Gdansk, Gdansk, Poland c Department of Biochemistry and Clinical Physiology, Medical
|
|
- Mary Short
- 6 years ago
- Views:
Transcription
1 This article was downloaded by: [Gdanski Uniwersytet Medyczny] On: 11 July 2014, At: 08:04 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: Registered office: Mortimer House, Mortimer Street, London W1T 3JH, UK Nucleosides, Nucleotides and Nucleic Acids Publication details, including instructions for authors and subscription information: Extracellular Nucleotide Catabolism in Aortoiliac Bifurcation of Atherosclerotic ApoE/LDLr Double Knock Out Mice Barbara Kutryb-Zajac a, Paulina Zukowska a, Marta Toczek a, Magdalena Zabielska a, Marcin Lipinski b, Iwona Rybakowska c, Stefan Chlopicki d, Ewa M. Slominska a & Ryszard T. Smolenski a a Department of Biochemistry, Medical University of Gdansk, Gdansk, Poland b Department of Pharmaceutical Biochemistry, Medical University of Gdansk, Gdansk, Poland c Department of Biochemistry and Clinical Physiology, Medical University of Gdansk, Gdansk, Poland d Department of Experimental Pharmacology, Jagiellonian University Medical College and Jagiellonian Centre for Experimental Therapeutics (JCET), Jagiellonian University, Krakow, Poland Published online: 18 Jun To cite this article: Barbara Kutryb-Zajac, Paulina Zukowska, Marta Toczek, Magdalena Zabielska, Marcin Lipinski, Iwona Rybakowska, Stefan Chlopicki, Ewa M. Slominska & Ryszard T. Smolenski (2014) Extracellular Nucleotide Catabolism in Aortoiliac Bifurcation of Atherosclerotic ApoE/ LDLr Double Knock Out Mice, Nucleosides, Nucleotides and Nucleic Acids, 33:4-6, , DOI: / To link to this article: PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the Content ) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or
2 howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at
3 Nucleosides, Nucleotides and Nucleic Acids, 33: , 2014 Copyright C Taylor and Francis Group, LLC ISSN: print / online DOI: / EXTRACELLULAR NUCLEOTIDE CATABOLISM IN AORTOILIAC BIFURCATION OF ATHEROSCLEROTIC ApoE/LDLr DOUBLE KNOCK OUT MICE Barbara Kutryb-Zajac, 1 Paulina Zukowska, 1 Marta Toczek, 1 Magdalena Zabielska, 1 Marcin Lipinski, 2 Iwona Rybakowska, 3 Stefan Chlopicki, 4 Ewa M. Slominska, 1 and Ryszard T. Smolenski 1 1 Department of Biochemistry, Medical University of Gdansk, Gdansk, Poland 2 Department of Pharmaceutical Biochemistry, Medical University of Gdansk, Gdansk, Poland 3 Department of Biochemistry and Clinical Physiology, Medical University of Gdansk, Gdansk, Poland 4 Department of Experimental Pharmacology, Jagiellonian University Medical College and Jagiellonian Centre for Experimental Therapeutics (JCET), Jagiellonian University, Krakow, Poland Atherosclerosis is a consequence of diverse pathologies that could be affected by signaling mediated by nucleotides and their metabolites. Concentration of specific nucleotide derivatives in the proximity of purinergic receptors is controlled by extracellular enzymes such as ecto-nucleoside triphopsphate diphosphohydrolase (entpd), ecto-5 -nucleotidase (e5nt), and ecto-adenosine deaminase (eada). To estimate changes in metabolism of extracellular nucleotides in the atherosclerotic vessel wall, aortoiliac bifurcation of ApoE/LDLr ( / ) mice was perfused with solution containing adenosine-5 -triphosphate (ATP), adenosine-5 -monophosphate (AMP) or adenosine. Formation of the product of entpd, e5nt or eada was measured by high performance liquid chromatography (HPLC). The most significant difference between ApoE/LDLr ( / ) and wild-type mice was several times higher rate of conversion of adenosine to inosine catalyzed by eada activity. This highlights potential decrease in intravascular adenosine concentration in atherosclerosis. Keywords Nucleotides; ecto-nucleoside triphopsphate diphosphohydrolase; ecto-5 - nucleotidase; adenosine deaminase; adenosine; atherosclerosis; inflammation Received 20 September 2013; accepted 23 December This study was supported by European Union from the resources of the European Regional Development Fund under the Innovative Economy Programme (grant coordinated by JCET-UJ, No POIG /09), National Science Centre of Poland (2011/01/B/NZ4/03719), and Foundation for Polish Science (TEAM/2011-8/7). Address correspondence to Ryszard T. Smolenski, Department of Biochemistry, Medical University of Gdansk, Debinki 1, Gdansk, Poland. rt.smolenski@gumed.edu.pl 323
4 324 B. Kutryb-Zajac et al. INTRODUCTION Atherosclerosis leading to cardiovascular diseases is a main cause of mortality worldwide. [1] The development of this process is characterized by a long asymptomatic phase with the critical role of local inflammation and thrombotic mechanisms in a vessel wall. [2,3] Extracellular metabolism of nucleotides plays a critical role in regulation of these mechanisms. [4] Ecto-nucleoside triphopsphate diphosphohydrolase (entpd) and ecto-5 - nucleotidase (e5nt) modulates concentrations of molecules involved in purinergic signaling: ATP, ADP, and adenosine. Besides these activities, extracellular adenosine deaminase (eada) could further modify concentration of adenosine by its conversion to inosine. [5] Enzymes responsible for extracellular nucleotide catabolism could be present in the vessel wall predominantly endothelium or on the surface of the other cells present in blood erythrocytes and in particular cells of the immune system. Besides cellular enzymes, blood plasma activities can also contribute to nucleotide metabolism. [6,7] Clarification of these complex relations is therefore interesting and important, particularly in pathological conditions such as atherosclerosis. The purpose of this study was to compare rates of conversion of ATP, AMP, and adenosine in the vessel of normal and mice with atherosclerosis (ApoE/LDLr / ). MATERIALS AND METHODS Double-knockout mice for apolipoprotein E (ApoE) and low-density lipoprotein receptor (LDLr) on the C57BL/6J x129/svj background and control wild-type mice of the same strain were maintained on standard laboratory diet. All animal care and experimental procedures complied with the EU guidelines and were approved by the local Bioethical Committee at the Medical University of Gdansk. Five male ApoE/LDLr ( / ) mice and five wild-type mice as a control (20 weeks of age, weighing g) were used. Mice from both groups of the study were anesthetized with a mixture of ketamine (100 mg/kg) and xylazine (10 mg/kg) given intraperitoneally. Abdominal aorta was then collected, cannulated, and ligated by suture just below the middle caudal artery. The perfused fragment included aortoiliac bifurcation from the middle caudal artery to ramification of the iliac arteries. Perfusion was carried out using a peristaltic pomp with Hanks Balanced Salt Solution (HBSS). The flow rate was 0.4 ml/min and the whole system was maintained at 37 C. After a 5-minute equilibration period, the substrates were added in sequence: adenosine, ATP, and AMP at 50 μm concentration. An inhibitor of adenosine deaminase-erythro-9-(2-hydroxy-3-nonyl)adenine (EHNA) was present at 5 μm concentration during perfusion with ATP and AMP to block conversion of adenosine to inosine. Samples of perfusion
5 Extracellular Nucleotide Catabolism 325 FIGURE 1 Concentration of entpd reactants at the inflow and outflow during perfusion of the aortoiliac bifurcation of wild-type mice (A) and ApoE/LDLr / - mice (B). Results shown as mean ± SEM, n = 5. medium both at inflow to the vessel and at outflow with each substrate were collected during each 1-minute perfusion. Concentrations of ATP, ADP, AMP, adenosine, inosine, hypoxanthine, xanthine, and urid acid were measured by HPLC according to the method described earlier. [8] Results are reported as the mean ± SEM. Comparison of the means was done by Student s t-test. p < 0.05 was considered significant. RESULTS Data presented on Figures 1 3 show the change in the concentrations of nucleotide metabolites during the passage of perfusion solution through the vessel. We did not observe significant differences during the infusion of ATP or AMP suggesting that activities of entpd and e5nt in ApoE/LDLr ( / ) versus wild-type mice do not differ (Figures 1 and 2). Nevertheless, some trends that suggest an increased conversion rate of ADP to AMP and AMP to adenosine in ApoE/LDLr ( / ) mice have been noted. Its full clarification needs more observation in studied age group or analysis in different age groups. Interestingly, concentration of inosine in the outflow perfusate of ApoE/LDLr ( / ) mice was six times higher than in wild type while adenosine was completely removed in ApoE/LDLr ( / ) and retained in wild-type mice (Figure 3). This suggests substantial elevation of eada activity in ApoE/LDLr ( / ) mice. DISCUSSION This work demonstrated that intravascular degradation of adenosine in atherosclerotic mice is substantially accelerated as indicated by much higher
6 326 B. Kutryb-Zajac et al. FIGURE 2 Concentration of e5nt reactants at the inflow and outflow during perfusion of the aortoiliac bifurcation of wild-type mice (A) and ApoE/LDLr / - mice (B). Results shown as mean ± SEM, n = 5. concentration of inosine in the perfusate than in wild-type mice. Extracellular adenosine acting via P1 receptors, is considered as an important antiatherosclerotic molecule through preventing thrombosis, foam cells transformation and blood pressure elevation. [9 11] The ApoE/LDLr ( / ) mice model, which we used, is commonly accepted in atherosclerosis research and has been well characterized. [12 15] Changes in the vessel wall of these mice develops gradually, but at 4 5 FIGURE 3 Concentration of eada reactants at the inflow and outflow during perfusion of the aortoiliac bifurcation of wild-type mice (A) and ApoE/LDLr / - mice (B). Results shown as mean ± SEM, p < 0.05, p < vs. wild type, n = 5.
7 Extracellular Nucleotide Catabolism 327 months there is a particular breakthrough in the progression of inflammation, inflammatory cells infiltration in the area of atherosclerotic plaque, and the activity of matrix metalloproteinases. [16,17] The point at which the abdominal aorta bifurcates into the common iliac arteries, known as the aortoiliac bifurcation, is particularly vulnerable for atherosclerosis development through the interaction between hemodynamic forces, blood pressure and the local flow patterns. [18 20] Disrupted barrier function of the endothelium modulated by wall shear stress are involved in the infiltration and accumulation of atherogenic lipids within the arterial wall. [21] Our results indicated an increased activity of an adenosine-degrading enzyme in the atherosclerotic vessel wall. The enzyme responsible for this effect: ecto-adenosine deaminase is highly expressed on the immune cells surface and has a pivotal role in the regulation and enhancement of the inflammatory response. [22,23] An elevated activity of eada in the ApoE/LDLr ( / ) mice vessel wall may result from the infiltration by lymphocytes and/or macrophages, in which early atherosclerotic plaque is abundant. Consequently, intensification of inflammation and, hence, progression of atherosclerosis can occur due to reduced level of extracellular adenosine. The measurement of adenosine concentration in human blood is difficult due to its short half-life (<1 s) and data on its concentration in patients with atherosclerosis is limited. Besides quick metabolism of adenosine, local differences at cellular level can further complicate the interpretation of direct measurements of adenosine in blood. [24] It can be, however, stated with certainty that high expression of eada at the cell surface will lead to reduction of adenosine receptor activation. Clinical studies in patients with atherosclerosis demonstrated elevated activity of serum adenosine deaminase in patients with unstable angina. [25] This observation, which is consistent with our data, may indicate that an increase in adenosine degrading enzyme activity in the atherosclerotic vessel may be of clinical importance, but its full elucidation requires further studies. REFERENCES 1. Minino, A.M.; Murphy, S.L.; Xu, J.; Kochanek, K.D. Deaths: final data for Natl. Vital. Stat. Rep. 2011, 59, Pastrana, J.L.; Sha, X.; Virtue, A.; Mai, J.; Cueto, R.; Lee, I.A.; Wang, H.; Yang, X.F. Regulatory T cells and atherosclerosis. J. Clin. Exp. Cardiol. 2012, S12, Herbin, O.; Ait-Oufella, H.; Yu, W.; Fredrikson, G.N.; Aubier, B.; Perez, N.; Barateau, V.; Nilsson, J.; Tedgui, A.; Mallat, Z. Regulatory T-cell response to apolipoprotein B100-derived peptides reduces the development and progression of atherosclerosis in mice. Arterioscler Thromb. Vasc. Biol. 2012, 32, Hasko, G.; Cronstein, B.N. Adenosine: an endogenous regulator of innate immunity. Trends Immunol. 2004, 25,
8 328 B. Kutryb-Zajac et al. 5. Dong, R.P.; Kameoka, J.; Hegen, M.; Tanaka, T.; Xu, Y.; Schlossman, S. F.; Morimoto, C. Characterization of adenosine deaminase binding to human CD26 on T cells and its biologic role in immune response. J. Immunol. 1996, 156, Robson, S.C.; Sevigny, J.; Zimmermann, H. The E-NTPDase family of ectonucleotidases: structure function relationships and pathophysiological significance. Purinergic Signal 2006, 2, Salmi, M.; Jalkanen, S. Cell-surface enzymes in control of leukocyte trafficking. Nat. Rev. Immunol. 2005, 5, Smolenski, R.T.; Lachno, D.R.; Ledingham, S. J.M.; Yacoub, M.H. Determination of 16 nucleotides, nucleosides and bases using high-performance liquid-chromatography and its application to the study of purine metabolism in hearts for transplantation. J. Chromatogr. Biomed. Appl. 1990, 527, Koupenova, M.; Johnston-Cox, H.; Ravid, K. Regulation of atherosclerosis and associated risk factors by adenosine and adenosine receptors. Curr. Atheroscler. Rep. 2012, 14, Hasko, G.; Pacher, P. Regulation of macrophage function by adenosine. Arterioscler Thromb. Vasc. Biol. 2012, 32, Reiss, A.B.; Cronstein, B.N. Regulation of foam cells by adenosine. Arterioscler Thromb. Vasc. Biol. 2012, 32, Kostogrys, R.B.; Franczyk-Zarow, M.; Maslak, E.; Gajda, M.; Mateuszuk, L.; Jackson, C.L.; Chlopicki, S. Low carbohydrate, high protein diet promotes atherosclerosis in apolipoprotein E/low-density lipoprotein receptor double knockout mice (apoe/ldlr-/-). Atherosclerosis 2012, 223, Gajda, M.; Banas, K.; Banas, A.; Jawien, J.; Mateuszuk, L.; Chlopicki, S.; Kwiatek, W.M.; Cichockil, T.; Falkenberg, G. Distribution of selected elements in atherosclerotic plaques of apoe/ldlr-double knockout mice assessed by synchrotron radiation-induced micro-xrf spectrometry. X-Ray Spectrom. 2008, 37, Csanyi, G.; Gajda, M.; Franczyk-Zarow, M.; Kostogrys, R.; Gwozdz, P.; Mateuszuk, L.; Sternak, M.; Wojcik, L.; Zalewska, T.; Walski, M.; Chlopicki, S. Functional alterations in endothelial NO, PGI(2) and EDHF pathways in aorta in ApoE/LDLR-/- mice. Prostaglandins Other Lipid Mediat. 2012, 98, Jawien, J.; Gajda, M.; Rudling, M.; Mateuszuk, L.; Olszanecki, R.; Guzik, T. J.; Cichocki, T.; Chlopicki, S.; Korbut, R. Inhibition of five lipoxygenase activating protein (FLAP) by MK-886 decreases atherosclerosis in apoe/ldlr-double knockout mice. Eur. J. Clin. Invest. 2006, 36, Mateuszuk, L.; Khomich, T.I.; Slominska, E.; Gajda, M.; Wojcik, L.; Lomnicka, M.; Gwozdz, P.; Chlopicki, S. Activation of nicotinamide N-methyltrasferase and increased formation of 1- methylnicotinamide (MNA) in atherosclerosis. Pharmacol. Rep. 2009, 61, Gajda, M.; Jawien, J.; Mateuszuk, L.; Lis, G.J.; Radziszewski, A.; Chopicki, S.; Litwin, J.A. Triple immunofluorescence labeling of atherosclerotic plaque components in apoe/ldlr-/- mice. Folia Histochemica Et Cytobiologica 2008, 46, Bassiouny, H.S.; Zarins, C.K.; Kadowaki, M.H.; Glagov, S. Hemodynamic stress and experimental aortoiliac atherosclerosis. J. Vasc. Surg. 1994, 19, Tse, J.; Martin-McNaulty, B.; Halks-Miller, M.; Kauser, K.; DelVecchio, V.; Vergona, R.; Sullivan, M.E.; Rubanyi, G.M. Accelerated atherosclerosis and premature calcified cartilaginous metaplasia in the aorta of diabetic male Apo E knockout mice can be prevented by chronic treatment with 17 beta-estradiol. Atherosclerosis 1999, 144, Nakashima, Y.; Plump, A.S.; Raines, E.W.; Breslow, J.L.; Ross, R. ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree. Arterioscler Thromb. 1994, 14, Ding, Z.; Fan, Y.; Deng, X.; Sun, A.; Kang, H. 3,3 -Dioctadecylindocarbocyanine-low-density lipoprotein uptake and flow patterns. Exp. Biol. Med. (Maywood). 2010, 235, Lluis, C.; Franco, R.; Cordero, O. Ecto-ADA in the development of the immune system. Immunol. Today. England 1998, Souza Vdo, C.; Schlemmer, K.B.; Noal, C.B.; Jaques, J.A.; Zimmermann, C.E.; Leal, C.A.; Fleck, J.; Casali. E.A.; Morsch, V.M.; Schetinger, M.R.; Leal, D.B. E-NTPDase and E-ADA activities are altered in lymphocytes of patients with indeterminate form of Chagas disease. Parasitol. Int. 2012, 61, Yegutkin, G.G.; Mikhailov, A.; Samburski, S.S.; Jalkanen, S. The detection of micromolar pericellular ATP pool on lymphocyte surface by using lymphoid ecto-adenylate kinase as intrinsic ATP sensor. Mol. Biol. Cell 2006, 17, Rani, S.H.; Rao, D.V.; Prakash, S.M.; Jyothy, A. Serum adenosine deaminase activity and C-reactive protein levels in unstable angina. India: Indian J. Hum. Genet. 2003,
MODULATION OF AMP DEAMINASE IN RAT HEARTS SUBJECTED TO ISCHEMIA AND REPERFUSION BY PURINE RIBOSIDE
Nucleosides, Nucleotides, and Nucleic Acids, 27:876 88, 28 Copyright C Taylor & Francis Group, LLC ISSN: 1525-777 print / 1532-2335 online DOI: 1.18/152577782146551 MODULATION OF AMP DEAMINASE IN RAT HEARTS
More informationBack-Calculation of Fish Length from Scales: Empirical Comparison of Proportional Methods
Animal Ecology Publications Animal Ecology 1996 Back-Calculation of Fish Length from Scales: Empirical Comparison of Proportional Methods Clay L. Pierce National Biological Service, cpierce@iastate.edu
More informationCostanza Scaffidi Abbate a b, Stefano Ruggieri b & Stefano Boca a a University of Palermo
This article was downloaded by: [Costanza Scaffidi Abbate] On: 29 July 2013, At: 06:31 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer
More informationDimitris Pnevmatikos a a University of Western Macedonia, Greece. Published online: 13 Nov 2014.
This article was downloaded by: [Dimitrios Pnevmatikos] On: 14 November 2014, At: 22:15 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer
More informationTo link to this article:
This article was downloaded by: [University of Kiel] On: 24 October 2014, At: 17:27 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer
More informationAnne A. Lawrence M.D. PhD a a Department of Psychology, University of Lethbridge, Lethbridge, Alberta, Canada Published online: 11 Jan 2010.
This article was downloaded by: [University of California, San Francisco] On: 05 May 2015, At: 22:37 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered
More informationTo link to this article:
This article was downloaded by: [University of Notre Dame] On: 12 February 2015, At: 14:40 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office:
More informationWild Minds What Animals Really Think : A Museum Exhibit at the New York Hall of Science, December 2011
This article was downloaded by: [Dr Kenneth Shapiro] On: 09 June 2015, At: 10:40 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer
More informationLora-Jean Collett a & David Lester a a Department of Psychology, Wellesley College and
This article was downloaded by: [122.34.214.87] On: 10 February 2013, At: 16:46 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,
More informationNANCY FUGATE WOODS a a University of Washington
This article was downloaded by: [ ] On: 30 June 2011, At: 09:44 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer
More informationRichard Lakeman a a School of Health & Human Sciences, Southern Cross University, Lismore, Australia. Published online: 02 Sep 2013.
This article was downloaded by: [UQ Library] On: 09 September 2013, At: 21:23 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,
More informationPublished online: 17 Feb 2011.
This article was downloaded by: [Iowa State University] On: 23 April 2015, At: 08:45 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer
More informationCognitive Enhancement Using 19-Electrode Z-Score Neurofeedback
This article was downloaded by: [Lucas Koberda] On: 22 August 2012, At: 09:31 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,
More informationLaura N. Young a & Sara Cordes a a Department of Psychology, Boston College, Chestnut
This article was downloaded by: [Boston College] On: 08 November 2012, At: 09:04 Publisher: Psychology Press Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer
More informationPLEASE SCROLL DOWN FOR ARTICLE
This article was downloaded by:[university of Virginia] On: 26 November 2007 Access Details: [subscription number 785020474] Publisher: Informa Healthcare Informa Ltd Registered in England and Wales Registered
More informationPLEASE SCROLL DOWN FOR ARTICLE. Full terms and conditions of use:
This article was downloaded by: [Chiara, Andrea Di] On: 30 December 2010 Access details: Access Details: [subscription number 931692396] Publisher Routledge Informa Ltd Registered in England and Wales
More informationKey Knowledge Generation Publication details, including instructions for author and Subscription information:
This article was downloaded by: Publisher: KKG Publications Registered office: 18, Jalan Kenanga SD 9/7 Bandar Sri Damansara, 52200 Malaysia Key Knowledge Generation Publication details, including instructions
More informationAdvanced Projects R&D, New Zealand b Department of Psychology, University of Auckland, Online publication date: 30 March 2011
This article was downloaded by: [University of Canterbury Library] On: 4 April 2011 Access details: Access Details: [subscription number 917001820] Publisher Psychology Press Informa Ltd Registered in
More informationThe Flynn effect and memory function Sallie Baxendale ab a
This article was downloaded by: [University of Minnesota] On: 16 August 2010 Access details: Access Details: [subscription number 917397643] Publisher Psychology Press Informa Ltd Registered in England
More informationMarie Stievenart a, Marta Casonato b, Ana Muntean c & Rens van de Schoot d e a Psychological Sciences Research Institute, Universite
This article was downloaded by: [UCL Service Central des Bibliothèques], [Marie Stievenart] On: 19 June 2012, At: 06:10 Publisher: Psychology Press Informa Ltd Registered in England and Wales Registered
More informationClinical Biochemistry department/ College of medicine / AL-Mustansiriyah University
Clinical Biochemistry department/ College of medicine / AL-Mustansiriyah University Dr. Ali al-bayati NUCLEOTIDE METABOLISM Lec. 3 The salvage pathway of purine synthesis Purines that result from the normal
More informationRole of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD
Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD Our laboratory focuses on the role of apolipoprotein (apo) B- containing lipoproteins in normal
More informationThis article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and
This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution
More informationLes McFarling a, Michael D'Angelo a, Marsha Drain a, Deborah A. Gibbs b & Kristine L. Rae Olmsted b a U.S. Army Center for Substance Abuse Programs,
This article was downloaded by: [Florida State University] On: 10 November 2011, At: 13:53 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office:
More informationEffect of insulin and glucose on adenosine metabolizing enzymes in human B lymphocytes
Vol. 56 No. 3/29, 439 446 Regular paper on-line at: www.actabp.pl Effect of insulin and glucose on adenosine metabolizing enzymes in human B lymphocytes Katarzyna Kocbuch 1, Monika Sakowicz-Burkiewicz
More informationA Project to Clone Companion Animals Mark Greene Published online: 04 Jun 2010.
This article was downloaded by: [Dr Kenneth Shapiro] On: 08 June 2015, At: 09:28 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer
More informationPLEASE SCROLL DOWN FOR ARTICLE. Full terms and conditions of use:
This article was downloaded by: [University of Cardiff] On: 3 March 2010 Access details: Access Details: [subscription number 906511392] Publisher Routledge Informa Ltd Registered in England and Wales
More informationPLEASE SCROLL DOWN FOR ARTICLE
This article was downloaded by:[heal- Link Consortium] On: 21 November 2007 Access Details: [subscription number 772810500] Publisher: Informa Healthcare Informa Ltd Registered in England and Wales Registered
More informationDyslipidemia Endothelial dysfunction Free radicals Immunologic
ATHEROSCLEROSIS Hossein Mehrani Professor of Clinical Biochemistry Definition Atherosclerosis: Is a chronic inflammatory process characterized by plaque formation within the vessel wall of arteries and
More informationAmerican Journal of Human Genetics. American Journal of Hypertension. American Journal of Neuroradiology
A) Acta Neurochir AJNR Am J Neuroradiol Am Coll Rheumatol Am J Cardiol Am J Hum Genet Am J Hypertens Am J Neuroradiol AJNR Am J Physiol Am J Physiol Gastrointest Liver Physiol Am J Physiol Heart Circ physiol
More informationImmune Cells in Atherosclerosis Regulatory vs Inflammatory T cells Göran K Hansson
Immune Cells in Atherosclerosis Regulatory vs Inflammatory T cells Göran K Hansson Center for Molecular Medicine Karolinska Institute Stockholm, Sweden DECLARATION OF CONFLICT OF INTEREST Goran Hansson
More informationPLEASE SCROLL DOWN FOR ARTICLE
This article was downloaded by:[university of Virginia] On: 26 November 2007 Access Details: [subscription number 785020474] Publisher: Informa Healthcare Informa Ltd Registered in England and Wales Registered
More informationVersion of record first published: 25 Apr 2012.
This article was downloaded by: [Dr William T. Tsushima] On: 23 October 2012, At: 13:21 Publisher: Psychology Press Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office:
More informationPrevalence of Coronary Artery Disease: A Tertiary Care Hospital Based Autopsy Study
Article History Received: 03 Feb 2016 Revised: 05 Feb 2016 Accepted: 08 Feb 2016 *Correspondence to: Dr. Alpana Jain Senior demonstrator SMS Medical College, Jaipur, Rajasthan, INDIA. dr.alpana.jain@gmail.com
More informationLife Events, Social Support, and Depression Among Taiwanese Female Homemakers
This article was downloaded by: [National Taiwan University] On: 17 November 2014, At: 18:56 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office:
More informationEHPS 2012 abstracts. To cite this article: (2012): EHPS 2012 abstracts, Psychology & Health, 27:sup1, 1-357
This article was downloaded by: [158.197.72.142] On: 30 August 2012, At: 04:44 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,
More informationTexas A&M University, College Station, TX, USA b University of Missouri, Columbia, MO, USA
This article was downloaded by: [Hicks, Joshua A.][Texas A&M University] On: 11 August 2010 Access details: Access Details: [subscription number 915031380] Publisher Psychology Press Informa Ltd Registered
More informationAdenosine deaminase severe combined immunodeficiency (ADA-SCID)
Adenosine deaminase severe combined immunodeficiency (ADA-SCID) Christopher A. Haynes, PhD Service Fellow, CDC National Conversation: Tandem Mass Spectrometry in Newborn Screening February 5-6, 2015 National
More informationStudies on Components of Blood and its Functions
Chapter 3 Inflammation and Platelet Aggregation: The Role of Blood Extracellular Purines and Adenosine Andréia Machado Cardoso*; Leandro Henrique Manfredi Federal University of Fronteira Sul, Campus Chapecó,
More informationProstaglandins and Other Lipid Mediators
Prostaglandins & other Lipid Mediators 98 (2012) 107 115 Contents lists available at SciVerse ScienceDirect Prostaglandins and Other Lipid Mediators Functional alterations in endothelial NO, PGI 2 and
More informationMoneyball: The Art of Winning the American Dental Association Membership Renewal Game
This article was downloaded by: [97.73.50.115] On: 19 June 2014, At: 03:22 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,
More informationThe aorta is an integral part of the cardiovascular system and should not be considered as just a conduit for blood supply from the heart to the
The aorta is an integral part of the cardiovascular system and should not be considered as just a conduit for blood supply from the heart to the limbs and major organs. A range of important pathologies
More informationKEY COMPONENTS. Metabolic Risk Cardiovascular Risk Vascular Inflammation Markers
CardioMetabolic Risk Poor blood sugar regulation and unhealthy triglyceride and lipoprotein levels often present long before the diagnosis of type 2 Diabetes. SpectraCell s CardioMetabolic and Pre-Diabetes
More informationCardiovascular Division, Brigham and Women s Hospital, Harvard Medical School
Low Endothelial Shear Stress Upregulates Atherogenic and Inflammatory Genes Extremely Early in the Natural History of Coronary Artery Disease in Diabetic Hyperlipidemic Juvenile Swine Michail I. Papafaklis,
More informationCIC Edizioni Internazionali. Cardio-metabolic comorbidities in rheumatoid arthritis and SLE. Review. 120 Clinical Dermatology 2013; 1 (2):
Review Cardio-metabolic comorbidities in rheumatoid arthritis and SLE Andrea Doria Division of Rheumatology University of Padua, Italy Address for correspondence: Division of Rheumatology University of
More informationMetabolism and Atherogenic Properties of LDL
Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal
More informationEILEEN K. McMILLEN a, HERBERT W. HELM JR. a & DUANE C. McBRIDE a a Department of Behavioral Sciences, Andrews
This article was downloaded by: [Andrews University] On: 11 July 2013, At: 07:04 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer
More informationThe inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema
The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema Dept Cardiology, Leiden University Medical Center, Leiden,
More informationIdentification & Confirmation of Structurally Related Degradation Products of Simvastatin
Identification & Confirmation of Structurally Related Degradation Products of Simvastatin Power of QTRAP Systems for Identification and Confirmation of Degradation Products Dilip Reddy 1, Chandra Sekar
More informationImmunoTools special Award 2014
ImmunoTools special Award 2014 Davide Ferrari, PhD University of Ferrara, Department of Morphology, Surgery and Experimental Medicine. Section of Pathology, Oncology and Exper. Biology via L. Borsari 46,
More informationOnline publication date: 08 June 2010
This article was downloaded by: [Vrije Universiteit, Library] On: 1 June 2011 Access details: Access Details: [subscription number 907218003] Publisher Routledge Informa Ltd Registered in England and Wales
More informationOleuropein and Related Compounds Reduce Atherosclerosis
The Open Conference Proceedings Journal, 2010, 1, 81-86 81 Oleuropein and Related Compounds Reduce Atherosclerosis Open Access Paul L. Huang*, Philip L. Huang and Sylvia Lee-Huang Cardiology Division,
More informationLIPOPROTEIN-ASSOCIATED PHOSPHOLIPASE A 2 : EFFECTS OF LOW DENSITY LIPOPROTEIN APHERESIS
LIPOPROTEIN-ASSOCIATED PHOSPHOLIPASE A 2 : EFFECTS OF LOW DENSITY LIPOPROTEIN APHERESIS Patrick M. Moriarty, M.D., FACP, Director, Atherosclerosis and LDL-Apheresis Center, University of Kansas Medical
More informationAndrea W. Clay a b, Mollie A. Bloomsmith a b, M. Jackson Marr b & Terry L. Maple b a Yerkes National Primate Research Center, Emory
This article was downloaded by: [Dr Kenneth Shapiro] On: 09 June 2015, At: 08:19 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): Bempedoic acid (ETC-1002) is an ATP-citrate lyase (ACL) inhibitor that in clinical studies has been shown to decrease plasma LDL cholesterol apparently
More informationPublished online: 14 Dec 2007.
This article was downloaded by: [University of Cambridge] On: 09 October 2014, At: 08:25 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer
More informationTracking a Killer Molecule
Tracking a Killer Molecule Mercodia Oxidized LDL ELISA www.mercodia.com Mercodia Oxidized LDL ELISA products Product Catalog No Kit size Oxidized LDL ELISA 10-1143-01 96 wells Oxidized LDL competitive
More informationMDSC 1102/VM1102 Cardiovascular and Renal. Purine nucleotide metabolism
MDSC 1102/VM1102 Cardiovascular and Renal Purine nucleotide metabolism Dr. J. Foster Biochemistry Unit, Dept. Preclinical Sciences Faculty of Medical Sciences, U.W.I. Learning Objectives Discuss purineand
More informationREAGENTS. RANDOX sdldl CHOLESTEROL (sdldl-c) SIZE MATTERS: THE TRUE WEIGHT OF RISK IN LIPID PROFILING
REAGENTS RANDOX sdldl CHOLESTEROL (sdldl-c) SIZE MATTERS: THE TRUE WEIGHT OF RISK IN LIPID PROFILING Randox sdldl Cholesterol (sdldl-c) Size Matters: The True Wight of Risk in Lipid Profiling 1. BACKGROUND
More informationSummary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
More information9SA, UK Published online: 04 Jan 2008.
This article was downloaded by: [European Association of Psychology and Law] On: 11 December 2014, At: 12:40 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954
More informationPLEASE SCROLL DOWN FOR ARTICLE
This article was downloaded by: On: 21 September 2009 Access details: Access Details: Free Access Publisher Informa Healthcare Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered
More informationCurriculum Vitae. Research Officer in Baker IDI Heart & Diabetes Institute from Aug
Curriculum Vitae Yi Fu ( 付毅 ) (PhD, MBBS) Baker IDI Heart and Diabetes Institute 75 Commercial Road, Prahran, Melbourne, VIC 3004 Australia Phone: +61 3 8532 1288 Email: yi.fu@bakeridi.edu.au PROFILE Research
More informationArteriosclerosis & Atherosclerosis
Arteriosclerosis & Atherosclerosis Arteriosclerosis = hardening of arteries = arterial wall thickening + loss of elasticity 3 types: -Arteriolosclerosis -Monckeberg medial sclerosis -Atherosclerosis Arteriosclerosis,
More informationLa Trombosi Arteriosa
La Trombosi Arteriosa Prof. Giovanni Davì Medicina Interna Chieti Platelet activation and thrombosis Harrison 19 edizione Platelets are essential for primary hemostasis and repair of the endothelium They
More informationSimvastatin friend or foe in abdominal aortic aneurysm
Simvastatin friend or foe in abdominal aortic aneurysm A. Piechota-Polańczyk Department of Medical Biotechnology, Jagiellonian University, Krakow, Poland VISAR, Vienna, April 20-21, 2017 Statins in Abdominal
More informationLoss of ectonucleotidases from the coronary vascular bed after ischemia-reperfusion in isolated rat heart
Takahashi-Sato et al. BMC Cardiovascular Disorders 213, 13:53 RESEARCH ARTICLE Open Access Loss of ectonucleotidases from the coronary vascular bed after ischemia-reperfusion in isolated rat heart Kaoru
More informationInvited Review. Vascular smooth muscle cell proliferation in the pathogenesis of atherosclerotic cardiovascular diseases
Histol Histopathol (2000) 15: 557-571 Histology and Histopathology Cellular and Molecular Biology Invited Review Vascular smooth muscle cell proliferation in the pathogenesis of atherosclerotic cardiovascular
More informationDr Muge Cevik. Chelsea and Westminster Hospital, London. 18 th Annual Conference of the British HIV Association (BHIVA)
18 th Annual Conference of the British HIV Association (BHIVA) Dr Muge Cevik Chelsea and Westminster Hospital, London 18-20 April 2012, The International Convention Centre, Birmingham A09 Polymorphisms
More informationBIOCHEMISTRY & MEDICINE:
BIOCHEMISTRY & MEDICINE: INTRODUCTION Biochemistry can be defined as the science of the chemical basis of life (Gk bios "life"). The cell is the structural unit of living systems. Thus, biochemistry can
More informationGuelph, Guelph, Ontario, Canada c Department of Animal Science, Faculty of Agricultural Science, University of Guilan,
This article was downloaded by: [University of Guelph] On: 01 October 2014, At: 11:40 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office:
More informationLDL Uptake Cell-Based Assay Kit
LDL Uptake Cell-Based Assay Kit Item No. 10011125 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationPPAR history of research
PPAR Rubens, 1640 PPAR history of research number of publications 3000 2000 1000 0 till now: : 16 296 publications 1985 1990 1995 2000 2005 year liver, brown adipocytes, kidney, heart, skeletal muscles,
More informationHigh density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
More informationPLEASE SCROLL DOWN FOR ARTICLE
This article was downloaded by:[anonymous Registration for mpptwo] On: 5 June 2008 Access Details: [subscription number 780368323] Publisher: Informa Healthcare Informa Ltd Registered in England and Wales
More informationrenoprotection therapy goals 208, 209
Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization
More informationJournal of the American College of Cardiology Vol. 50, No. 24, by the American College of Cardiology Foundation ISSN /07/$32.
Journal of the American College of Cardiology Vol. 50, No. 24, 2007 2007 by the American College of Cardiology Foundation ISSN 0735-1097/07/$32.00 Published by Elsevier Inc. doi:10.1016/j.jacc.2007.07.081
More informationLipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry
Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different
More informationPATHOPHYSIOLOGY OF ACUTE CORONARY SYNDROMES
PATHOPHYSIOLOGY OF ACUTE CORONARY SYNDROMES Brian R. Holroyd, MD, FACEP, FRCPC Professor and Director, Division of Emergency Medicine, Faculty of Medicine and Dentistry, University of Alberta, Edmonton,
More informationDetection of carotid plaque neovascularization with Superb Micro-Vascular Imaging
Detection of carotid plaque neovascularization with Superb Micro-Vascular Imaging Yong Qiang Professor Ultrasonic Department, Beijing An-Zhen Hospital, Capital Medical University, China 1. Background Conventional
More informationInnate Immunity in Atherosclerosis
Innate Immunity in Atherosclerosis Peter Libby Brigham & Women s Hospital Harvard Medical School IAS Amsterdam May 26, 2015 ACS Stable demand angina Characteristics of Atherosclerotic Plaques Associated
More informationQuantitative Imaging of Transmural Vasa Vasorum Distribution in Aortas of ApoE -/- /LDL -/- Double Knockout Mice using Nano-CT
Quantitative Imaging of Transmural Vasa Vasorum Distribution in Aortas of ApoE -/- /LDL -/- Double Knockout Mice using Nano-CT M. Kampschulte 1, M.D.; A. Brinkmann 1, M.D.; P. Stieger 4, M.D.; D.G. Sedding
More informationNature Medicine doi: /nm.3150
Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG
More informationClinical Policy: Cardiac Biomarker Testing for Acute Myocardial Infarction Reference Number: CP.MP.156
Clinical Policy: Reference Number: CP.MP.156 Effective Date: 12/17 Last Review Date: 12/17 See Important Reminder at the end of this policy for important regulatory and legal information. Description The
More informationOriginal Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine
Int J Clin Exp Med 2015;8(9):16374-16378 www.ijcem.com /ISSN:1940-5901/IJCEM0010359 Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine Hongming Zhang
More informationTomasz J Guzik. Diabetes, perivascular adipose tissue and inflammation.
Tomasz J Guzik Diabetes, perivascular adipose tissue and inflammation. Translational Research Laboratory Department of Internal and Agricutural Medicine Jagiellonian University School of Medicine Cracow,
More informationMesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future
Mesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future Cell Therapy 2014 Las Vegas, NV, USA Sulaiman Al-Hashmi, PhD Sultan Qaboos University Oman What are MSCs? Stem
More informationTesting Lesniaski s Revised Brief Test
Claremont Colleges Scholarship @ Claremont Library Staff Publications and Research Library Publications 1-1-2010 Testing Lesniaski s Revised Brief Test M. Sara Lowe Claremont University Consortium Sean
More informationMedical management of abdominal aortic aneurysms
Medical management of abdominal aortic aneurysms Definition of AAA - Generally a 50% increase in native vessel diameter - Diameter 3 cm - Relative measures compared with nondiseased aortic segments less
More informationIn the name of GOD. Animal models of cardiovascular diseases: myocardial infarction & hypertension
In the name of GOD Animal models of cardiovascular diseases: myocardial infarction & hypertension 44 Presentation outline: Cardiovascular diseases Acute myocardial infarction Animal models for myocardial
More informationMetabolism of Nucleotides
Metabolism of Nucleotides Outline Nucleotide degradation Components of Nucleobases Purine and pyrimidine biosynthesis Hyperuricemia Sources Nucleotide degradation The nucleotides are among the most complex
More informationAvailable online: 09 Jun 2011
This article was downloaded by: [Bill Herring] On: 30 November 2011, At: 19:46 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,
More informationQualifying Examination (Part I)
Department of Pharmacology Qualifying Examination (Part I) December 15 & 17, 2009 Examination Committee: 1. Ron Emeson 2. Eugenia Gurevich 3. Tina Iverson 4. Brian Wadzinski Tuesday, December 15 Thursday,
More informationFamilial hypercholesterolaemia in children and adolescents
Familial hypercholesterolaemia in children and adolescents Rationale and recommendations for early identification and treatment European Atherosclerosis Society Consensus Panel Slide deck adapted from:
More informationRandy A. Sansone a b & Michael W. Wiederman c a Departments of Psychiatry and Internal Medicine, Wright State
This article was downloaded by: [174.141.48.34] On: 01 February 2013, At: 08:11 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,
More informationMagalhães, Porto, Portugal
This article was downloaded by:[b-on Consortium - 2007] On: 18 February 2008 Access Details: [subscription number 778384761] Publisher: Informa Healthcare Informa Ltd Registered in England and Wales Registered
More informationPathology of Coronary Artery Disease
Pathology of Coronary Artery Disease Seth J. Kligerman, MD Pathology of Coronary Artery Disease Seth Kligerman, MD Assistant Professor Medical Director of MRI University of Maryland Department of Radiology
More informationIschemic heart disease
Ischemic heart disease Introduction In > 90% of cases: the cause is: reduced coronary blood flow secondary to: obstructive atherosclerotic vascular disease so most of the time it is called: coronary artery
More information