Curriculum Vitae. Research Officer in Baker IDI Heart & Diabetes Institute from Aug
|
|
- Shona Jenkins
- 5 years ago
- Views:
Transcription
1 Curriculum Vitae Yi Fu ( 付毅 ) (PhD, MBBS) Baker IDI Heart and Diabetes Institute 75 Commercial Road, Prahran, Melbourne, VIC 3004 Australia Phone: yi.fu@bakeridi.edu.au PROFILE Research Officer in Baker IDI Heart & Diabetes Institute from Aug Gender: Male Date of Birth: Feb. 4 th, 1981 Place of Birth: Jiangsu, China EDUCATION Sichuan University (West China Medical School), Chengdu Degree: MBBS (Bachelor of Medicine, Bachelor of Surgery) Peking University (Health Science Center), Beijing Degree: Ph. D in Physiology University of California, Riverside, United States Visiting Graduate Student in Division of Biomedical Science
2 WORK EXPERIENCE Baker IDI Heart and Diabetes Institute, Melbourne, Australia Now Research Officer (Scientist) RESEARCH EXPERIENCE Graduate Stage: Laminar shear stress regulates liver X receptor in vascular endothelial cells. The liver X receptors (LXRs) regulate a set of genes involved in lipid metabolism and reverse cholesterol transport. We investigated the mechanism by which shear stress regulates LXR in vascular endothelial cells (ECs). Western blot showed that the protein level of LXRa and its target ABCA1 in the mouse thoracic aorta was higher than that in the aortic arch. As well, the mrna level of LXR and its target genes ABCA1, ABCG1, ApoE, and LPL in the thoracic aorta was higher. In vitro, bovine aortic ECs were subjected to a steady laminar flow (12 dyne/cm 2 ). The expressions of LXR and the LXR-mediated transcription were increased by laminar shear stress. Laminar flow increased LXR-ligand binding and the gene expression of sterol 27-hydroxylase (CYP27), which suggests an increased level of LXR ligand in ECs. This effect was attenuated by LXRa and CYP27 RNAi. The decrease of LXR in the aorta of PPARg +/- mice and that of C57 mice fed with PPARg antagonist suggest the involvement of PPARg in the LXR induction by flow. Laminar flow increases LXR function via a PPARg-CYP27 dependent mechanism, which reveals an atheroprotective role for laminar flow exerting on endothelium. Translocation of ATP synthase beta chain by laminar versus oscillatory flow. Shear stress plays an important role in endothelial function and can be a major pathogenic factor of atherosclerosis, depending upon flow patterns. ATP synthase β chain (ATPSβ) is the enzymatic center for ATP synthesis. It can locate either in mitochondria or on the cell membrane. It was demonstrated that plasmamembrane ATPSβ could play a role on binding of γ/δ T cells. We previously reported that ATPSβ could be co-localized with caveolin-1 in membrane caveolae and enriched by exposure of cholesterol. In this study, we examined whether shear stress affects cellular distribution of ATPSβ in bovine aortic endothelial cells (ECs) and thus induces the adhesion of γ/δ T cells to ECs. Our results showed that laminar flow caused a decrease in membrane cholesterol in ECs with attendant decreased translocation of ATPSβ on the membrane, which was companioned with caveolin-1 alteration. In contrast, oscillatory flow increased the membrane cholesterol content and the colocalization of ATPSβ and caveolin-1 on the membrane. The incubation of ECs with cholesterol or depletion of cellular cholesterol with β-cyclodextrin (βcd) could mimic the respective effects of oscillatory and laminar flows. The inhibition
3 of caveolin-1 expression by caveolin-1 sirna prevented the translocation of ATPSβ in ECs responding to shear stress. Importantly, T cells adhesion assay showed that oscillatory flow or cholesterol elevated the number of γ/δ T cells binding to ECs, and this increment could be blocked by anti-atpsβ antibody pretreatment, while laminar flow or βcd decreased this attachment significantly. Thus, a novel mechanism of endothelial activation was proposed that cholesterol or oscillatory shear stress promote γ/δ T cells adhesion on ECs through the membrane translocation of ATPSβ. Proteome research of endothelial lipid rafts Lipid rafts are cholesterol-enriched microdomains in cell membrane, and they play an important role in maintaining endothelial function. Shear stress is a key pathogen factor of atherosclerosis, and statins are HMG-CoA reductase inhibitor and regulate cholesterol level. I applied itraq method for comparative endothelial lipid rafts proteome under these conditions (laminar flow, oscillatory flow and atorvastatin). We found that atorvastatin mainly increased anti-oxidative proteins and proteins that could enhance cell barriment; it decreased proteins that are associated mitochondrial function and white blood cells adhesion in endothelial lipid rafts. Therefore, we concluded that statins played their endothelium-protective function partly through regulating the protein translocation in lipid rafts. We have still been analyzing the proteome result for shear stress. Postdoctoral Stage: The role of caveolin-1 in monocyte differentiation into macrophage Monocyte to macrophage differentiation is an essential step in atherogenesis. The structure protein of caveolae, caveolin-1, is involved in protein translocation and integrin signalling. Primary monocytes demonstrate an increase in caveolin-1 expression following adhesion to endothelium. We explore the hypothesis that caveolin-1 plays a role in monocyte differentiation to macrophage. We confirm that PMA treatment of THP-1 cells induces expression of inflammatory genes and macrophage cell surface markers and show that caveolin-1 expression increases in these treated cells. These findings were validated in human and mouse primary monocytes. As well, expression of macrophage markers and inflammatory genes increased following transfection of pegf-caveolin-1 plasmid, while caveolin-1 knockdown by sirna reduced the PMA-induced expression of these differentiation markers. Moreover, the nuclear location of the early growth responsor 1 (EGR-1) transcription factor, increased by PMA treatment, was blocked by knocking down caveolin-1. ChIP assay results further showed that caveolin-1 knock-down inhibited the binding of EGR-1 to its target DNA fragments (CSF1R and TNFα) induced by monocyte differentiation thus decreasing EGR-1 transcriptional activity. Finally, caveolin-1 transfection altered the transmigration ability of THP-1 (monocyte) cells to one closer to that observed in PMA treated THP-1 (macrophage) cells. We conclude that caveolin- 1 promotes monocyte to macrophage differentiation through regulation of EGR-1 transcriptional activity and suggest that monocytic caveolin-1 is a potential
4 therapeutic target for atherosclerosis. The gene profiling on HDL-regulated monocyte inflammation HDL is considered as good cholesterol through its atheroprotective effects. However, the role of HDL on monocyte inflammation is still not clear. Here, microarrays were applied to compare HDL effects on static and LPS-induced THP-1 monocytes. Through gene screening, metallothioniens (MTs) were selected as a target gene family up-regulated by HDL. We hypothesized that HDL inhibited LPS-induced inflammation on monocytes through MTs. We planned to increase or decrease MTs expression in monocytes through transfection of MTs expression plasmid and sirna respectively, then to explore the alteration of HDL effects on LPS-induced inflammation on monocytes. The role of HDL on macrophage polarization Monocytes differentiate into macrophages following transmigration into tissue. Under physiological conditions, the monocyte-derived macrophage is of the M2 type playing a normal protective role in the organism. When pathological factors (including inflammation) are present, the differentiated macrophage possesses features which damage tissue, and this type of macrophage is normally termed M1. M1 macrophages play an important role in cardiovascular disease. For example, M1 macrophages turn into foam cells through the uptake of ox-ldl in atherosclerosis, forming pathological lipid lesions on the vessel wall. Circulating cholesterol levels in blood is related to cardiovascular disease. Lipoprotein is one of the major vectors for circulating cholesterol. Low density lipoprotein (LDL) is commonly known as bad cholesterol as a result of its promotion of cardiovascular disease, while high density lipoprotein (HDL) is referred to as good cholesterol due to its protective effect on the cardiovascular system. HDL promotes cardioprotection through the inhibition of inflammation and oxdative stress and the mediation of cholesterol efflux thus decreasing cholesterol levels. Our previous research work demonstrated that HDL can inhibit monocytic activation and inflammation, but the role of HDL on macrophage is still not clear. This project aims to explore the potential effects of HDL on macrophage polarization. We will isolate monocytes from human blood, differentiate them into macrophages, and induce the macrophages into M1 or M2 states respectively. We will then study the influence of HDL on the induction of M1 or M2 macrophages and HDL-induced alteration of macrophage polarization. TECHNOLOGY EXPERIENCE Cell biology Primary cells isolation and culture (HUVECs, MAECs, blood leukocytes, monocytes, γ/δ T lymphocytes) FACS (flow cytometry)
5 Immunofluorescence Flow chamber for endothelium (Shear stress effect on ECs) Immunology ELISA and Bioplex (ELISA array) Transmigration assay Molecular Biology Immunoblotting and Real-time PCR ChIP assay Lentivirus mir cloning Gene regulation by transfection or infection Experience of involving in high through-put projects (microarray and itraq proteomics) Animal experiments Ex vivo: vessel chamber In vivo: handle atherosclerotic mouse models HONORS AND AWARDS Peking University: Triple A Graduate Students 2008 Research Innovation Award 2008 Australian NHMRC Training Fellowship (65,000 per year, 2 years) Baker IDI Bright Sparks Program Travel Grant 2011
6 CONFERENCES st International Symposium on Lipid and Tissue Injury, Chongqing, China (Poster Presenter) th Annual Symposium Bioengineering Institute of California, Riverside, CA, US (Poster Presenter) th European Meeting of Vascular Biology and Medicine, Krakow, Poland (Poster Presenter) PUBLICATIONS 1. Fu Y, Moore XL, Sivordoc D, Chin-Dusting J (Current) Caveolin-1 Plays a Critical Role in the Differentiation of Monocytes into Macrophages. Arterio Thromb Vasc Biol. (In Revision) 2. Fu Y, Hou Y, Fu C, Gu M, Li C, Kong W, Wang X, Shyy JY, Zhu Y (2011) A Novel Mechanism of γ/δ T-Lymphocyte and Endothelial Activation by Shear Stress: The Role of Ecto-ATP Synthase β Chain. Circ Res. 108(4): (Cover Image) 3. Fu Y, Zhu Y (2011) Ectopic ATP synthase in endothelial cells: a novel cardiovascular therapeutic target. Curr Pharm Des. 16(37): Thomas MC, Pickering RJ, Tsorotes D, Koitka A, Sheehy K, Bernardi S, Toffoli B, Nguyen-Huu TP, Head GA, Fu Y, Chin-Dusting J, Cooper ME, Tikellis C (2010) Genetic Ace2 deficiency accentuates vascular inflammation and atherosclerosis in the ApoE knockout mouse. Circ Res. 107(7): Chen Z, Peng IC, Sun W, Su MI, Hsu PH, Fu Y, Zhu Y, Defea K, Pan S, Tsai MD, Shyy JY (2009) AMP-Activated Protein Kinase Functionally Phosphorylates Endothelial Nitric Oxide Synthase Ser633. Circ Res. 104(4): Zhu M*, Fu Y*, Wang N, Guan Y, Tang CS, Shyy JY, Zhu Y (2008) Laminar Shear Stress Regulates Liver X Receptor in Vascular Endothelial Cells In vitro and In vivo. Arterio Thromb Vasc Biol. 28: (*contributed equally) 7. Ai D, Fu Y, Guo DL, Tanaka H, Wang N, Tang CS, Hammock BD, Shyy JY, Zhu Y (2007) Angiotensin II Upregulates Soluble Epoxide Hydrolase in Vascular Endothelium In vitro and In vivo. Proc Natl Acad Sci USA. 104: Qin X, Tian J, Zhang P, Fan Y, Chen L, Guan Y, Fu Y, Zhu Y, Chien S, Wang N (2007) Laminar shear stress up-regulates the expression of stearoyl-coa desaturase-1 in vascular endothelial cells. Cardiovasc Res. 74(3):
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationCardiovascular Division, Brigham and Women s Hospital, Harvard Medical School
Low Endothelial Shear Stress Upregulates Atherogenic and Inflammatory Genes Extremely Early in the Natural History of Coronary Artery Disease in Diabetic Hyperlipidemic Juvenile Swine Michail I. Papafaklis,
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More informationStrathprints Institutional Repository
Strathprints Institutional Repository Tate, Rothwelle and Rotondo, Dino and Davidson, Jillian (2015) Regulation of lipid metabolism by micrornas. Current Opinion in Lipidology, 26 (3). pp. 243-244. ISSN
More informationSummary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
More informationMinimallyModifiedLDLInducesActinPolymerization Macrophages viacd14signalingpathway.
MinimallyModifiedLDLInducesActinPolymerization Macrophages viacd14signalingpathway. *Randon T. Hall I, Joseph L. Witztum2, Yury I. Miller2 From the IMSTP-SURF Program and 2Division of Endocrinology and
More informationCURRICULUM VITAE Shanshan Zhou. Shanshan Zhou. Department of Cardiology. Tel: Feb 25, 1982, China. Chinese.
CURRICULUM VITAE Shanshan Zhou PERSONAL DETAILS Name: Work address: Shanshan Zhou Department of Cardiology The General Hospital of the People's Liberation Army 28 Fuxing Road, Haidian District, Beijing,
More informationG. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille, France
LIVER X RECEPTORS (LXRS): TRANSCRIPTIONAL REGULATORS OF MACROPHAGE CHOLESTEROL METABOLISM G. Chinetti-Gbaguidi and B. Staels, UR 545 INSERM, Institut Pasteur de Lille and Université de Lille 2, Lille,
More informationPotential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L.
Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L. Bartel 1 Ixmyelocel-T, an expanded, autologous multicellular therapy cultured
More informationNature Medicine doi: /nm.3150
Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG
More informationAtherosclerosis is the underlying cause of cardiovascular
RP5-833A20.1/miR-382-5p/NFIA Dependent Signal Transduction Pathway Contributes to the Regulation of Cholesterol Homeostasis and Inflammatory Reaction Yan-Wei Hu, Jia-Yi Zhao, Shu-Fen Li, Jin-Lan Huang,
More informationPPAR history of research
PPAR Rubens, 1640 PPAR history of research number of publications 3000 2000 1000 0 till now: : 16 296 publications 1985 1990 1995 2000 2005 year liver, brown adipocytes, kidney, heart, skeletal muscles,
More informationEndotoxin Induces Toll-Like Receptor 4 Expression in Vascular Cells: A Novel Mechanism Involved in Vascular Inflammation
Endotoxin Induces Toll-Like Receptor 4 Expression in Vascular Cells: A Novel Mechanism Involved in Vascular Inflammation Introduction Feng-Yen Lin, Ph.D. 1, and Shing-Jong Lin, M.D., PhD. 2, 1 Department
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationChild born in year /3 will die before parents in US (diabetes)
Child born in year 2000-1/3 will die before parents in US (diabetes) ATP III identified 6 components of the metabolic syndrome that relate to CVD 1. Abdominal obesity 2. Atherogenic dyslipidemia (elevated
More informationrenoprotection therapy goals 208, 209
Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization
More informationECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
More informationAmniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation
Amniotic fluid stem cells provide considerable advantages in epidermal regeneration: B7H4 creates a moderate inflammation microenvironment to promote wound repair Qing Sun 1, +, Fang Li 1, +, Hong Li 2,
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): Bempedoic acid (ETC-1002) is an ATP-citrate lyase (ACL) inhibitor that in clinical studies has been shown to decrease plasma LDL cholesterol apparently
More informationcholesterol structure Cholesterol FAQs Cholesterol promotes the liquid-ordered phase of membranes Friday, October 15, 2010
cholesterol structure most plasma cholesterol is in the esterified form (not found in cells or membranes) cholesterol functions in all membranes (drives formation of lipid microdomains) cholesterol is
More informationTable S1. Quantitative RT-PCR primers
Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg
More informationOriginal Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine
Int J Clin Exp Med 2015;8(9):16374-16378 www.ijcem.com /ISSN:1940-5901/IJCEM0010359 Original Article Regulation of macrophage cholesterol efflux and liver X receptor α activation by nicotine Hongming Zhang
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationCardiology, CardioVascular Center University Hospital Zurich Zurich, Switzerland
Modification of by the lipoxidation product malondialdehyde leads to LOX-1 dependent activation of endothelial PKCbeta-2 and adverse endothelial effects of in patients with coronary artery disease Christian
More informationLipid/Lipoprotein Structure and Metabolism (Overview)
Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures
More informationNovel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27
Novel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27 Ed O Brien, Jean-Claude Bakala-N Goma, Chunhua Shi Cumming School
More informationHigh density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
More informationThe New Gold Standard for Lipoprotein Analysis. Advanced Testing for Cardiovascular Risk
The New Gold Standard for Lipoprotein Analysis Advanced Testing for Cardiovascular Risk Evolution of Lipoprotein Testing The Lipid Panel Total Cholesterol = VLDL + LDL + HDL Evolution of Lipoprotein Testing
More informationSupplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
More informationMechanisms underlying adverse effects of HDL on enos-activating pathways in patients with coronary artery disease
Related Commentary, page 2545 Research article Mechanisms underlying adverse effects of HDL on enos-activating pathways in patients with coronary artery disease Christian Besler, 1,2,3 Kathrin Heinrich,
More informationRole of CD36, the Macrophage Class B Scavenger Receptor, in Atherosclerosis
Role of CD36, the Macrophage Class B Scavenger Receptor, in Atherosclerosis ANDREW C. NICHOLSON, JIHONG HAN, MARIA FEBBRAIO, ROY L. SILVERSTERIN, AND DAVID P. HAJJAR Center of Vascular Biology, Cornell
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationSupplementary Table I - Primers used for real-time quantitative PCR and RT-PCR
Supplement Supplementary Table I - Primers used for real-time quantitative PCR and RT-PCR Gene Forward Primer (5-3 ) Reverse primer (5-3 ) Reference Human ST2 CTTGATTGATAAACAGAATG CTGATCCAGATACTGTTGAA
More informationRegulation of Metabolism by Nuclear Hormone Receptors
Regulation of Metabolism by Nuclear Hormone Receptors Huey Jing Huang* and Ira G. Schulman { *Department of Biology, Exelixis Inc., 4757 Nexus Centre Drive, San Diego, California 92121 { Center for Molecular
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationJournal of the American College of Cardiology Vol. 50, No. 24, by the American College of Cardiology Foundation ISSN /07/$32.
Journal of the American College of Cardiology Vol. 50, No. 24, 2007 2007 by the American College of Cardiology Foundation ISSN 0735-1097/07/$32.00 Published by Elsevier Inc. doi:10.1016/j.jacc.2007.07.081
More informationMicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang
More informationTranslational Science. Inflammatory Stress Induces Statin Resistance by Disrupting 3-Hydroxy-3-Methylglutaryl-CoA Reductase Feedback Regulation
Translational Science Inflammatory Stress Induces Statin Resistance by Disrupting 3-Hydroxy-3-Methylglutaryl-CoA Reductase Feedback Regulation Yaxi Chen, Halcyon Ku, Lei Zhao, David C. Wheeler, Lung-Chih
More informationCholesterol and its transport. Alice Skoumalová
Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones
More informationQuantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
More informationThe inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema
The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema Dept Cardiology, Leiden University Medical Center, Leiden,
More informationDifferential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ
Research article Related Commentary, page 1538 Differential inhibition of macrophage foam-cell formation and atherosclerosis in mice by PPARα, β/δ, and γ Andrew C. Li, 1 Christoph J. Binder, 2 Alejandra
More informationMechanisms underlying adverse effects of HDL on enos-activating pathways in patients with coronary artery disease
Research article Mechanisms underlying adverse effects of HDL on enos-activating pathways in patients with coronary artery disease Christian Besler, 1,2,3 Kathrin Heinrich, 1,2,3 Lucia Rohrer, 3,4 Carola
More informationThe role of death-associated protein kinase in endothelial apoptosis under fluid shear stress
Purdue University Purdue e-pubs Open Access Dissertations Theses and Dissertations Spring 2015 The role of death-associated protein kinase in endothelial apoptosis under fluid shear stress Keith R. Rennier
More informationUnit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number
More informationWuzhou WAN, Ph.D. Ph.D. in Chemical Biology Peking University, Beijing, China. B.S. in Applied Chemistry Shandong University, Jinan, China
Wuzhou WAN, Ph.D. Research Fellow Molecular Signaling Section Laboratory of Molecular Immunology (NIAID, NIH) 9000 Rockville Pike Building10, Room11N107 Bethesda, Maryland 20892-1886 Phone: 301-496-8327
More informationCURRICULUM VITAE. Post Address: West China Second University Hospital, Section 3, 20S, Renmin Road, Chengdu, Sichuan , China
General Information: Name: Ling Gu Gender: Female Citizenship: P. R. China CURRICULUM VITAE Post Address: West China Second University Hospital, Section 3, 20S, Renmin Road, Phone Number: 86-13568818956(mobile),
More informationLipid metabolism in familial hypercholesterolemia
Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis
More informationCholesterol suppresses cellular TGF- responsiveness: implications in atherogenesis
Research Article 3509 Cholesterol suppresses cellular TGF- responsiveness: implications in atherogenesis Chun-Lin Chen 1, I-Hua Liu 2, Steven J. Fliesler 3, Xianlin Han 4, Shuan Shian Huang 2 and Jung
More informationFigure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
More informationRegulating Hepatic Cellular Cholesterol
Under circumstances of cholesterol deficiency, Sterol Regulatory Element Binding Proteins (SREBPs) via binding to DNA nuclear response elements set off genomic production of proteins and enzymes that induce
More informationSupplemental Material. Results
Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was
More informationPlasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam
Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain
More informationPOSITION TITLE Professor. DEGREE (if applicable)
NAME Wang, Tong era COMMONS USER NAME TOWANG BIOGRAPHICAL SKETCH Provide the following information for the key personnel and other significant contributors in the order listed on Form Page 2. Follow this
More informationDyslipidemia Endothelial dysfunction Free radicals Immunologic
ATHEROSCLEROSIS Hossein Mehrani Professor of Clinical Biochemistry Definition Atherosclerosis: Is a chronic inflammatory process characterized by plaque formation within the vessel wall of arteries and
More informationNature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.
Supplementary Figure 1 IC261 inhibits a virus-induced type I interferon response. (a) HEK293T cells were cultured in 384 wells and transiently transfected with 50 ng of the IFN-β promoter-luc construct
More informationa. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
More informationStatins and control of MHC2TA gene transcription
Statins and CIITA 4 4 Statins and control of MHC2TA gene transcription 4 Hedwich F. Kuipers and Peter J. van den Elsen Nature Medicine, 2005, 11: 365-366 Statins and control of MHC2TA gene transcription
More informationRole of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation
Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation In-kyu Lee, M.D., Ph. D. Dept. of Internal Med, Keimyung Univ., School of Med. Taegu, Korea Oxidative Stress and Atherosclerosis
More informationAcetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/389/ra79/dc1 Supplementary Materials for HDL-bound sphingosine 1-phosphate acts as a biased agonist for the endothelial cell receptor S1P 1 to limit vascular
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationCholesterol efflux pathways and other potential mechanisms involved in the athero-protective effect of high density lipoproteins
Review Article Cholesterol efflux pathways and other potential mechanisms involved in the athero-protective effect of high density lipoproteins A. R. Tall From the Division of Molecular Medicine, Department
More informationTreating the Cause to Prevent and Reverse Heart Disease. Caldwell B. Esselstyn Jr., M.D.
Treating the Cause to Prevent and Reverse Heart Disease Caldwell B. Esselstyn Jr., M.D. Dr Esselstyn reports no known financial conflicts. Is the Therapy of Coronary Artery Disease the Radical Mastectomy
More informationArteriosclerosis & Atherosclerosis
Arteriosclerosis & Atherosclerosis Arteriosclerosis = hardening of arteries = arterial wall thickening + loss of elasticity 3 types: -Arteriolosclerosis -Monckeberg medial sclerosis -Atherosclerosis Arteriosclerosis,
More informationCholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia
Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary
More informationNature Immunology doi: /ni Supplementary Figure 1. Raf-1 inhibition does not affect TLR4-induced type I IFN responses.
Supplementary Figure 1 Raf-1 inhibition does not affect TLR4-induced type I IFN responses. Real-time PCR analyses of IFNB, ISG15, TRIM5, TRIM22 and APOBEC3G mrna in modcs 6 h after stimulation with TLR4
More informationEpidemiological studies have revealed an inverse correlation
LXR-Induced Redistribution of ABCG1 to Plasma Membrane in Macrophages Enhances Cholesterol Mass Efflux to HDL Nan Wang, Mollie Ranalletta, Fumihiko Matsuura, Felix Peng, Alan R. Tall Objectives This study
More informationSupplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
More informationTopic 11. Coronary Artery Disease
Topic 11 Coronary Artery Disease Lipid metabolism http://news.bbc.co.uk/2/hi/health/7372495.stm Sterol Metabolism and Coronary Artery Disease Big Picture: Exogenous Cholesterol and Fat Metabolism Fats-Triglycerides
More informationLipoprotein Particle Profile
Lipoprotein Particle Profile 50% of people at risk for HEART DISEASE are not identified by routine testing. Why is LPP Testing The Most Comprehensive Risk Assessment? u Provides much more accurate cardiovascular
More informationROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU. PhD THESIS Summary
ROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU PhD THESIS Summary INVOLVEMENT OF ALARMIN HMGB1 IN INFLAMMATORY PROCESSES ASSOCIATED WITH VASCULAR DYSFUNCTION IN HYPERLIPIDEMIA
More informationA lincrna-dynlrb2-2/gpr119/glp-1r/abca1- dependent signal transduction pathway is essential for the regulation of cholesterol homeostasis
A lincrna-dynlrb2-2/gpr119/glp-1r/abca1- dependent signal transduction pathway is essential for the regulation of cholesterol homeostasis Yan-Wei Hu, 1, * Jun-Yao Yang, 1, * Xin Ma, 1, Zhi-Ping Chen, *
More informationCholesterol is an essential component of mammalian cell
Brief Reviews Intracellular Cholesterol Transport Raymond E. Soccio, Jan L. Breslow Abstract Intracellular cholesterol transport is essential for the maintenance of cholesterol homeostasis. Many aspects
More informationSphingosine-1-phosphate receptor-2 deficiency leads to inhibition of macrophage proinflammatory activities and atherosclerosis in apoe-deficient mice
RETRACTED View retraction Amendment history: Retraction (March 2012) Expression of concern (January 2012) Sphingosine-1-phosphate receptor-2 deficiency leads to inhibition of macrophage proinflammatory
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationResearch Article Silence of NLRP3 Suppresses Atherosclerosis and Stabilizes Plaques in Apolipoprotein E-Deficient Mice
Mediators of Inflammation, Article ID 5728, 8 pages http://dx.doi.org/1.1155/214/5728 Research Article Silence of NLRP3 Suppresses Atherosclerosis and Stabilizes Plaques in Apolipoprotein E-Deficient Mice
More informationAnnual Scientific Meeting of the Australian Atherosclerosis Society
Annual Scientific Meeting of the Australian Atherosclerosis Society October 21 23, 2015, Fremantle, Western Australia Faculty Member Biographies International Guest Speakers: Prof. Bart Staels, Pasteur
More informationInflammation: Novel Target for Cardiovascular Risk Reduction
Inflammation: Novel Target for Cardiovascular Risk Reduction Andrew Zalewski, M.D. Thomas Jefferson University, Philadelphia GlaxoSmithKline, Philadelphia Why inflammation? Population-based studies: low
More informationLeptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)
More informationDiosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23
Subject Index ACC, see Acyl-CoA carboxylase 1 -Acetoxychavicol acetate, inducible nitric oxide synthase suppression in cancer chemoprevention 199, 200 Acetylene carotenoids, anti-inflammatory activity
More informationDYSLIPIDEMIA PHARMACOLOGY. University of Hawai i Hilo Pre- Nursing Program NURS 203 General Pharmacology Danita Narciso Pharm D
DYSLIPIDEMIA PHARMACOLOGY University of Hawai i Hilo Pre- Nursing Program NURS 203 General Pharmacology Danita Narciso Pharm D 1 LEARNING OBJECTIVES Know normal cholesterol levels Understand what the role
More informationDepending on the geometry of the arterial tree, blood flow
Laminar Flow Activates Peroxisome Proliferator Activated Receptor- in Vascular Endothelial Cells Yi Liu, PhD; Yi Zhu, MD; Francois Rannou, MD, PhD; Tzong-Shyuan Lee, DVM, PhD; Kitty Formentin, PhD; Lingfang
More informationFunctional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,
More informationCholesterol Metabolism
Cholesterol Metabolism Lippincott s Illustrated Review Chapter 18 Steroid Nucleus 1 2 Cholesterol was isolated from gall bladder stones in 1774 3 Sources and Elimination of Cholesterol Synthesis: 1000
More information*These authors contributed equally to this study. Corresponding author: S. Wang
TLR4/NF-κB signaling pathway-mediated and oxldl-induced up-regulation of LOX-1, MCP-1, and VCAM-1 expressions in human umbilical vein endothelial cells Y. Feng 1 *, Z.R. Cai 2 *, Y. Tang 3, G. Hu 3, J.
More informationPage 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
More informationThis information is current as of September 21, 2018.
This information is current as of September 21, 2018. References Subscription Permissions Email Alerts Induction of Scavenger Receptor Class B Type I Is Critical for Simvastatin Enhancement of High-Density
More informationRole of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD
Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD Our laboratory focuses on the role of apolipoprotein (apo) B- containing lipoproteins in normal
More informationINCREASED SERUM HIGH-DENSITY LIPOPROTEIN CHOLESTEROL LEVEL IS ASSOCIATED WITH A REDUCTION IN PERIPHERAL MONOCYTE COUNT
INCREASED SERUM HIGH-DENSITY LIPOPROTEIN CHOLESTEROL LEVEL IS ASSOCIATED WITH A REDUCTION IN PERIPHERAL MONOCYTE COUNT IN NORMAL INDIVIDUALS Zei-Shung Huang, 1 Kwan-Lih Hsu, 1 Kuo-Liong Chien, 1 Tien-Chun
More informationNature Immunology doi: /ni.3268
Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,
More informationBIOMEDICAL SCIENCES GRADUATE PROGRAM SUMMER 2014
THE OHIO STATE UNIVERSITY BIOMEDICAL SCIENCES GRADUATE PROGRAM SUMMER 2014 Jessica Rose Napolitano PhD Candidate Examination of the role of ZIP8 and cadmium in the development of Chronic Obstructive Pulmonary
More informationRadiation-induced Bystander Effect in Immune Response 1
BIOMEDICAL AND ENVIRONMENTAL SCIENCES 17, 40-46 (2004) Radiation-induced Bystander Effect in Immune Response 1 SHU-ZHENG LIU 2, SHUN-ZI JIN, AND XIAO-DONG LIU Department of Radiation Biology, Jilin University
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationIt is believed that physiological shear stress exerts atheroprotective
Chronic Physiological Shear Stress Inhibits Tumor Necrosis Factor Induced Proinflammatory Responses in Rabbit Aorta Perfused Ex Vivo Hideyuki Yamawaki, DVM, PhD; Stephanie Lehoux, PhD; Bradford C. Berk,
More informationand Restenosis Yangsoo Jang, MD, PhD. Yonsei University College of Medicine
PPAR- Agonist and In-Stent Restenosis Yangsoo Jang, MD, PhD. Yonsei University College of Medicine Peroxisome Proliferator- activated Receptors (PPAR) Lipid-activated transcription factors : => regulating
More informationAssociation of liver X receptor α (LXRα) gene polymorphism and ischemic stroke
Association of liver X receptor α (LXRα) gene polymorphism and ischemic stroke H.X. Wang 1, K. Zhang 2, L. Zhao 1, J.W. Tang 1, L.Y. Gao 1 and Z.P. Wei 1 1 Department of Neurology, The Affiliated Fourth
More information