FEATURES OF GENE POLYMORPHISMS REGULATING LIPID METABOLISM

Transcription

1 Open Access Research Journal Medical and Health Science Journal, MHSJ ISSN: (Print) (Online) Volume 11, 2012, pp FEATURES OF GENE POLYMORPHISMS REGULATING LIPID METABOLISM AND ID POLYMORPHISM OF ACE GENE IN UZBEK PATIENTS WITH UNSTABLE ANGINA WITH A FAMILY HISTORY OF CORONARY HEART DISEASE There were examined 183 Uzbek patients with unstable angina. The basic group consisted of 125 patients with unstable angina (UA) and control group consisted of 58 healthy persons. Presence of CHD in family history among Uzbek patients with UA was associated with the accumulation of damaging alleles: A (M1-) G-A polymorphism of APOA1, ε4 of APOE gene, and D I/D polymorphism of ACE gene. Meanwhile, there were no differences revealed in the frequency of carriage T allele of - 516C/T polymorphism of APOB gene. FERUZA BEKMETOVA, RAVSHANBEK KURBANOV, ALEXANDER SHEK, LILYA KAN, SHAVKAT HASHIMOV Republican Specialized Center of Cardiology, Uzbekistan Keywords: Polymorphism of gene, unstable angina, burdened family history, lipid metabolism, angiotensin-converting enzyme UDC: : : Introduction It is known that in the development of coronary heart disease (CHD), together with phenotypic factors of the environment (Kannel et al., 1976; Kotceva et al., 2009) the genetic predisposition to disease plays an important role. Conduction of simultaneous analysis of all candidate genes is currently intricate problem; therefore, it s important to release a group of genes with potentially the greatest contribution to the pathogenesis of disease. Polymorphism of genes regulating lipid transport and metabolism - apolipoprotein E, B and A - plays an important role in lipid metabolism and can directly influence the development of atherosclerosis. The proteins of apolipoproteins E, B, A are involved in creating, secretion, transport, and binding of macromolecular lipoprotein complexes (Fielding and Fielding, 1995; Gerdes et al., 2000; Van t Hooft et al., 1999). Angiotensin-converting enzyme (ACE) is a key enzyme of the renin-angiotensin system (RAS) plays an important role in the regulation of hemodynamics and blood pressure, control of water-salt metabolism and cell growth (Kurtz, 1992). Objective To study distribution of apolipoprotein E, B and A genes polymorphism, regulating lipid metabolism - and ID polymorphism of ACE gene in Uzbek patients with unstable angina, depending on the availability of family history of CHD. Materials and methods The study included patients receiving inpatient treatment in Republican Specialized Center of Cardiology. There were examined 125 Uzbek patients with unstable angina (class IIB), and hypercholesterolemia (low-density lipoprotein (LDL) cholesterol > 100 mg/dl). Control group consisted of 58 healthy Uzbek subjects without clinical and instrumental diagnostic signs of CHD (according to exercise test), comparable with the patients by age and sex, with no family history of CHD. There were excluded patients with myocardial infarction (MI), transferred in previous 3 months, patients with diabetes type 2 requiring insulin treatment, with II-III degree hypertension (BP>159/99 mmhg), hypotension

2 (BP<100/60 mmhg), atrial fibrillation and life-threatening ventricular arrhythmias, chronic obstructive pulmonary disease, patients receiving long-term lipid-lowering drugs and angiotensin-converting enzyme inhibitors (ACEi), with chronic heart failure higher than I FC (NYHA), chronic renal and hepatic failure. For objective assessment of level of inflammation biomarkers, exclusion criteria also included: presence acute infectious disease or exacerbation of chronic infectious disease, inflammatory and autoimmune diseases in less than 1 month after complete clinical and laboratory remission. All patients gave informed consent to participate in the study. Family history Evaluation of family history conducted on basis of survey using a standard questionnaire by WHO, Family History. We registered presence of death (in consequence of myocardial infarction or stroke) in 1st degree relatives (parents, siblings, and children), old myocardial infarction, and presence of hypertension. Family history considered burdened in the presence of a patient with 2 or more affected relatives. Initially, diagnosis of unstable angina was verified on basis of: complaints - a characteristic of the dynamics of pain on the background of the therapy; history - presence of angina or a history of myocardial infarction (not older than 3 months); dynamics of the ECG (transient STdepression more than 1 mm, the lack of elevation ST), lack of troponin I increase, ECG Holter monitoring; echocardiography - revealing signs of disturbances of local contractility (hypokinesia, dyskinesia), evaluation of global left ventricular contractility. Ultrasound examination of carotid arteries - determined thickness of the intima-media complex (IMC) of common carotid artery (CCA) by scanning B-mode color Doppler flow mapping in the ultrasound system ALOKA - Multi View (Japan) linear transducer with a frequency of 7 MHz [20m]. Echocardiography: performed on echocardiograph ALOKA - Multi-View by the standard method as recommended by the American Association of Echocardiography, there were measured: end-diastolic size, end-systolic size of LV, left ventricular posterior wall thickness (LVPWT) and interventricular septum (IVST) in diastole. All measurements were performed at least 5 cardiac cycles, and then results were averaged. ECG Holter monitoring performed to verify the diagnosis in patients with unstable angina: according to standard method on the unit Cardiolab, (HAI, Ukraine). Determination of lipid profile. In studying the lipid profile content were determined: total cholesterol, triglycerides, HDL cholesterol, LDL and VLDL cholesterol very low density, coefficient of atherogenicity. Blood sampling was carried out on the next day after admission to hospital, in the morning, after 12 hours of fasting, from the cubital vein, in the horizontal position of the patient. Determination of blood lipid levels - total cholesterol (TC), high density lipoprotein (HDL), triglycerides (TG) - performed by enzymatic method on biochemical analyzer Daytona (RANDOX, UK). The concentration of LDL-C was determined by the Fridvald s formula: LDL-C=TC-HDL-TG/5 (mg/dl); Atherogenic ratio (AR) was determined by the formula: AR=(Cholesterol - HDL cholesterol)/hdl-c (relative unit). TC in blood serum <200 mg/dl, HDL-C>40 mg/dl, TG<150 mg/dl was considered as normal values. Concentration of high sensitive C-reactive protein was determined by a highly sensitive particle-enhanced turbidimetric immunoassay method with latex amplification using Daytona (RANDOX, UK). The lower limit of determination was 0.20 mg / l. Blood for investigation of CRP was taken on an empty stomach. Content of apolipoproteins A-1, B determined on the biochemical autoanalyzer Daytona (RANDOX, UK), using particle

3 enhanced turbidimetric immunoassay, using a monospecific antibody to human apob. Were calculated the apob/apoa ratio. Value of the coefficient considered normal when ratio was <1.0. Determination of the concentration of Lp (a) (mg/dl) in serum was performed by ELISA using a monospecific antibody to human Lp (a). Level of lipoprotein (a) higher than 30 mg / dl considered as increased value. By request of laboratory CHD RSCC MH RU were genotyped 183 samples of whole blood. There were selected 4 candidate-genes, polymorphic variants of these genes according to international databases associated with coronary artery disease. Isolation of genomic DNA. Genomic DNA was isolated from peripheral blood lymphocytes by standard protocol using reagents Diatom TM DNA Prep 200 (production of LLC Laboratory Isogen ). Polymerase chain reaction. Genotyping of RAAS genes by polymerase chain reaction (PCR) was performed in the laboratory of functional human genomics, at the Institute of Genetics and Plant Experimental Biology, Academy of Sciences of RU using PCR Systems 2700 thermal cycler ( Applied Biosystems, USA) and in the laboratory of Arterial Hypertension and MHI RSCC on the GeneAmp PCR Systems 9700 thermal cycler ( Applied Biosystems, USA). For genotyping of polymorphic markers of RAAS genes by PCR used the following primer pairs: G-A polymorphism of APO A1 gene 5 '- AGG GAC AGA GCT GAT CCT TGA ACT CTT AAG -3' (direct primer) 5 '- TTA GGG GAC ACC TAG CCC TCA GGA AGA GCA -3' (reverse primer) -516C/T polymorphism of APO B used the following sequence of primers (Sposito, 2004): 5 '- GCT GGG GTT TCT TGA AGA CA - 3' (direct primer) 5 '- CAA GCG TCT TCA GTG CTC TG - 3' (reverse primer) ε2/ε3/ε4 polymorphism of APO E gene Upstream primer = 5'TCCAAGGAGCTGCAGGCGGCGCA3 ' Downstream primer = 5'ACAGAATTCGCCCCGGCCTGGTACACTGCCA3 '. I/D-polymorphism of ACE gene: ACE1 5 - CTG GAG ACC ACT CCC ATC CTT TC - 3 ACE2 5 - GAT GTG GCC ATC ACA TTC GTC AGA T - 3 Statistical analysis Statistical data analysis was performed using the software package Statistica 6.0, and were also used Microsoft Excel spreadsheets. Results are presented as arithmetic mean and standard deviation (M ± SD), statistical significance of the measurements by comparing the average values determined by Student's test (t) with the computation of error probability (P) for checking the normality of the distribution. We used nonparametric analysis (T test Mann-Whitney test for two samples) if the distribution of the studied variables differed from normal. To find the difference between the qualitative variables used χ2 method. For the statistically significant changes taken confidence level P <0.05 (95% significance level). To compare the frequency of favorable and unfavorable outcome in unrelated groups, calculated the odds ratio (odds ratio - OR) with determination of confidence interval (CI). Differences in the studied binary attributes considered statistically significant if CI for OR did not include one. Survivability was considered as probability of absence of an unfavorable outcome within 12 months after unstable angina

4 Results Among the 183 Uzbek persons in the basic group patients with unstable (progressive) angina class II B, in the control group - 58 healthy subjects (Table 1). Of the 183 Uzbek subjects surveyed, 125 were included to basic group of patients with unstable (progressive) angina class II B, the remaining 58 healthy subjects included in the control group (Table 1). Among the patients with unstable angina 63 (51.2%) patients (I group) had burdened familial history (Table 1). A comparative analysis of both groups of patients did not differ in baseline clinical and hemodynamic and biochemical parameters (Table 2, 3), but I group had higher values of IMС of the carotid arteries and the level of hscrp. TABLE 1. CLINICAL AND DEMOGRAPHIC CHARACTERISTICS EXAMINED SUBJECTS (M±SD, n %) Indices Patients with unstable angina (n=125) Healthy subjects (n=58) Age 54.8± ±11.3 Sex (male/female), n (%) 71/54 (56.8%/43.2%) 30/28 (51.7%/48.3%) Burdened familial history, n (%) 63 (51.2%) 0 Diabetes mellitus, n (%) 26 (20.8%) 0 Heart rate, beats per min. 78.2±12.6*** 68.6±5.9 SBP, mmhg 136.0±21.4*** 120.7±8.1 DBP, mmhg 86.5±11.7*** 77.2±5.2 Note: *,**,*** - Р<0.05, Р<0.01, Р<0.001, significance of differences relative to the group of healthy individual. TABLE 2. COMPARATIVE EVALUATION OF INITIAL CLINICAL AND HEMODYNAMIC AND BIOCHEMICAL PARAMETERS IN THE STUDIED GROUPS OF PATIENTS WITH UNSTABLE ANGINA ACCORDING TO FAMILY HISTORY (M±SD, n (%)) Indices Patients with a burdened familial history (I group) Patients without a family history (II group) n 63 (50.4%) 62 (49.6%) Age 53.1± ±8.4 Sex (male/female), n (%) 36/27 (57.1%/42.9%) 35/27 (56.5%/43.5%) Duration of CHD, years 5.6± ±4.5 Hypertensive disease I stage 60 (95.2%) 55 (88.7%) History of myocardial infarction 23 (36.5%) 22 (35.5%) Diabetes mellitus 14 (22.2%) 12 (19.4%) History of stroke 5 (7.9%) 2 (3.2%) Frequency of angina attacks, for ± ±7.5 week Intake of nitroglycerin for 1 week 20.3±8.0 20,1±5.2 Heart rate, beats / min 78.1± ±12.4 Systolic BP, mmhg 136.3± ±23.4 Diastolic BP, mmhg 86.4± ±12.2 LV EDV, ml 140.5± ±30.5 LV ESV, ml 53.2± ±21.8 LVEF, % 62.7± ±8.3 IMC, right 1.02± ±0.20 IMC, left 1.02±0.23* 0.93±0.22 Note: *,**,*** - Р<0.05, Р<0.01, Р<0.001, significance of differences relative to the group patients without a family history

5 TABLE 3. COMPARATIVE EVALUATION OF BASELINE PARAMETERS OF LIPID METABOLISM, BIOMARKERS OF LIPID METABOLISM AND INFLAMMATION IN STUDIED GROUPS OF PATIENTS WITH UNSTABLE ANGINA ACCORDING TO FAMILY HISTORY (M±SD) Indices Patients with a burdened Patients without familial history (n=63) a family history (n=62) Total cholesterol, mg/dl 218.2± ±38.0 TG, mg/dl 193.7± ±95.3 LDL cholesterol, mg/dl 141.0± ±36.2 HDL cholesterol, mg/dl 38.1± ±8.7 VLDL cholesterol, mg/dl 39.6± ±22.0 Atherogenic ratio, relative unit 4.9± ±1.3 Apo A, mg/dl 131.1± ±26.1 Apo B, mg/dl 102.0± ±27.8 Apo A/Apo B, unit 0.8± ±0.3 Lipoprotein (a) mg/dl 35.6± ±14.2 hscrp, g/l 12.3±2.3*** 7.9±2.6 Note: *,**,*** - Р<0.05, Р<0.01, Р<0.001, significance of differences relative to the group patients without a family history. In studying the distribution of damaging alleles of studied genes, in the whole of UA patients compared with healthy individuals has been found a higher prevalence of A allele carriers of the apolipoprotein A, and tendency to more frequent occurrence of Apo E ε4 allele among the patients (Table 4). In the separate comparison of studied groups was found that in group II the distribution of damaging alleles did not differ significantly from healthy subjects, whereas in group I had significantly greater accumulation of alleles: A GA polymorphism of APO A1 gene, ε4 polymorphism of APO E gene, a marked predominance of allele D I/D-polymorphism of ACE gene. At the same time there was no difference in the frequency of carriage T alleles of-516c / T polymorphism of APO B gene. TABLE 4. DISTRIBUTION OF POLYMORPHISMS OF APOLIPOPROTEIN E, B AND A GENES REGULATING LIPID METABOLISM - AND ID POLYMORPHISM OF ACE GENE IN UZBEK PATIENTS WITH UNSTABLE ANGINA, DEPENDING ON FAMILY HISTORY Genes Damaging allele Patients with UA (n=125) ApoE ε4-carriers vs no-ε4 28/97 relative risk: ,86-5,2 ApoB T-carriers vs CC 50/75 relative risk: 0.88 ApoA1 A-carriers vs GG 50/75 relative risk: ,63-8,04 P=0.002 ID ACE D-carriers vs II 83/42 relative risk: ,83-5,08 Family history, (n=63) 18/45 relative risk: ,12-7,62 P=0,044 25/38 relative risk: /30 relative risk: ,52-14,24 P= /14 relative risk: ,04-5,09 P=0.06 Without family history, (n=62) 10/52 relative risk: ,50-3,97 25/37 relative risk: /45 relative risk: ,83-5,08 34/28 relative risk: ,39-1,65 Healthy individuals (n=58) 7/51 25/33 9/49 35/

6 Discussion The peculiarity of our study was to compare the distribution of alleles of studied genes in patients, depending on family history of CHD. This allowed comparing the prevalence of genetic markers in people who may have been the predominant influence of the phenotype of environmental factors with a tuning fork of the group of patients with a crucial contribution of genetic factors. There was some unexpected predominance of allele A Apo A gene in Uzbek patients with unstable angina in comparison with healthy individuals. In some reports the accumulation of A allele was accompanied by increased levels of HDL-C and Apo AI with the expectation of reducing the risk of CHD (Jeenah et al., 1990; Pagani et al., 1990; Zou Yangchun et al.,2003), but in others it has not been confirmed (Barre et al., 1994; Civeira et al.,1993; Peacock et al., 1994; Wang et al.,1996), and even pointed to the feedback (Matsunaga et al., 1995). In women, carriers of the A allele was found the relationship between genotype and diet, depending on Apo AI GA polymorphism: increased intake of polyunsaturated fatty acids was associated with an increased concentration of HDL, whereas in women with G / G genotype was observed adverse effect (Ordovas, 1999). In some studies it was found that carriers of the A allele (M1) in the promoter region of Apo AI gene is associated with a significant increase in the concentration of lipoprotein (a), regardless of gender and the presence of diabetes (Albahrani et al., 2007; Heng et al., 2001). Also, in some experimental studies have shown that the A allele is associated with reduced transcription of lipoprotein AI, which is known to have important antiatherogenic value (Matsunaga et al., 1999; Smith et al., 1992; Tuteja et al., 1992). In a study of Requero et al., 1998, indicated a significant increase in the frequency of the A allele (M1) in the promoter region of the gene Apo AI in patients with unstable angina (P <0.05), and especially with acute myocardial infarction (P=0.009), outside the context of other risk factors (Requero et al., 1998). The results of our study among patients with unstable angina confirm these data and suggest that the heterogeneity of published data may be associated with a different representation of patients with a family history of CHD in these studies. Among the candidate genes considered involved in the risk of coronary heart disease, an important place is occupied by a gene coding apolipoprotein E (Song et al., 2004). The role of the Apo E gene polymorphism in the occurrence and progression of CHD confirmed by studies that found an association of ε4 allele with morbidity and mortality from CHD (De Andrade et al., 1995; Stengard et al., 1995). In substudy conducted as part of Scandinavian multicenter study 4S showed that ε4-carriers met in 36.5%, while non-ε4 carriers were 63.5% of surveyed patients after myocardial infarction (Davignon et al., 1999). At the same time, ε4-carriers who taking a placebo, had almost twice higher risk of mortality relative to non-carriers (15.7% and 9%; RR 1,8, : ). Meanwhile a similar design study conducted within the framework of GISSI- Prevenzione in Italy, among patients with myocardial infarction, only 16.8% were ε4- carriers and 83.2% were not-ε4 carriers. It was shown that ε4-allele is a determinant of a positive response to therapy with pravastatin in relation to survival (Chiodini et al. 2007; Gerdes et al., 2000). Angiotensinogen and ACE are key elements of the renin-angiotensin system (RAS) and make a great contribution to the development of cardiovascular diseases. In REGRESS study, according to a two-year monitoring of 782 men with stable angina treated with pravastatin, the incidence of myocardial infarction was significantly higher among patients with DD genotype of ACE gene and in patients with both DD genotype of ACE gene and CC genotype of an angiotensin II receptor gene (Van Geel et al., 2001). Results of this study showed that among patients with unstable angina, marked

7 accumulation of damaging lipid-protein alleles of transport and the renin-angiotensin systems, are more expressed in patients with a family history of coronary artery disease. Conclusion Presence of family history of CHD among Uzbeks with unstable angina is associated with the accumulation of alleles A (M1-) GA polymorphism of APO A1, ε4 APO E gene, and some prevalence of D allele, I/D-polymorphism of ACE gene. Meanwhile, there were no differences revealed in the frequency of carriage T alleles of-516c / T polymorphism of APO B gene. References Albahrani, A., Usher, J., Mohammed Alkindi et al., ApolipoproteinA1-75 G/A (M1-) polymorphism and Lipoprotein(a) Anti- versus Pro-Atherogenic properties, Lipids in Health and Disease, Vol.6, pp.19 Barre, D., Guerra, R., Verstraete, R., Wang, Z., Grundy, S., Cohen, J., Genetic analysis of a polymorphism in the human apolipoprotein A-I gene promoter: effect on plasma HDL-cholesterol levels, J Lipid Res., Vol.35(7), pp Chiodini, B., Franzosi, M., Barlera, S. et al Apolipoprotein E polymorphisms influence effect of pravastatin on survival after myocardial infarction in a Mediterranean population: the GISSI-Prevenzione study, Eur. Heart J, Vol.28, pp Civeira, F., Pocovi, M., Cenarro, A., Garces, C., Ordovas, J., Adenine for guanine substitution -78 base pairs to the apolipoprotein (APO) A-I gene: relation with high-density lipoprotein cholesterol and apoa-i concentrations, Clin Genet., Vol.44(6), pp Davignon, J., Cohn, J., Mabile, L., Bernier, L., Apolipoprotein E and atherosclerosis: insight from animal and human studies, Clin. Chim. Acta., Vol.286(1-2), pp De Andrade, M., Brown, S. et al., Relationship of the apolipoprotein E polymorphism with carotid artery atherosclerosis, Am. J. Hum. Genet., Vol.56, pp Fielding, C.J., Fielding, P.E., Molecular physiology of reverse cholesterol transport, Journal of Lipid Research, Vol.36(2), pp Gerdes, L., Gerdes, C., Kervinen, K. et al., The apolipoprotein epsilon4 allele determines prognosis and the effect on prognosis of simvastatin in survivors of myocardial infarction: a substudy of the Scandinavian simvastatin survival study, Circulation. Vol.101, pp Gerdes, L., Jeune, B., Ranberg, K. et al., Estimation of apolipoprotein E genotype specific relative mortality from the distribution of genotypes in centenarians and middle-aged men: Apolipoprotein E gene is a «frailty gene», not a «longevity gene, Genetic Epidemiol., Vol.19(3), pp Heng, Ck., Low, P., Saha, N., Variations in the promoter region of the apolipoprotein A-1 gene influence plasma lipoprotein(a) levels in Asian Indian neonates from Singapore, Pediatr Res. Vol.49(4), pp Jeenah, M., Kessling, A., Miller, N., Humphries, S., G to A substitution in the promoter region of the apolipoprotein AI gene is associated with elevated serum apolipoprotein AI and high density lipoprotein cholesterol concentrations, Mol. Biol. Med. Vol.7(3), pp Kannel, W., McGee, D., Gordon, T., General cardiovascular risk profile: The Framingham Stud, Am J Cardiol., Vol.38, pp Kotceva, K., Wood, D., De Backer, G. et al., EUROASPIRE Study Group. Euroaspire III A survey on the lifestyle, risk factors and use of cardioprotective drug therapies in coronary patients from 22 European countries, Eur J Cardiovasc Prev. Rehabil., Vol.16(2), pp Kurtz, T., Genetic Approaches to Hypertension Annals of Medicine, Vol.24. pp Matsunaga, A., Sasaki, J., Han, H. et al., Compound heterozygosity for an apolipoprotein A1 gene promoter mutation and a structural nonsense mutation with apolipoprotein A1 deficiency, Arterioscler Thromb Vasc. Biol., Vol.19, pp Matsunaga, A., Sasaki, J., Mori, T. et al., Apolipoprotein A-I gene promoter polymorphism in patients with coronary artery disease and healthy controls, Nutr. Metab. Cardiovasc. Dis., Vol.5, pp Ordovas, J., The genetics of serum lipid responsiveness to dietary interventions,, Proc. Nutr. Soc., Vol.58, pp

8 Pagani, F., Sidoli, A., Giudici, G., Barenghi, L., Vergani, C., Baralle, F., Human apolipoprotein A-I gene promoter polymorphism: association with hyperalphalipoproteinemia, J Lipid Res., Vol.31, pp Peacock, R., Hamsten, A., Johansson, J., Nilsson-Ehle, P., Humphries SE. Associations of genotypes at the apoliprotein AI-CIII-AIV, apolipoprotein B and lipoprotein lipase gene loci with coronary atherosclerosis and high-density lipoprotein subclasses, Clin. Genet., Vol.46(4), pp Requero, J., Cubero, G., Batalla, A. et al., Apolipoprotein AI gene polymorphisms and risk of early Coronary disease, Cardiology, Vol.90, pp Smith, J., Brinton, E., Breslow, J., Polymorphism in the human apolipoprotein A-I gene promoter region. Association of the minor allele with decreased production rate in vivo and promoter activity in vitro, J Clin. Invest., Vol.89, pp Song, Y., Stampfer, M., Liu, S., Meta_analysis: Apolipoprotein E genotypes and risk for coronary heart disease, Ann. Int. Med., Vol.141(2), pp Stengard, J., Zebra, K. et al Apolipoprotein E polymorphism effect atherosclerosis in young males, Circulation., Vol.91(2), pp Tuteja, R., Tuteja, N., Melo, C., Casari, G., Baralle, F., Transcription efficiency of human apolipoprotein A-I promoter varies with naturally occurring A to G transition, FEBS Lett., Vol. 304, pp Van Geel, P., Van Geel, P.P., eto oshibka? idiot povtor Pinto, Y., Zwinderman, A. et al Synergistic effects of angiotensin converting enzyme and angiotensin-ii type 1 receptor gene polymorphisms on ischaemic events, XX Congress of the European society of Cardiology, Abstract. p.386 Van t Hooft, F., Jormsjö, S., Lundahl, B., Tornvall, P. et al., A functional polymorphism in the apolipoprotein B promoter that influences the level of plasma low density lipoprotein, J. Lipid Res., Vol.40, pp Wang, X., Liu, S., McCredie, R., Wilcken, D., Polymorphisms at the 5'-end of the apolipoprotein AI gene and severity of coronary artery disease, J Clin. Invest., Vol.98(2), pp Zou Yangchun, Hu Dayi, Yang Xinchun et al., Kak pravilno familiii sdelat Relationships among apolipoprotein A1 gene polymorphisms, lipid levels and coronary atherosclerosis disease, Chinese Medical Journal, Vol.116(5), pp