Virulence profiles of Shiga toxin 2e-producing Escherichia coli isolated from healthy pig at slaughter

Transcription

1 Veterinary Microbiology 117 (2006) Short communication Virulence profiles of Shiga toxin 2e-producing Escherichia coli isolated from healthy pig at slaughter C. Zweifel a, S. Schumacher a, L. Beutin b, J. Blanco c, R. Stephan a, * a Institute for Food Safety and Hygiene, Vetsuisse Faculty University of Zurich, Winterthurerstrasse 272, 8057 Zurich, Switzerland b Federal Institute for Risk Assessment (BfR), National Reference Laboratory for Escherichia coli, Diedersdorfer Weg 1, Berlin, Germany c E. coli Reference Laboratory (LREC), Department of Microbiology and Parasitology, Faculty of Veterinary, University of Santiago de Compostela (USC), Lugo, Spain Received 24 April 2006; received in revised form 19 June 2006; accepted 21 June Abstract Recently, virulence patterns of Stx2e-producing Escherichia coli from pigs with edema disease and from humans were compared and strains from diseased pigs were reported to be unlikely human pathogens [Sonntag, A.K., Bielaszewska, M., Mellmann, A., Dierksen, N., Schierack, P., Wieler, L.H., Schmidt, M.A., Karch, H., Shiga toxin 2e-producing Escherichia coli isolates from humans and pigs differ in their virulence profiles and interactions with intestinal epithelial cells. Appl. Environ. Microbiol. 71, ]. In the present study, 31 Shiga toxin-producing E. coli (STEC) strains harboring stx2e, which were previously isolated out of fecal samples from healthy pigs at slaughter [Kaufmann, M., Zweifel, C., Blanco, M., Blanco, J.E., Blanco, J., Beutin, L., Stephan, R., Escherichia coli O157 and non-o157 Shiga toxin-producing Escherichia coli in fecal samples of finished pigs at slaughter in Switzerland. J. Food Prot. 69, ], were characterized by phenotypic and genotypic traits. Nine of the thirty-one sorbitol-positive non-o157 STEC (stx2e) isolated from healthy pigs belonged to serotypes found in STEC isolated from humans, including two serotypes (O9:H, O26:H ) reported in association with hemolytic-uremic syndrome. Otherwise, the serotypes were different from those isolated from cases of edema disease in pigs. The eae (intimin) gene, which is strongly correlated with severe human disease, was not detected. Moreover, all strains were lacking the genes for enterohemolysin (ehxa), porcine A/E associated protein ( paa), STEC autoagglutinating adhesin (saa) and the serin protease EspI (espi). Nine strains tested positive for asta (EAST1), one O141:H17 strain for feda (F18 fimbrial adhesin) and one O159:H strain for terf (tellurite resistance). Similar to the Stx2e-producing E. coli isolated from humans, which are mainly lacking further virulence factors, genes of an iron uptake system on the high-pathogenicity island (irp2, fyua) were detected in three ONT:H10 and ONT:H19 strains from healthy pigs. Consequently, although the isolated strains are unlikely to be associated with severe human diseases, healthy pigs cannot be excluded as a potential source of human infection with Stx2e-producing STEC. # 2006 Elsevier B.V. All rights reserved. Keywords: Shiga toxin-producing E. coli; stx2e; Healthy pig; Virulence factors * Corresponding author. Tel.: ; fax: address: stephanr@fsafety.unizh.ch (R. Stephan) /$ see front matter # 2006 Elsevier B.V. All rights reserved. doi: /j.vetmic

2 C. Zweifel et al. / Veterinary Microbiology 117 (2006) Introduction Shiga toxin-producing Escherichia coli (STEC) are responsible for a number of human diseases, including watery or bloody diarrhea, hemorrhagic colitis (HC) and hemolytic-uremic syndrome (HUS). To assess the pathogenicity of STEC, evaluation of serotypes and virulence factors is required. Most cases of HC and HUS have been attributed to O157:H7 STEC, but the importance of non-o157 STEC is increasingly recognized. Different authors have underlined the potential key role of the Stx2 subtype and intimin in the severity of disease, whereas the impact of enterohemolysin is controversially discussed (Eklund et al., 2001; Friedrich et al., 2002; Beutin et al., 2004). Since strains harboring stx2e have been isolated from patients with diarrhea and HUS (Thomas et al., 1994; Friedrich et al., 2002; Beutin et al., 2004) and genetic relatedness between O101 strains from human and porcine origin was demonstrated (Franke et al., 1995), the epidemiological role of pigs needs further elucidation. Reports on STEC isolated from pigs are often based upon animals suffering from postweaning diarrhea or edema disease. Commonly, edema disease causing E. coli belong to certain O serogroups (O138, O139, O141, O149, O157) and produce Stx2e and adherence-mediating factors as F18 fimbrial adhesin Table 1 PCR primers and conditions used Target Primer Oligonucleotide sequence ( ) Annealing temperature (8C) No. of cycles Product size (bp) Reference asta EAST11a CCATCAACACAGTATATCCGA Yamamoto and EAST11b GGTCGCGAGTGACGGCTTTGT Nakazawa (1997) eae SK1 CCCGAATTCGGCACAAGCATAAGC Friedrich et al. SK2 CCCGGATCCGTCTCGCCAGTATTCG ehxa HlyA1 GGTGCAGCAGAAAAAGTTGTAG Schmidt et al. HlyA4 TCTCGCCTGATAGTGTTTGGTA (1995) espi EspI-I ATGGACAGAGTGGAGACAG Schmidt et al. EspI-II GCCACCTTTATTCTCACCA (2001) feda feda1 GTGAAAAGACTAGTGTTTATTTC Niewerth et al. feda2 CTTGTAAGTAACCGCGTAAGC (2001) fyua FyuA f TGATTAACCCCGCGACGGGAA Karch et al. FyuA r CGCAGTAGGCACGATGTTGTA (1999) irp2 Irp2 FP AAGGATTCGCTGTTACCGGAC Karch et al. Irp2 RP TCGTCGGGCAGCGTTTCTTCT (1999) paa M155-F1 ATGAGGAAACATAATGGCAGG Batisson et al. M155-R1 TCTGGTCAGGTCGTCAATAC (2003) saa SAADF CGTGATGAACAGGCTATTGC Paton and Paton SAADR ATGGACATGCCTGTGGCAAC stx1 KS7 CCCGGATCCATGAAAAAAAC ATTATTAATAGC Friedrich et al. KS8 CCCGAATTCAGCTATTCTG AGTCAACG stx2 VT2e AATACATTATGGGAAAGTAATA Piérard et al. VT2f TAAACTGCACTTCAGCAAAT (1998) stx2e FK1 CCCGGATCCAAGAAGATGTTTATAG Friedrich et al. FK2 CCCGAATTCTCAGTTAAACTTCACC terf TerF1 TerF2 TTACAATCCGGACAAAACA CAATGACAACGGTGATCG Taylor et al.

3 330 C. Zweifel et al. / Veterinary Microbiology 117 (2006) (Aarestrup et al., 1997; Blanco et al., 1997, 2006). Recently, it was shown that Stx2e-producing E. coli isolated from pigs suffering from edema disease and from humans differ in: (i) their virulence patterns and therefore the latter are unlikely human pathogens and (ii) in their interactions with intestinal epithelial cells (Sonntag et al., 2005). Otherwise, studies investigating healthy pigs detected STEC in a high prevalence and some strains were reported as potential human pathogens (Rios et al., 1999; Fratamico et al., 2004). The aim of the present study was: (i) to characterize stx2e-positive E. coli strains isolated from healthy pigs at slaughter by phenotypic and genotypic traits and (ii) to compare the results obtained with the virulence profiles of recently characterized Stx2e-producing E. coli from diseased pigs and humans (Sonntag et al., 2005). 2. Materials and methods Recently, we isolated non-o157 STEC strains from fecal samples of slaughtered pigs in Switzerland by colony blot hybridization (Kaufmann et al., 2006). Thirty-one strains harboring stx2e were serotyped with available O (O1 to O185) and H (H1 to H56) antisera and examined for sorbitol fermentation (sorbitol MacConkey agar) and a-hemolysis (sheep blood agar). For the genotypic characterization, isolated strains were tested by PCR for stx1, stx2 and stx2e (Piérard et al., 1998; Friedrich et al., 2002). Additionally, strains were examined by PCR for asta encoding for EAST1 (Yamamoto and Nakazawa, 1997), eae encoding for intimin (Friedrich et al., 2002), ehxa encoding for enterohemolysin (Schmidt et al., 1995), espi encoding for the serin protease EspI (Schmidt et al., 2001), feda encoding for the major subunit of F18 fimbrial adhesin (Niewerth et al., 2001), fyua and irp2 that are genes of an iron uptake system (Karch et al., 1999), paa encoding for porcine attaching and effacing (A/E) associated protein (Batisson et al., 2003), saa encoding for STEC autoagglutinating adhesin (Paton and Paton, 2002) and terf used as a marker for tellurite resistance (Taylor et al., 2002). PCR assays were performed in a T3 thermocycler (Biometra, Göttingen, Germany). Reagents were purchased from PROMEGA (Madison, WI) and primers synthesized by MICROSYNTH (Balgach, Switzerland). PCR mixtures (50 ml) consisted of 2 ml of bacterial suspension boiled in 42 ml of doubledistilled water (100 8C, 10 min), 5 ml of 10-foldconcentrated polymerase synthesis buffer containing 2.0 mm MgCl 2, 200 mm (each) dntp, 30 pmol of each primer and 2.5 U of Taq DNA polymerase. PCR primers, target sequences, product sizes and main conditions are listed in Table Results and discussion All 31 stx2e-positive E. coli strains originating from healthy pigs fermented sorbitol and three strains showed a-hemolysis. Twenty-two strains were typeable with available O antisera, whereas nine were nontypeable (ONT). Moreover, 13 strains were typed into seven different H types, whereas 18 were non-motile (H ). Among typeable strains, 10 different O:H serotypes were present (Table 2). Serotypes O8:H9, O9:H, and O26:H (9/31 strains) have previously been described among STEC isolated from humans, including serotypes O9:H and O26:H (5/31 strains) reported in association with HUS (Table 2). The majority of the non-o157 STEC harboring stx2e were lacking further virulence factors (Table 2). Genes for adhesins as the outer membrane protein intimin (eae), a protein essential for the intimate attachment and the formation of A/E lesions on intestinal epithelial cells (Nataro and Kaper, 1998), or the STEC autoagglutinating adhesin (saa), a protein probably of importance in strains negative for the locus of enterocyte effacement (LEE) (Paton and Paton, 2002), were not detected. Sonntag et al. (2005) hypothesized that as-yet-unidentified adhesin factors may play a role in the adherence of Stx2e-producing E. coli to epithelial cells not belonging to the classical edema disease serogroup. Moreover, the following genes were also not detected in the examined strains: ehxa encoding for enterohemolysin, paa encoding for the porcine A/E associated protein that was reported to contribute to the early stages of A/E E. coli virulence (Batisson et al., 2003) as well as espi located on a pathogenicity island termed the locus of proteolysis activity and encoding for the serin protease EspI that cleaves swine pepsin A and human apolipoprotein (Schmidt et al., 2001). Interestingly, Stx2e-producing

4 C. Zweifel et al. / Veterinary Microbiology 117 (2006) Table 2 Characterization results of stx2e-positive Escherichia coli isolated from healthy pig at slaughter (n = 31) Serotype No. of strains stx1 stx2 eae ehxa asta paa saa feda irp2 fyua terf espi a-hemolysis O2:H32 1 stx2e + O8:H4 3 stx2e O8:H9 a 4 stx2e O9:H b 4 stx2e O26:H b 1 stx2e O65:H 1 stx2e + O100:H 2 stx2e + O100:H 3 stx2e O141:H17 c 1 stx2e + + O159:H 1 stx2c, 2e + + O180:H21 1 stx2e ONT:H a 3 stx2e ONT:H a 3 stx2e + ONT:H10 a 2 stx2e ONT:H19 a 1 stx2e NT, non-typeable. a Serotypes previously found in STEC strains isolated from humans. b Serotypes previously associated with STEC strains that caused HUS. c Serotype associated with edema disease. E. coli from patients with mild diarrhea or from asymptomatic carriers also lacked the majority of the examined virulence factors (Sonntag et al., 2005). Ten strains harbored further putative virulence factors (asta, feda, fyua, irp2, terf)(table 2). Overall, the asta gene encoding for EAST1 was most frequently found (9/31 strains; O100:H, O159:H, ONT:H, ONT:H10). Interestingly, the O159:H strain, which tested positive for stx2c and stx2e, harbored additionally the terf gene. The terf gene is used as a marker for the ter cluster encoding tellurite resistance and for E. coli O157:H7 screening (Taylor et al., 2002). Albeit strains were isolated from apparently healthy pigs, one stx2e-positive strain belonged to a serogroup associated with edema disease (O141), showed a- hemolysis, tested positive for feda encoding for the major subunit of F18 fimbrial adhesin and therefore contained characteristics of strains typically associated with edema disease in pigs. But, similarly to Stx2eproducing E. coli isolated from humans (Sonntag et al., 2005), 30 of the 31 strains did not show factors reported in strains associated with edema disease. It is noteworthy that among the stx2e-positive E. coli isolated from healthy pigs, three strains harbored the irp2 and fyua genes (Table 2). These genes are components of an iron uptake-mediating gene cluster located on the high-pathogenicity island (HPI). It was hypothesized that HPI may contribute to the fitness of strains under iron limitation and to the virulence of strains, as HPI was also found in certain STEC pathogenic to humans (Karch et al., 1999). Similarly, 5 of 13 Stx2e-producing E. coli isolated from humans, but none of the corresponding isolates from diseased pigs, contained irp2 and fyua (Sonntag et al., 2005). Moreover, among the five strains isolated from humans containing a complete HPI, four strains were also non-typeable and three strains showed the same H type as the irp2- and fyua-positive strains isolated from healthy pigs in the present study (ONT:H10, ONT:H19). However, the contribution of HPI to pathogenicity remains unclear, as three of the HPI-positive human strains were isolated from patients with diarrhea, whereas the two others were isolated from asymptomatic carriers (Sonntag et al., 2005). In consequence, stx2e-positive E. coli isolated from healthy pigs are unlikely to be associated with severe human diseases as HUS or HC, especially as genes for intimin and enterohemolysin were not detected. However, in view of the remarkable prevalence of stx2e-positive STEC reported in healthy pigs (Fratamico et al., 2004; Kaufmann et al., 2006) and as long as the exact contribution and interaction of virulence factors in especially milder disease remains unclear,

5 332 C. Zweifel et al. / Veterinary Microbiology 117 (2006) healthy pigs cannot be excluded as a potential source of human infection with Stx2e-producing STEC. The phenomenon that porcine STEC, which are frequently found in food and in the environment, are rarely isolated from human infections could be explained by inadequate colonization of humans with these strains highly adapted to swine. It cannot be excluded, that these strains might acquire other colonization factors by horizontal gene transfer, which might enable them to colonize humans more efficiently. References Aarestrup, F.M., Jorsal, S.E., Ahrens, P., Jensen, N.E., Meyling, A., Molecular characterization of Escherichia coli strains isolated from pigs with edema disease. J. Clin. Microbiol. 35, Batisson, I., Guimond, M.-P., Girard, F., An, H., Zhu, C., Oswald, E., Fairbrother, J.M., Jacques, M., Harel, J., Characterization of the novel factor Paa involved in the early steps of the adhesion mechanism of attaching and effacing Escherichia coli. Infect. Immun. 71, Beutin, L., Krause, G., Zimmermann, S., Kaulfuss, S., Gleier, K., Characterization of Shiga toxin-producing Escherichia coli strains isolated from human patients in Germany over a 3- year period. J. Clin. Microbiol. 42, Blanco, M., Blanco, J.E., Gonzalez, E.A., Mora, A., Jansen, W., Gomes, T.A., Zerbini, L.F., Yano, T., Pestana de Castro, A.F., Blanco, J., Genes coding for enterotoxins and verotoxins in porcine Escherichia coli strains belonged to different O:K:H serotypes: relationship with toxic phenotyes. J. Clin. Microbiol. 35, Blanco, M., Lazo, L., Blanco, J.E., Dahbi, G., Mora, A., López, C., González, E.A., Blanco, J., Serotypes, virulence genes, and PFGE patterns of enteropathogenic Escherichia coli isolated from Cuban pigs with diarrhea. Int. Microbiol. 9, Eklund, M., Scheutz, F., Siitonen, A., Clinical isolates of non- O157 Shiga toxin-producing Escherichia coli: serotypes, virulence characteristics, and molecular profiles of strains of the same serotype. J. Clin. Microbiol. 39, Franke, S., Harmsen, D., Caprioli, A., Piérard, D., Wieler, L.H., Karch, H., Clonal relatedness of Shiga-like toxin-producing Escherichia coli O101 strains of human and porcine origin. J. Clin. Microbiol. 33, Fratamico, P.M., Bagi, L.K., Bush, E.J., Solow, B.T., Prevalence and characterization of Shiga toxin-producing Escherichia coli in swine feces recovered in the National Animal Health Monitoring System s Swine 2000 study. Appl. Environ. Microbiol. 70, Friedrich, A.W., Bielaszewska, M., Zhang, W.L., Pulz, M., Kuczius, T., Ammon, A., Karch, H., Escherichia coli harboring Shiga toxin 2 gene variants: frequency and association with clinical symptoms. J. Infect. Dis. 185, Karch, H., Schubert, S., Zhang, D., Zhang, W., Schmidt, H., Ölschläger, T.O., Hacker, J., A genomic island, termed high pathogenicity island, is present in certain non-o157 Shiga toxinproducing Escherichia coli clonal lineages. Infect. Immun. 67, Kaufmann, M., Zweifel, C., Blanco, M., Blanco, J.E., Blanco, J., Beutin, L., Stephan, R., Escherichia coli O157 and non- O157 Shiga toxin-producing Escherichia coli in fecal samples of finishedpigsatslaughter inswitzerland. J. Food Prot. 69, Nataro, J.P., Kaper, J.B., Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11, Niewerth, U., Frey, A., Voss, T., Le Bouguenec, C., Baljer, G., Franke, S., Schmidt, M.A., The AIDA autotransporter system is associated with F18 and stx2e in Escherichia coli isolates from pigs diagnosed with edema disease and postweaning diarrhea. Clin. Diagn. Lab. Immunol. 8, Paton, A.W., Paton, J.C., Direct detection and characterization of Shiga toxigenic Escherichia coli by multiplex PCR for stx1, stx2, eae, ehxa, and saa. J. Clin. Microbiol. 40, Piérard, D., Muyledermans, G., Moriau, L., Stevens, D., Lauwers, S., Identification of new verocytotoxin type 2 variant B- subunit genes in human and animal Escherichia coli isolates. J. Clin. Microbiol. 36, Rios, M., Prado, V., Trucksis, M., Arellano, C., Borie, C., Alexandre, M., Fica, A., Levine, M.M., Clonal diversity of Chilean isolates of enterohemorrhagic Escherichia coli from patients with hemolytic-uremic syndrome, asymptomatic subjects, animal reservoirs, and food products. J. Clin. Microbiol. 37, Schmidt, H., Beutin, L., Karch, H., Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL933. Infect. Immun. 63, Schmidt, H., Zhang, W.-L., Hemmrich, U., Jelacic, S., Brunder, W., Tarr, P.I., Dobrindt, U., Hacker, J., Karch, H., Identification and characterization of a novel genomic island integrated at selc in locus of enterocyte effacement-negative, Shiga toxinproducing Escherichia coli. Infect. Immun. 69, Sonntag, A.K., Bielaszewska, M., Mellmann, A., Dierksen, N., Schierack, P., Wieler, L.H., Schmidt, M.A., Karch, H., Shiga toxin 2e-producing Escherichia coli isolates from humans and pigs differ in their virulence profiles and interactions with intestinal epithelial cells. Appl. Environ. Microbiol. 71, Taylor, D., Rooker, M., Keelen, M., Ng, L.-K., Martin, I., Perna, N.T., Burland, N.T., Blattner, F.R., Genome variability of O islands encoding tellurite resistance in enterohemorrhagic Escherichia coli O157:H7 isolates. J. Bacteriol. 184, Thomas, A., Cheasty, T., Chart, H., Rowe, B., Isolation of Vero cytotoxin-producing Escherichia coli serotypes O9ab:H and O101:H carrying VT2 variant gene sequences from a patient with haemolytic uraemic syndrome. Eur. J. Clin. Microbiol. Infect. Dis. 13, Yamamoto, T., Nakazawa, M., Detection and sequences of the enteroaggregative Escherichia coli heat-stable enterotoxin 1 gene in enterotoxigenic E. coli strains isolated from piglets and calves with diarrhea. J. Clin. Microbiol. 35,