Gdansk, Gdansk, Poland c Department of Biochemistry and Clinical Physiology, Medical

Size: px
Start display at page:

Download "Gdansk, Gdansk, Poland c Department of Biochemistry and Clinical Physiology, Medical"

Transcription

1 This article was downloaded by: [Gdanski Uniwersytet Medyczny] On: 11 July 2014, At: 08:04 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: Registered office: Mortimer House, Mortimer Street, London W1T 3JH, UK Nucleosides, Nucleotides and Nucleic Acids Publication details, including instructions for authors and subscription information: Extracellular Nucleotide Catabolism in Aortoiliac Bifurcation of Atherosclerotic ApoE/LDLr Double Knock Out Mice Barbara Kutryb-Zajac a, Paulina Zukowska a, Marta Toczek a, Magdalena Zabielska a, Marcin Lipinski b, Iwona Rybakowska c, Stefan Chlopicki d, Ewa M. Slominska a & Ryszard T. Smolenski a a Department of Biochemistry, Medical University of Gdansk, Gdansk, Poland b Department of Pharmaceutical Biochemistry, Medical University of Gdansk, Gdansk, Poland c Department of Biochemistry and Clinical Physiology, Medical University of Gdansk, Gdansk, Poland d Department of Experimental Pharmacology, Jagiellonian University Medical College and Jagiellonian Centre for Experimental Therapeutics (JCET), Jagiellonian University, Krakow, Poland Published online: 18 Jun To cite this article: Barbara Kutryb-Zajac, Paulina Zukowska, Marta Toczek, Magdalena Zabielska, Marcin Lipinski, Iwona Rybakowska, Stefan Chlopicki, Ewa M. Slominska & Ryszard T. Smolenski (2014) Extracellular Nucleotide Catabolism in Aortoiliac Bifurcation of Atherosclerotic ApoE/ LDLr Double Knock Out Mice, Nucleosides, Nucleotides and Nucleic Acids, 33:4-6, , DOI: / To link to this article: PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the Content ) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or

2 howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at

3 Nucleosides, Nucleotides and Nucleic Acids, 33: , 2014 Copyright C Taylor and Francis Group, LLC ISSN: print / online DOI: / EXTRACELLULAR NUCLEOTIDE CATABOLISM IN AORTOILIAC BIFURCATION OF ATHEROSCLEROTIC ApoE/LDLr DOUBLE KNOCK OUT MICE Barbara Kutryb-Zajac, 1 Paulina Zukowska, 1 Marta Toczek, 1 Magdalena Zabielska, 1 Marcin Lipinski, 2 Iwona Rybakowska, 3 Stefan Chlopicki, 4 Ewa M. Slominska, 1 and Ryszard T. Smolenski 1 1 Department of Biochemistry, Medical University of Gdansk, Gdansk, Poland 2 Department of Pharmaceutical Biochemistry, Medical University of Gdansk, Gdansk, Poland 3 Department of Biochemistry and Clinical Physiology, Medical University of Gdansk, Gdansk, Poland 4 Department of Experimental Pharmacology, Jagiellonian University Medical College and Jagiellonian Centre for Experimental Therapeutics (JCET), Jagiellonian University, Krakow, Poland Atherosclerosis is a consequence of diverse pathologies that could be affected by signaling mediated by nucleotides and their metabolites. Concentration of specific nucleotide derivatives in the proximity of purinergic receptors is controlled by extracellular enzymes such as ecto-nucleoside triphopsphate diphosphohydrolase (entpd), ecto-5 -nucleotidase (e5nt), and ecto-adenosine deaminase (eada). To estimate changes in metabolism of extracellular nucleotides in the atherosclerotic vessel wall, aortoiliac bifurcation of ApoE/LDLr ( / ) mice was perfused with solution containing adenosine-5 -triphosphate (ATP), adenosine-5 -monophosphate (AMP) or adenosine. Formation of the product of entpd, e5nt or eada was measured by high performance liquid chromatography (HPLC). The most significant difference between ApoE/LDLr ( / ) and wild-type mice was several times higher rate of conversion of adenosine to inosine catalyzed by eada activity. This highlights potential decrease in intravascular adenosine concentration in atherosclerosis. Keywords Nucleotides; ecto-nucleoside triphopsphate diphosphohydrolase; ecto-5 - nucleotidase; adenosine deaminase; adenosine; atherosclerosis; inflammation Received 20 September 2013; accepted 23 December This study was supported by European Union from the resources of the European Regional Development Fund under the Innovative Economy Programme (grant coordinated by JCET-UJ, No POIG /09), National Science Centre of Poland (2011/01/B/NZ4/03719), and Foundation for Polish Science (TEAM/2011-8/7). Address correspondence to Ryszard T. Smolenski, Department of Biochemistry, Medical University of Gdansk, Debinki 1, Gdansk, Poland. rt.smolenski@gumed.edu.pl 323

4 324 B. Kutryb-Zajac et al. INTRODUCTION Atherosclerosis leading to cardiovascular diseases is a main cause of mortality worldwide. [1] The development of this process is characterized by a long asymptomatic phase with the critical role of local inflammation and thrombotic mechanisms in a vessel wall. [2,3] Extracellular metabolism of nucleotides plays a critical role in regulation of these mechanisms. [4] Ecto-nucleoside triphopsphate diphosphohydrolase (entpd) and ecto-5 - nucleotidase (e5nt) modulates concentrations of molecules involved in purinergic signaling: ATP, ADP, and adenosine. Besides these activities, extracellular adenosine deaminase (eada) could further modify concentration of adenosine by its conversion to inosine. [5] Enzymes responsible for extracellular nucleotide catabolism could be present in the vessel wall predominantly endothelium or on the surface of the other cells present in blood erythrocytes and in particular cells of the immune system. Besides cellular enzymes, blood plasma activities can also contribute to nucleotide metabolism. [6,7] Clarification of these complex relations is therefore interesting and important, particularly in pathological conditions such as atherosclerosis. The purpose of this study was to compare rates of conversion of ATP, AMP, and adenosine in the vessel of normal and mice with atherosclerosis (ApoE/LDLr / ). MATERIALS AND METHODS Double-knockout mice for apolipoprotein E (ApoE) and low-density lipoprotein receptor (LDLr) on the C57BL/6J x129/svj background and control wild-type mice of the same strain were maintained on standard laboratory diet. All animal care and experimental procedures complied with the EU guidelines and were approved by the local Bioethical Committee at the Medical University of Gdansk. Five male ApoE/LDLr ( / ) mice and five wild-type mice as a control (20 weeks of age, weighing g) were used. Mice from both groups of the study were anesthetized with a mixture of ketamine (100 mg/kg) and xylazine (10 mg/kg) given intraperitoneally. Abdominal aorta was then collected, cannulated, and ligated by suture just below the middle caudal artery. The perfused fragment included aortoiliac bifurcation from the middle caudal artery to ramification of the iliac arteries. Perfusion was carried out using a peristaltic pomp with Hanks Balanced Salt Solution (HBSS). The flow rate was 0.4 ml/min and the whole system was maintained at 37 C. After a 5-minute equilibration period, the substrates were added in sequence: adenosine, ATP, and AMP at 50 μm concentration. An inhibitor of adenosine deaminase-erythro-9-(2-hydroxy-3-nonyl)adenine (EHNA) was present at 5 μm concentration during perfusion with ATP and AMP to block conversion of adenosine to inosine. Samples of perfusion

5 Extracellular Nucleotide Catabolism 325 FIGURE 1 Concentration of entpd reactants at the inflow and outflow during perfusion of the aortoiliac bifurcation of wild-type mice (A) and ApoE/LDLr / - mice (B). Results shown as mean ± SEM, n = 5. medium both at inflow to the vessel and at outflow with each substrate were collected during each 1-minute perfusion. Concentrations of ATP, ADP, AMP, adenosine, inosine, hypoxanthine, xanthine, and urid acid were measured by HPLC according to the method described earlier. [8] Results are reported as the mean ± SEM. Comparison of the means was done by Student s t-test. p < 0.05 was considered significant. RESULTS Data presented on Figures 1 3 show the change in the concentrations of nucleotide metabolites during the passage of perfusion solution through the vessel. We did not observe significant differences during the infusion of ATP or AMP suggesting that activities of entpd and e5nt in ApoE/LDLr ( / ) versus wild-type mice do not differ (Figures 1 and 2). Nevertheless, some trends that suggest an increased conversion rate of ADP to AMP and AMP to adenosine in ApoE/LDLr ( / ) mice have been noted. Its full clarification needs more observation in studied age group or analysis in different age groups. Interestingly, concentration of inosine in the outflow perfusate of ApoE/LDLr ( / ) mice was six times higher than in wild type while adenosine was completely removed in ApoE/LDLr ( / ) and retained in wild-type mice (Figure 3). This suggests substantial elevation of eada activity in ApoE/LDLr ( / ) mice. DISCUSSION This work demonstrated that intravascular degradation of adenosine in atherosclerotic mice is substantially accelerated as indicated by much higher

6 326 B. Kutryb-Zajac et al. FIGURE 2 Concentration of e5nt reactants at the inflow and outflow during perfusion of the aortoiliac bifurcation of wild-type mice (A) and ApoE/LDLr / - mice (B). Results shown as mean ± SEM, n = 5. concentration of inosine in the perfusate than in wild-type mice. Extracellular adenosine acting via P1 receptors, is considered as an important antiatherosclerotic molecule through preventing thrombosis, foam cells transformation and blood pressure elevation. [9 11] The ApoE/LDLr ( / ) mice model, which we used, is commonly accepted in atherosclerosis research and has been well characterized. [12 15] Changes in the vessel wall of these mice develops gradually, but at 4 5 FIGURE 3 Concentration of eada reactants at the inflow and outflow during perfusion of the aortoiliac bifurcation of wild-type mice (A) and ApoE/LDLr / - mice (B). Results shown as mean ± SEM, p < 0.05, p < vs. wild type, n = 5.

7 Extracellular Nucleotide Catabolism 327 months there is a particular breakthrough in the progression of inflammation, inflammatory cells infiltration in the area of atherosclerotic plaque, and the activity of matrix metalloproteinases. [16,17] The point at which the abdominal aorta bifurcates into the common iliac arteries, known as the aortoiliac bifurcation, is particularly vulnerable for atherosclerosis development through the interaction between hemodynamic forces, blood pressure and the local flow patterns. [18 20] Disrupted barrier function of the endothelium modulated by wall shear stress are involved in the infiltration and accumulation of atherogenic lipids within the arterial wall. [21] Our results indicated an increased activity of an adenosine-degrading enzyme in the atherosclerotic vessel wall. The enzyme responsible for this effect: ecto-adenosine deaminase is highly expressed on the immune cells surface and has a pivotal role in the regulation and enhancement of the inflammatory response. [22,23] An elevated activity of eada in the ApoE/LDLr ( / ) mice vessel wall may result from the infiltration by lymphocytes and/or macrophages, in which early atherosclerotic plaque is abundant. Consequently, intensification of inflammation and, hence, progression of atherosclerosis can occur due to reduced level of extracellular adenosine. The measurement of adenosine concentration in human blood is difficult due to its short half-life (<1 s) and data on its concentration in patients with atherosclerosis is limited. Besides quick metabolism of adenosine, local differences at cellular level can further complicate the interpretation of direct measurements of adenosine in blood. [24] It can be, however, stated with certainty that high expression of eada at the cell surface will lead to reduction of adenosine receptor activation. Clinical studies in patients with atherosclerosis demonstrated elevated activity of serum adenosine deaminase in patients with unstable angina. [25] This observation, which is consistent with our data, may indicate that an increase in adenosine degrading enzyme activity in the atherosclerotic vessel may be of clinical importance, but its full elucidation requires further studies. REFERENCES 1. Minino, A.M.; Murphy, S.L.; Xu, J.; Kochanek, K.D. Deaths: final data for Natl. Vital. Stat. Rep. 2011, 59, Pastrana, J.L.; Sha, X.; Virtue, A.; Mai, J.; Cueto, R.; Lee, I.A.; Wang, H.; Yang, X.F. Regulatory T cells and atherosclerosis. J. Clin. Exp. Cardiol. 2012, S12, Herbin, O.; Ait-Oufella, H.; Yu, W.; Fredrikson, G.N.; Aubier, B.; Perez, N.; Barateau, V.; Nilsson, J.; Tedgui, A.; Mallat, Z. Regulatory T-cell response to apolipoprotein B100-derived peptides reduces the development and progression of atherosclerosis in mice. Arterioscler Thromb. Vasc. Biol. 2012, 32, Hasko, G.; Cronstein, B.N. Adenosine: an endogenous regulator of innate immunity. Trends Immunol. 2004, 25,

8 328 B. Kutryb-Zajac et al. 5. Dong, R.P.; Kameoka, J.; Hegen, M.; Tanaka, T.; Xu, Y.; Schlossman, S. F.; Morimoto, C. Characterization of adenosine deaminase binding to human CD26 on T cells and its biologic role in immune response. J. Immunol. 1996, 156, Robson, S.C.; Sevigny, J.; Zimmermann, H. The E-NTPDase family of ectonucleotidases: structure function relationships and pathophysiological significance. Purinergic Signal 2006, 2, Salmi, M.; Jalkanen, S. Cell-surface enzymes in control of leukocyte trafficking. Nat. Rev. Immunol. 2005, 5, Smolenski, R.T.; Lachno, D.R.; Ledingham, S. J.M.; Yacoub, M.H. Determination of 16 nucleotides, nucleosides and bases using high-performance liquid-chromatography and its application to the study of purine metabolism in hearts for transplantation. J. Chromatogr. Biomed. Appl. 1990, 527, Koupenova, M.; Johnston-Cox, H.; Ravid, K. Regulation of atherosclerosis and associated risk factors by adenosine and adenosine receptors. Curr. Atheroscler. Rep. 2012, 14, Hasko, G.; Pacher, P. Regulation of macrophage function by adenosine. Arterioscler Thromb. Vasc. Biol. 2012, 32, Reiss, A.B.; Cronstein, B.N. Regulation of foam cells by adenosine. Arterioscler Thromb. Vasc. Biol. 2012, 32, Kostogrys, R.B.; Franczyk-Zarow, M.; Maslak, E.; Gajda, M.; Mateuszuk, L.; Jackson, C.L.; Chlopicki, S. Low carbohydrate, high protein diet promotes atherosclerosis in apolipoprotein E/low-density lipoprotein receptor double knockout mice (apoe/ldlr-/-). Atherosclerosis 2012, 223, Gajda, M.; Banas, K.; Banas, A.; Jawien, J.; Mateuszuk, L.; Chlopicki, S.; Kwiatek, W.M.; Cichockil, T.; Falkenberg, G. Distribution of selected elements in atherosclerotic plaques of apoe/ldlr-double knockout mice assessed by synchrotron radiation-induced micro-xrf spectrometry. X-Ray Spectrom. 2008, 37, Csanyi, G.; Gajda, M.; Franczyk-Zarow, M.; Kostogrys, R.; Gwozdz, P.; Mateuszuk, L.; Sternak, M.; Wojcik, L.; Zalewska, T.; Walski, M.; Chlopicki, S. Functional alterations in endothelial NO, PGI(2) and EDHF pathways in aorta in ApoE/LDLR-/- mice. Prostaglandins Other Lipid Mediat. 2012, 98, Jawien, J.; Gajda, M.; Rudling, M.; Mateuszuk, L.; Olszanecki, R.; Guzik, T. J.; Cichocki, T.; Chlopicki, S.; Korbut, R. Inhibition of five lipoxygenase activating protein (FLAP) by MK-886 decreases atherosclerosis in apoe/ldlr-double knockout mice. Eur. J. Clin. Invest. 2006, 36, Mateuszuk, L.; Khomich, T.I.; Slominska, E.; Gajda, M.; Wojcik, L.; Lomnicka, M.; Gwozdz, P.; Chlopicki, S. Activation of nicotinamide N-methyltrasferase and increased formation of 1- methylnicotinamide (MNA) in atherosclerosis. Pharmacol. Rep. 2009, 61, Gajda, M.; Jawien, J.; Mateuszuk, L.; Lis, G.J.; Radziszewski, A.; Chopicki, S.; Litwin, J.A. Triple immunofluorescence labeling of atherosclerotic plaque components in apoe/ldlr-/- mice. Folia Histochemica Et Cytobiologica 2008, 46, Bassiouny, H.S.; Zarins, C.K.; Kadowaki, M.H.; Glagov, S. Hemodynamic stress and experimental aortoiliac atherosclerosis. J. Vasc. Surg. 1994, 19, Tse, J.; Martin-McNaulty, B.; Halks-Miller, M.; Kauser, K.; DelVecchio, V.; Vergona, R.; Sullivan, M.E.; Rubanyi, G.M. Accelerated atherosclerosis and premature calcified cartilaginous metaplasia in the aorta of diabetic male Apo E knockout mice can be prevented by chronic treatment with 17 beta-estradiol. Atherosclerosis 1999, 144, Nakashima, Y.; Plump, A.S.; Raines, E.W.; Breslow, J.L.; Ross, R. ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree. Arterioscler Thromb. 1994, 14, Ding, Z.; Fan, Y.; Deng, X.; Sun, A.; Kang, H. 3,3 -Dioctadecylindocarbocyanine-low-density lipoprotein uptake and flow patterns. Exp. Biol. Med. (Maywood). 2010, 235, Lluis, C.; Franco, R.; Cordero, O. Ecto-ADA in the development of the immune system. Immunol. Today. England 1998, Souza Vdo, C.; Schlemmer, K.B.; Noal, C.B.; Jaques, J.A.; Zimmermann, C.E.; Leal, C.A.; Fleck, J.; Casali. E.A.; Morsch, V.M.; Schetinger, M.R.; Leal, D.B. E-NTPDase and E-ADA activities are altered in lymphocytes of patients with indeterminate form of Chagas disease. Parasitol. Int. 2012, 61, Yegutkin, G.G.; Mikhailov, A.; Samburski, S.S.; Jalkanen, S. The detection of micromolar pericellular ATP pool on lymphocyte surface by using lymphoid ecto-adenylate kinase as intrinsic ATP sensor. Mol. Biol. Cell 2006, 17, Rani, S.H.; Rao, D.V.; Prakash, S.M.; Jyothy, A. Serum adenosine deaminase activity and C-reactive protein levels in unstable angina. India: Indian J. Hum. Genet. 2003,

MODULATION OF AMP DEAMINASE IN RAT HEARTS SUBJECTED TO ISCHEMIA AND REPERFUSION BY PURINE RIBOSIDE

MODULATION OF AMP DEAMINASE IN RAT HEARTS SUBJECTED TO ISCHEMIA AND REPERFUSION BY PURINE RIBOSIDE Nucleosides, Nucleotides, and Nucleic Acids, 27:876 88, 28 Copyright C Taylor & Francis Group, LLC ISSN: 1525-777 print / 1532-2335 online DOI: 1.18/152577782146551 MODULATION OF AMP DEAMINASE IN RAT HEARTS

More information

Back-Calculation of Fish Length from Scales: Empirical Comparison of Proportional Methods

Back-Calculation of Fish Length from Scales: Empirical Comparison of Proportional Methods Animal Ecology Publications Animal Ecology 1996 Back-Calculation of Fish Length from Scales: Empirical Comparison of Proportional Methods Clay L. Pierce National Biological Service, cpierce@iastate.edu

More information

Costanza Scaffidi Abbate a b, Stefano Ruggieri b & Stefano Boca a a University of Palermo

Costanza Scaffidi Abbate a b, Stefano Ruggieri b & Stefano Boca a a University of Palermo This article was downloaded by: [Costanza Scaffidi Abbate] On: 29 July 2013, At: 06:31 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer

More information

Dimitris Pnevmatikos a a University of Western Macedonia, Greece. Published online: 13 Nov 2014.

Dimitris Pnevmatikos a a University of Western Macedonia, Greece. Published online: 13 Nov 2014. This article was downloaded by: [Dimitrios Pnevmatikos] On: 14 November 2014, At: 22:15 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer

More information

To link to this article:

To link to this article: This article was downloaded by: [University of Kiel] On: 24 October 2014, At: 17:27 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer

More information

Anne A. Lawrence M.D. PhD a a Department of Psychology, University of Lethbridge, Lethbridge, Alberta, Canada Published online: 11 Jan 2010.

Anne A. Lawrence M.D. PhD a a Department of Psychology, University of Lethbridge, Lethbridge, Alberta, Canada Published online: 11 Jan 2010. This article was downloaded by: [University of California, San Francisco] On: 05 May 2015, At: 22:37 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered

More information

To link to this article:

To link to this article: This article was downloaded by: [University of Notre Dame] On: 12 February 2015, At: 14:40 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office:

More information

Wild Minds What Animals Really Think : A Museum Exhibit at the New York Hall of Science, December 2011

Wild Minds What Animals Really Think : A Museum Exhibit at the New York Hall of Science, December 2011 This article was downloaded by: [Dr Kenneth Shapiro] On: 09 June 2015, At: 10:40 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer

More information

Lora-Jean Collett a & David Lester a a Department of Psychology, Wellesley College and

Lora-Jean Collett a & David Lester a a Department of Psychology, Wellesley College and This article was downloaded by: [122.34.214.87] On: 10 February 2013, At: 16:46 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,

More information

NANCY FUGATE WOODS a a University of Washington

NANCY FUGATE WOODS a a University of Washington This article was downloaded by: [ ] On: 30 June 2011, At: 09:44 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer

More information

Richard Lakeman a a School of Health & Human Sciences, Southern Cross University, Lismore, Australia. Published online: 02 Sep 2013.

Richard Lakeman a a School of Health & Human Sciences, Southern Cross University, Lismore, Australia. Published online: 02 Sep 2013. This article was downloaded by: [UQ Library] On: 09 September 2013, At: 21:23 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,

More information

Published online: 17 Feb 2011.

Published online: 17 Feb 2011. This article was downloaded by: [Iowa State University] On: 23 April 2015, At: 08:45 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer

More information

Cognitive Enhancement Using 19-Electrode Z-Score Neurofeedback

Cognitive Enhancement Using 19-Electrode Z-Score Neurofeedback This article was downloaded by: [Lucas Koberda] On: 22 August 2012, At: 09:31 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,

More information

Laura N. Young a & Sara Cordes a a Department of Psychology, Boston College, Chestnut

Laura N. Young a & Sara Cordes a a Department of Psychology, Boston College, Chestnut This article was downloaded by: [Boston College] On: 08 November 2012, At: 09:04 Publisher: Psychology Press Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer

More information

PLEASE SCROLL DOWN FOR ARTICLE

PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by:[university of Virginia] On: 26 November 2007 Access Details: [subscription number 785020474] Publisher: Informa Healthcare Informa Ltd Registered in England and Wales Registered

More information

PLEASE SCROLL DOWN FOR ARTICLE. Full terms and conditions of use:

PLEASE SCROLL DOWN FOR ARTICLE. Full terms and conditions of use: This article was downloaded by: [Chiara, Andrea Di] On: 30 December 2010 Access details: Access Details: [subscription number 931692396] Publisher Routledge Informa Ltd Registered in England and Wales

More information

Key Knowledge Generation Publication details, including instructions for author and Subscription information:

Key Knowledge Generation Publication details, including instructions for author and Subscription information: This article was downloaded by: Publisher: KKG Publications Registered office: 18, Jalan Kenanga SD 9/7 Bandar Sri Damansara, 52200 Malaysia Key Knowledge Generation Publication details, including instructions

More information

Advanced Projects R&D, New Zealand b Department of Psychology, University of Auckland, Online publication date: 30 March 2011

Advanced Projects R&D, New Zealand b Department of Psychology, University of Auckland, Online publication date: 30 March 2011 This article was downloaded by: [University of Canterbury Library] On: 4 April 2011 Access details: Access Details: [subscription number 917001820] Publisher Psychology Press Informa Ltd Registered in

More information

The Flynn effect and memory function Sallie Baxendale ab a

The Flynn effect and memory function Sallie Baxendale ab a This article was downloaded by: [University of Minnesota] On: 16 August 2010 Access details: Access Details: [subscription number 917397643] Publisher Psychology Press Informa Ltd Registered in England

More information

Marie Stievenart a, Marta Casonato b, Ana Muntean c & Rens van de Schoot d e a Psychological Sciences Research Institute, Universite

Marie Stievenart a, Marta Casonato b, Ana Muntean c & Rens van de Schoot d e a Psychological Sciences Research Institute, Universite This article was downloaded by: [UCL Service Central des Bibliothèques], [Marie Stievenart] On: 19 June 2012, At: 06:10 Publisher: Psychology Press Informa Ltd Registered in England and Wales Registered

More information

Clinical Biochemistry department/ College of medicine / AL-Mustansiriyah University

Clinical Biochemistry department/ College of medicine / AL-Mustansiriyah University Clinical Biochemistry department/ College of medicine / AL-Mustansiriyah University Dr. Ali al-bayati NUCLEOTIDE METABOLISM Lec. 3 The salvage pathway of purine synthesis Purines that result from the normal

More information

Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD

Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD Our laboratory focuses on the role of apolipoprotein (apo) B- containing lipoproteins in normal

More information

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution

More information

Les McFarling a, Michael D'Angelo a, Marsha Drain a, Deborah A. Gibbs b & Kristine L. Rae Olmsted b a U.S. Army Center for Substance Abuse Programs,

Les McFarling a, Michael D'Angelo a, Marsha Drain a, Deborah A. Gibbs b & Kristine L. Rae Olmsted b a U.S. Army Center for Substance Abuse Programs, This article was downloaded by: [Florida State University] On: 10 November 2011, At: 13:53 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office:

More information

Effect of insulin and glucose on adenosine metabolizing enzymes in human B lymphocytes

Effect of insulin and glucose on adenosine metabolizing enzymes in human B lymphocytes Vol. 56 No. 3/29, 439 446 Regular paper on-line at: www.actabp.pl Effect of insulin and glucose on adenosine metabolizing enzymes in human B lymphocytes Katarzyna Kocbuch 1, Monika Sakowicz-Burkiewicz

More information

A Project to Clone Companion Animals Mark Greene Published online: 04 Jun 2010.

A Project to Clone Companion Animals Mark Greene Published online: 04 Jun 2010. This article was downloaded by: [Dr Kenneth Shapiro] On: 08 June 2015, At: 09:28 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer

More information

PLEASE SCROLL DOWN FOR ARTICLE. Full terms and conditions of use:

PLEASE SCROLL DOWN FOR ARTICLE. Full terms and conditions of use: This article was downloaded by: [University of Cardiff] On: 3 March 2010 Access details: Access Details: [subscription number 906511392] Publisher Routledge Informa Ltd Registered in England and Wales

More information

PLEASE SCROLL DOWN FOR ARTICLE

PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by:[heal- Link Consortium] On: 21 November 2007 Access Details: [subscription number 772810500] Publisher: Informa Healthcare Informa Ltd Registered in England and Wales Registered

More information

Dyslipidemia Endothelial dysfunction Free radicals Immunologic

Dyslipidemia Endothelial dysfunction Free radicals Immunologic ATHEROSCLEROSIS Hossein Mehrani Professor of Clinical Biochemistry Definition Atherosclerosis: Is a chronic inflammatory process characterized by plaque formation within the vessel wall of arteries and

More information

American Journal of Human Genetics. American Journal of Hypertension. American Journal of Neuroradiology

American Journal of Human Genetics. American Journal of Hypertension. American Journal of Neuroradiology A) Acta Neurochir AJNR Am J Neuroradiol Am Coll Rheumatol Am J Cardiol Am J Hum Genet Am J Hypertens Am J Neuroradiol AJNR Am J Physiol Am J Physiol Gastrointest Liver Physiol Am J Physiol Heart Circ physiol

More information

Immune Cells in Atherosclerosis Regulatory vs Inflammatory T cells Göran K Hansson

Immune Cells in Atherosclerosis Regulatory vs Inflammatory T cells Göran K Hansson Immune Cells in Atherosclerosis Regulatory vs Inflammatory T cells Göran K Hansson Center for Molecular Medicine Karolinska Institute Stockholm, Sweden DECLARATION OF CONFLICT OF INTEREST Goran Hansson

More information

PLEASE SCROLL DOWN FOR ARTICLE

PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by:[university of Virginia] On: 26 November 2007 Access Details: [subscription number 785020474] Publisher: Informa Healthcare Informa Ltd Registered in England and Wales Registered

More information

Version of record first published: 25 Apr 2012.

Version of record first published: 25 Apr 2012. This article was downloaded by: [Dr William T. Tsushima] On: 23 October 2012, At: 13:21 Publisher: Psychology Press Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office:

More information

Prevalence of Coronary Artery Disease: A Tertiary Care Hospital Based Autopsy Study

Prevalence of Coronary Artery Disease: A Tertiary Care Hospital Based Autopsy Study Article History Received: 03 Feb 2016 Revised: 05 Feb 2016 Accepted: 08 Feb 2016 *Correspondence to: Dr. Alpana Jain Senior demonstrator SMS Medical College, Jaipur, Rajasthan, INDIA. dr.alpana.jain@gmail.com

More information

Life Events, Social Support, and Depression Among Taiwanese Female Homemakers

Life Events, Social Support, and Depression Among Taiwanese Female Homemakers This article was downloaded by: [National Taiwan University] On: 17 November 2014, At: 18:56 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office:

More information

EHPS 2012 abstracts. To cite this article: (2012): EHPS 2012 abstracts, Psychology & Health, 27:sup1, 1-357

EHPS 2012 abstracts. To cite this article: (2012): EHPS 2012 abstracts, Psychology & Health, 27:sup1, 1-357 This article was downloaded by: [158.197.72.142] On: 30 August 2012, At: 04:44 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,

More information

Texas A&M University, College Station, TX, USA b University of Missouri, Columbia, MO, USA

Texas A&M University, College Station, TX, USA b University of Missouri, Columbia, MO, USA This article was downloaded by: [Hicks, Joshua A.][Texas A&M University] On: 11 August 2010 Access details: Access Details: [subscription number 915031380] Publisher Psychology Press Informa Ltd Registered

More information

Adenosine deaminase severe combined immunodeficiency (ADA-SCID)

Adenosine deaminase severe combined immunodeficiency (ADA-SCID) Adenosine deaminase severe combined immunodeficiency (ADA-SCID) Christopher A. Haynes, PhD Service Fellow, CDC National Conversation: Tandem Mass Spectrometry in Newborn Screening February 5-6, 2015 National

More information

Studies on Components of Blood and its Functions

Studies on Components of Blood and its Functions Chapter 3 Inflammation and Platelet Aggregation: The Role of Blood Extracellular Purines and Adenosine Andréia Machado Cardoso*; Leandro Henrique Manfredi Federal University of Fronteira Sul, Campus Chapecó,

More information

Prostaglandins and Other Lipid Mediators

Prostaglandins and Other Lipid Mediators Prostaglandins & other Lipid Mediators 98 (2012) 107 115 Contents lists available at SciVerse ScienceDirect Prostaglandins and Other Lipid Mediators Functional alterations in endothelial NO, PGI 2 and

More information

Moneyball: The Art of Winning the American Dental Association Membership Renewal Game

Moneyball: The Art of Winning the American Dental Association Membership Renewal Game This article was downloaded by: [97.73.50.115] On: 19 June 2014, At: 03:22 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,

More information

The aorta is an integral part of the cardiovascular system and should not be considered as just a conduit for blood supply from the heart to the

The aorta is an integral part of the cardiovascular system and should not be considered as just a conduit for blood supply from the heart to the The aorta is an integral part of the cardiovascular system and should not be considered as just a conduit for blood supply from the heart to the limbs and major organs. A range of important pathologies

More information

KEY COMPONENTS. Metabolic Risk Cardiovascular Risk Vascular Inflammation Markers

KEY COMPONENTS. Metabolic Risk Cardiovascular Risk Vascular Inflammation Markers CardioMetabolic Risk Poor blood sugar regulation and unhealthy triglyceride and lipoprotein levels often present long before the diagnosis of type 2 Diabetes. SpectraCell s CardioMetabolic and Pre-Diabetes

More information

Cardiovascular Division, Brigham and Women s Hospital, Harvard Medical School

Cardiovascular Division, Brigham and Women s Hospital, Harvard Medical School Low Endothelial Shear Stress Upregulates Atherogenic and Inflammatory Genes Extremely Early in the Natural History of Coronary Artery Disease in Diabetic Hyperlipidemic Juvenile Swine Michail I. Papafaklis,

More information

CIC Edizioni Internazionali. Cardio-metabolic comorbidities in rheumatoid arthritis and SLE. Review. 120 Clinical Dermatology 2013; 1 (2):

CIC Edizioni Internazionali. Cardio-metabolic comorbidities in rheumatoid arthritis and SLE. Review. 120 Clinical Dermatology 2013; 1 (2): Review Cardio-metabolic comorbidities in rheumatoid arthritis and SLE Andrea Doria Division of Rheumatology University of Padua, Italy Address for correspondence: Division of Rheumatology University of

More information

Metabolism and Atherogenic Properties of LDL

Metabolism and Atherogenic Properties of LDL Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal

More information

EILEEN K. McMILLEN a, HERBERT W. HELM JR. a & DUANE C. McBRIDE a a Department of Behavioral Sciences, Andrews

EILEEN K. McMILLEN a, HERBERT W. HELM JR. a & DUANE C. McBRIDE a a Department of Behavioral Sciences, Andrews This article was downloaded by: [Andrews University] On: 11 July 2013, At: 07:04 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer

More information

The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema

The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema Dept Cardiology, Leiden University Medical Center, Leiden,

More information

Identification & Confirmation of Structurally Related Degradation Products of Simvastatin

Identification & Confirmation of Structurally Related Degradation Products of Simvastatin Identification & Confirmation of Structurally Related Degradation Products of Simvastatin Power of QTRAP Systems for Identification and Confirmation of Degradation Products Dilip Reddy 1, Chandra Sekar

More information

ImmunoTools special Award 2014

ImmunoTools special Award 2014 ImmunoTools special Award 2014 Davide Ferrari, PhD University of Ferrara, Department of Morphology, Surgery and Experimental Medicine. Section of Pathology, Oncology and Exper. Biology via L. Borsari 46,

More information

Online publication date: 08 June 2010

Online publication date: 08 June 2010 This article was downloaded by: [Vrije Universiteit, Library] On: 1 June 2011 Access details: Access Details: [subscription number 907218003] Publisher Routledge Informa Ltd Registered in England and Wales

More information

Oleuropein and Related Compounds Reduce Atherosclerosis

Oleuropein and Related Compounds Reduce Atherosclerosis The Open Conference Proceedings Journal, 2010, 1, 81-86 81 Oleuropein and Related Compounds Reduce Atherosclerosis Open Access Paul L. Huang*, Philip L. Huang and Sylvia Lee-Huang Cardiology Division,

More information

LIPOPROTEIN-ASSOCIATED PHOSPHOLIPASE A 2 : EFFECTS OF LOW DENSITY LIPOPROTEIN APHERESIS

LIPOPROTEIN-ASSOCIATED PHOSPHOLIPASE A 2 : EFFECTS OF LOW DENSITY LIPOPROTEIN APHERESIS LIPOPROTEIN-ASSOCIATED PHOSPHOLIPASE A 2 : EFFECTS OF LOW DENSITY LIPOPROTEIN APHERESIS Patrick M. Moriarty, M.D., FACP, Director, Atherosclerosis and LDL-Apheresis Center, University of Kansas Medical

More information

Andrea W. Clay a b, Mollie A. Bloomsmith a b, M. Jackson Marr b & Terry L. Maple b a Yerkes National Primate Research Center, Emory

Andrea W. Clay a b, Mollie A. Bloomsmith a b, M. Jackson Marr b & Terry L. Maple b a Yerkes National Primate Research Center, Emory This article was downloaded by: [Dr Kenneth Shapiro] On: 09 June 2015, At: 08:19 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): Bempedoic acid (ETC-1002) is an ATP-citrate lyase (ACL) inhibitor that in clinical studies has been shown to decrease plasma LDL cholesterol apparently

More information

Published online: 14 Dec 2007.

Published online: 14 Dec 2007. This article was downloaded by: [University of Cambridge] On: 09 October 2014, At: 08:25 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer

More information

Tracking a Killer Molecule

Tracking a Killer Molecule Tracking a Killer Molecule Mercodia Oxidized LDL ELISA www.mercodia.com Mercodia Oxidized LDL ELISA products Product Catalog No Kit size Oxidized LDL ELISA 10-1143-01 96 wells Oxidized LDL competitive

More information

MDSC 1102/VM1102 Cardiovascular and Renal. Purine nucleotide metabolism

MDSC 1102/VM1102 Cardiovascular and Renal. Purine nucleotide metabolism MDSC 1102/VM1102 Cardiovascular and Renal Purine nucleotide metabolism Dr. J. Foster Biochemistry Unit, Dept. Preclinical Sciences Faculty of Medical Sciences, U.W.I. Learning Objectives Discuss purineand

More information

REAGENTS. RANDOX sdldl CHOLESTEROL (sdldl-c) SIZE MATTERS: THE TRUE WEIGHT OF RISK IN LIPID PROFILING

REAGENTS. RANDOX sdldl CHOLESTEROL (sdldl-c) SIZE MATTERS: THE TRUE WEIGHT OF RISK IN LIPID PROFILING REAGENTS RANDOX sdldl CHOLESTEROL (sdldl-c) SIZE MATTERS: THE TRUE WEIGHT OF RISK IN LIPID PROFILING Randox sdldl Cholesterol (sdldl-c) Size Matters: The True Wight of Risk in Lipid Profiling 1. BACKGROUND

More information

Summary and concluding remarks

Summary and concluding remarks Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated

More information

9SA, UK Published online: 04 Jan 2008.

9SA, UK Published online: 04 Jan 2008. This article was downloaded by: [European Association of Psychology and Law] On: 11 December 2014, At: 12:40 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954

More information

PLEASE SCROLL DOWN FOR ARTICLE

PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: On: 21 September 2009 Access details: Access Details: Free Access Publisher Informa Healthcare Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered

More information

Curriculum Vitae. Research Officer in Baker IDI Heart & Diabetes Institute from Aug

Curriculum Vitae. Research Officer in Baker IDI Heart & Diabetes Institute from Aug Curriculum Vitae Yi Fu ( 付毅 ) (PhD, MBBS) Baker IDI Heart and Diabetes Institute 75 Commercial Road, Prahran, Melbourne, VIC 3004 Australia Phone: +61 3 8532 1288 Email: yi.fu@bakeridi.edu.au PROFILE Research

More information

Arteriosclerosis & Atherosclerosis

Arteriosclerosis & Atherosclerosis Arteriosclerosis & Atherosclerosis Arteriosclerosis = hardening of arteries = arterial wall thickening + loss of elasticity 3 types: -Arteriolosclerosis -Monckeberg medial sclerosis -Atherosclerosis Arteriosclerosis,

More information

La Trombosi Arteriosa

La Trombosi Arteriosa La Trombosi Arteriosa Prof. Giovanni Davì Medicina Interna Chieti Platelet activation and thrombosis Harrison 19 edizione Platelets are essential for primary hemostasis and repair of the endothelium They

More information

Simvastatin friend or foe in abdominal aortic aneurysm

Simvastatin friend or foe in abdominal aortic aneurysm Simvastatin friend or foe in abdominal aortic aneurysm A. Piechota-Polańczyk Department of Medical Biotechnology, Jagiellonian University, Krakow, Poland VISAR, Vienna, April 20-21, 2017 Statins in Abdominal

More information

Loss of ectonucleotidases from the coronary vascular bed after ischemia-reperfusion in isolated rat heart

Loss of ectonucleotidases from the coronary vascular bed after ischemia-reperfusion in isolated rat heart Takahashi-Sato et al. BMC Cardiovascular Disorders 213, 13:53 RESEARCH ARTICLE Open Access Loss of ectonucleotidases from the coronary vascular bed after ischemia-reperfusion in isolated rat heart Kaoru

More information

Invited Review. Vascular smooth muscle cell proliferation in the pathogenesis of atherosclerotic cardiovascular diseases

Invited Review. Vascular smooth muscle cell proliferation in the pathogenesis of atherosclerotic cardiovascular diseases Histol Histopathol (2000) 15: 557-571 Histology and Histopathology Cellular and Molecular Biology Invited Review Vascular smooth muscle cell proliferation in the pathogenesis of atherosclerotic cardiovascular

More information

Dr Muge Cevik. Chelsea and Westminster Hospital, London. 18 th Annual Conference of the British HIV Association (BHIVA)

Dr Muge Cevik. Chelsea and Westminster Hospital, London. 18 th Annual Conference of the British HIV Association (BHIVA) 18 th Annual Conference of the British HIV Association (BHIVA) Dr Muge Cevik Chelsea and Westminster Hospital, London 18-20 April 2012, The International Convention Centre, Birmingham A09 Polymorphisms

More information

BIOCHEMISTRY & MEDICINE:

BIOCHEMISTRY & MEDICINE: BIOCHEMISTRY & MEDICINE: INTRODUCTION Biochemistry can be defined as the science of the chemical basis of life (Gk bios "life"). The cell is the structural unit of living systems. Thus, biochemistry can

More information

Guelph, Guelph, Ontario, Canada c Department of Animal Science, Faculty of Agricultural Science, University of Guilan,

Guelph, Guelph, Ontario, Canada c Department of Animal Science, Faculty of Agricultural Science, University of Guilan, This article was downloaded by: [University of Guelph] On: 01 October 2014, At: 11:40 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office:

More information

LDL Uptake Cell-Based Assay Kit

LDL Uptake Cell-Based Assay Kit LDL Uptake Cell-Based Assay Kit Item No. 10011125 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION

More information

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien

More information

PPAR history of research

PPAR history of research PPAR Rubens, 1640 PPAR history of research number of publications 3000 2000 1000 0 till now: : 16 296 publications 1985 1990 1995 2000 2005 year liver, brown adipocytes, kidney, heart, skeletal muscles,

More information

High density lipoprotein metabolism

High density lipoprotein metabolism High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC

More information

PLEASE SCROLL DOWN FOR ARTICLE

PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by:[anonymous Registration for mpptwo] On: 5 June 2008 Access Details: [subscription number 780368323] Publisher: Informa Healthcare Informa Ltd Registered in England and Wales

More information

renoprotection therapy goals 208, 209

renoprotection therapy goals 208, 209 Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization

More information

Journal of the American College of Cardiology Vol. 50, No. 24, by the American College of Cardiology Foundation ISSN /07/$32.

Journal of the American College of Cardiology Vol. 50, No. 24, by the American College of Cardiology Foundation ISSN /07/$32. Journal of the American College of Cardiology Vol. 50, No. 24, 2007 2007 by the American College of Cardiology Foundation ISSN 0735-1097/07/$32.00 Published by Elsevier Inc. doi:10.1016/j.jacc.2007.07.081

More information

Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry

Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different

More information

PATHOPHYSIOLOGY OF ACUTE CORONARY SYNDROMES

PATHOPHYSIOLOGY OF ACUTE CORONARY SYNDROMES PATHOPHYSIOLOGY OF ACUTE CORONARY SYNDROMES Brian R. Holroyd, MD, FACEP, FRCPC Professor and Director, Division of Emergency Medicine, Faculty of Medicine and Dentistry, University of Alberta, Edmonton,

More information

Detection of carotid plaque neovascularization with Superb Micro-Vascular Imaging

Detection of carotid plaque neovascularization with Superb Micro-Vascular Imaging Detection of carotid plaque neovascularization with Superb Micro-Vascular Imaging Yong Qiang Professor Ultrasonic Department, Beijing An-Zhen Hospital, Capital Medical University, China 1. Background Conventional

More information

Innate Immunity in Atherosclerosis

Innate Immunity in Atherosclerosis Innate Immunity in Atherosclerosis Peter Libby Brigham & Women s Hospital Harvard Medical School IAS Amsterdam May 26, 2015 ACS Stable demand angina Characteristics of Atherosclerotic Plaques Associated

More information

Quantitative Imaging of Transmural Vasa Vasorum Distribution in Aortas of ApoE -/- /LDL -/- Double Knockout Mice using Nano-CT

Quantitative Imaging of Transmural Vasa Vasorum Distribution in Aortas of ApoE -/- /LDL -/- Double Knockout Mice using Nano-CT Quantitative Imaging of Transmural Vasa Vasorum Distribution in Aortas of ApoE -/- /LDL -/- Double Knockout Mice using Nano-CT M. Kampschulte 1, M.D.; A. Brinkmann 1, M.D.; P. Stieger 4, M.D.; D.G. Sedding

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Clinical Policy: Cardiac Biomarker Testing for Acute Myocardial Infarction Reference Number: CP.MP.156

Clinical Policy: Cardiac Biomarker Testing for Acute Myocardial Infarction Reference Number: CP.MP.156 Clinical Policy: Reference Number: CP.MP.156 Effective Date: 12/17 Last Review Date: 12/17 See Important Reminder at the end of this policy for important regulatory and legal information. Description The

More information

Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine

Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine Int J Clin Exp Med 2015;8(9):16374-16378 www.ijcem.com /ISSN:1940-5901/IJCEM0010359 Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine Hongming Zhang

More information

Tomasz J Guzik. Diabetes, perivascular adipose tissue and inflammation.

Tomasz J Guzik. Diabetes, perivascular adipose tissue and inflammation. Tomasz J Guzik Diabetes, perivascular adipose tissue and inflammation. Translational Research Laboratory Department of Internal and Agricutural Medicine Jagiellonian University School of Medicine Cracow,

More information

Mesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future

Mesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future Mesenchymal Stem Cells to Repair Vascular Damage after Chemotherapy: Past, Present and Future Cell Therapy 2014 Las Vegas, NV, USA Sulaiman Al-Hashmi, PhD Sultan Qaboos University Oman What are MSCs? Stem

More information

Testing Lesniaski s Revised Brief Test

Testing Lesniaski s Revised Brief Test Claremont Colleges Scholarship @ Claremont Library Staff Publications and Research Library Publications 1-1-2010 Testing Lesniaski s Revised Brief Test M. Sara Lowe Claremont University Consortium Sean

More information

Medical management of abdominal aortic aneurysms

Medical management of abdominal aortic aneurysms Medical management of abdominal aortic aneurysms Definition of AAA - Generally a 50% increase in native vessel diameter - Diameter 3 cm - Relative measures compared with nondiseased aortic segments less

More information

In the name of GOD. Animal models of cardiovascular diseases: myocardial infarction & hypertension

In the name of GOD. Animal models of cardiovascular diseases: myocardial infarction & hypertension In the name of GOD Animal models of cardiovascular diseases: myocardial infarction & hypertension 44 Presentation outline: Cardiovascular diseases Acute myocardial infarction Animal models for myocardial

More information

Metabolism of Nucleotides

Metabolism of Nucleotides Metabolism of Nucleotides Outline Nucleotide degradation Components of Nucleobases Purine and pyrimidine biosynthesis Hyperuricemia Sources Nucleotide degradation The nucleotides are among the most complex

More information

Available online: 09 Jun 2011

Available online: 09 Jun 2011 This article was downloaded by: [Bill Herring] On: 30 November 2011, At: 19:46 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,

More information

Qualifying Examination (Part I)

Qualifying Examination (Part I) Department of Pharmacology Qualifying Examination (Part I) December 15 & 17, 2009 Examination Committee: 1. Ron Emeson 2. Eugenia Gurevich 3. Tina Iverson 4. Brian Wadzinski Tuesday, December 15 Thursday,

More information

Familial hypercholesterolaemia in children and adolescents

Familial hypercholesterolaemia in children and adolescents Familial hypercholesterolaemia in children and adolescents Rationale and recommendations for early identification and treatment European Atherosclerosis Society Consensus Panel Slide deck adapted from:

More information

Randy A. Sansone a b & Michael W. Wiederman c a Departments of Psychiatry and Internal Medicine, Wright State

Randy A. Sansone a b & Michael W. Wiederman c a Departments of Psychiatry and Internal Medicine, Wright State This article was downloaded by: [174.141.48.34] On: 01 February 2013, At: 08:11 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,

More information

Magalhães, Porto, Portugal

Magalhães, Porto, Portugal This article was downloaded by:[b-on Consortium - 2007] On: 18 February 2008 Access Details: [subscription number 778384761] Publisher: Informa Healthcare Informa Ltd Registered in England and Wales Registered

More information

Pathology of Coronary Artery Disease

Pathology of Coronary Artery Disease Pathology of Coronary Artery Disease Seth J. Kligerman, MD Pathology of Coronary Artery Disease Seth Kligerman, MD Assistant Professor Medical Director of MRI University of Maryland Department of Radiology

More information

Ischemic heart disease

Ischemic heart disease Ischemic heart disease Introduction In > 90% of cases: the cause is: reduced coronary blood flow secondary to: obstructive atherosclerotic vascular disease so most of the time it is called: coronary artery

More information