPP Casbene Castor bean

63 Taxol from the Pacific Yew CH 3 HN H 18 H 3 C CH 3 CH H CH H CH 3

64 Eleutherobin from marine coral

65 Prostratin Protein kinase C activator Isolated from the stems of the small Samoan tree Homalanthus nutans Inhibits human immunodeficiency virus type 1 (HIV-1) infection yet up-regulates viral expression from latent proviruses

66 Acknowledgements Graduate Students Trent A. Carrier Kristala Jones Christina Smolke Doug Pitera Sydnor Withers Brian Pfleger Yasuo Yoshikuni Post-docs Artem Khlebnikov Seon-Won Kim Vincent Martin Jack Newman Kinkead Reiling Funding National Science Foundation ffice of Naval Research Maxygen Diversa University of California Discovery Grant