Nucleotide Sequence Analysis of the Small (S) RNA Segment of Bunyamwera Virus, the Prototype of the Family Bunyaviridae

Transcription

1 J. gen. Virol. (1989), 70, Printed in Great Britain 1281 Key words: nucleotide sequence/bunyamwera virus Nucleotide Sequence Analysis of the Small (S) RNA Segment of Bunyamwera Virus, the Prototype of the Family Bunyaviridae By RCHARD M. ELLOTT nstitute of Virology, University of Glasgow, Church Street, Glasgow Gll 5JR, U.K. (Accepted 18 January 1989) SUMMARY The nucleotide sequence of the small (S) RNA segment of the Bunyamwera virus genome has been determined. The S RNA is 961 bases in length and, in common with other bunyaviruses, encodes two proteins, N and NSs, in overlapping reading frames. A six-way alignment of the amino acid sequences of the N and NSs proteins of viruses representing three serogroups within the Bunyavirus genus indicates regions which are strongly conserved, and provides targets for future analysis of protein function. The family Bunyaviridae is classified into five genera, Bunyavirus, Hantavirus, Nairovirus, Phlebovirus and Uukuvirus, on the basis of serological and biological criteria. Bunyamwera virus is the prototype of both the Bunyavirus genus and the family Bunyaviridae and was isolated from infected mosquitoes in Uganda (Smithburn et al., 1946). The bunyavirus genome comprises three segments of negative-sense RNA designated L (large), M (middle) and S (small). The S RNA encodes the nucleoprotein, N, and a non-structural protein, NSs; the M RNA encodes the two virion glycoproteins G1 and G2, and a second non-structural protein, NSm (reviewed by Bishop, 1985); the L RNA encodes the large protein L (R. M. Elliott, unpublished data) which is presumed to be a component of the virion-associated RNA polymerase. Nucleotide sequence studies of cloned cdna copies of bunyavirus RNAs have shown that the N and NSs proteins are encoded in overlapping reading frames (Bishop et al., 1982; Cabradilla et al., 1983; Akashi & Bishop, 1983; Akashi et al., 1984; Gerbaud et al., 1987; R. M. Elliott & A. McGregor, unpublished data), and the M segment encodes a polyprotein precursor containing G1, G2 and NSm (Eshita & Bishop, 1984; Lees et al., 1986; Grady et al., 1987; Pardigon et al., 1988). This laboratory has cloned cdna copies of the Bunyamwera virus genome segments (Lees et al., 1984; Pringle et al., 1984), and has reported the sequence of the M RNA segment (Lees et al., 1986). Here the sequence of the Bunyamwera virus S RNA segment is presented, together with a detailed comparison of six bunyavirus S RNA sequences which highlights regions of conservation in their N proteins. Complementary DNA clones containing Bunyamwera virus S segment-specific sequences were generated and identified as described by Pringle et al. (1984). DNA sequence determination was by both the chemical degradation method (Maxam & Gilbert, 1980) as modified in Lees et al. (1986) and the dideoxynucleotide chain termination method using DNA fragments subcloned into bacteriophage M13 (Sanger et al., 1980). The nucleotide sequences of five independent but overlapping cdna clones were determined and yielded a contiguous sequence corresponding to bases 15 to 961 of the Bunyamwera virus S RNA (complementary, positive RNA sense). None of the clones examined contained the 5'- terminal consensus sequence of bunyavirus RNAs (Clerx-van Haaster et al., 1982); hence the terminal sequences were determined by primer extension of a synthetic oligonucleotide (complementary to bases 108 to 127) in the presence of dideoxynucleoside triphosphates (Geliebter et al., 1986) using infected cell positive strand RNA as template (Fig. 1 a) SGM

2 1282 Short communication (a) Primer extension 5' 11! 3' + RNA 894 pbuns14, pbun3/ pbun308! pbun pbun93 t (b) ~ i 1 AGTAGTGTACTCCACACTACAAACTTGCTATTGTTGAAAATCGCTGTGCT~TTAAATCC~CAG~GGTCATTAAAGGCTCTTT~TGAT 90 M M S L L T P A V L L T Q R S H T L T L S V S ~ P L E L E F H D V A A N T S S T F D P E V A Y A N F K R V H T T 91 TGAGTTGG~TTTCATGATGTCGCTGCT~CACCAGcAGTACTTTTGACCCAGAGGTCGCATACGCT~CTTT~GCGTGTCCACACCAC 180 G L V M T T Y E S S T L K D A R L K L V S Q K E V N G K L H G L S Y D H R F y K G R E K T S L A K R S E W E V T 181 TGGGCTTAGTTATGACCACATACG~TCTTCTACATTAAAGGACGCGAGATTAAAACTAGTCTCGCAAAAAG~GTG~TGGG~GTTAC 270 LTLGAGRLLYRNFLATGTTQFLTMVLPS L N L G G W K T V Y N T F P G N R N N P V P D D G L T L 271 ACTT~CCTTGGGGGCTGG~GATTACTGTATAT~TACG~TTTTCCTGGC~CcGG~C~CCCAGTTCcTGACGATGGTCTTACCCT 360 T A S V D S L P G T Y L R R C * H R L S G F L A R Y L L E K M L K V S E P E K L K S K 361 CCACcGCCTCAGTGGATT~CTTGCCAGGTAC~TACTTGAG~GATGCTG~GTCAGTG~CCAGAG~TTGATTATTAAATCAAAAAT 450 N P L A E K N G T W N D G E E V Y L S F F P G S E M F L 451 ~TC~CCCTTTGGCTGA~G~TGGGATCACTTGG~TGATGGAGAGG~GTTTATCTCTCTTTCTTCCCAGGATCAGAGATGTTCTT 540 G T F R F Y P L A G Y K V Q R K E M E P K Y L E K T M R 541 AGG~CTTTCAGATTCTACCCCTTAGC~TCGGGATCTAC~GTTCAGCGC~GG~TGG~CCAAAATACCTTGAGAA~C~TGCG 630 Q R Y M G L E A A T W T V S K L T E V Q S A L T V V S S L G 631 GCAGAGGTACATGGGACTAG~GCAGC~CTTGGACTGTTAGTAAATTGAcAG~GTTCAGTCTGCACTGACAGTTGTCTCTAGCTTAGG 720 W K K T N V S A A A R D F L A K F G N M * 721 TTG~GAAAACC~TGTTAGTGCAGCTGCCAGGGACTTCCTTGCT~TTCGG~TC~CATGT~GCAGGGATGCATTTTT~TCGGG CTAAAGTCATCTGTTTT~TTTGGCTAAAAGGGTTGTTTC~CCCACA~T~CAGCTGCTTGGGTGGGTGGTTGGGGACAG~GACA GCGGGCTAAATC~CATTATATTGTT~TGGTATTTT~GTTTTAGGTGGAGCACACTACT 961 Fig. 1. Sequencing strategy and nucleotide sequence of the Bunyamwera vies S RNA segment. (a) Relationship of the five overlapping cdna clones and the bases they contain relative to the complementa~ positive sense RNA. Also shown are the two regions that were sequenced by primer extension on mrna (.-) or vrna (~). (b) Nucleotide sequence of the S RNA and deduced amino acid" sequences of the N and NSs proteins. The sequence presented is of the complementary positive RNA strand, written as DNA. The Bunyamwera virus S RNA segment is 961 nucleotides in length (Fig. 1 b) and has a base composition of 27-2~ A, 22.4~ C, 19-5~ G and 31-0~ U. Fourteen out of the 15 terminal nucleotides at the 5' and 3' ends of the RNA are complementary, the exception being A-C at positions 9 and 953. This mismatch was also noted in the complementary sequence at the termini of the M RNA segment (Lees et al., 1986). Two AUG-initiated open reading frames were found in the sequence: the first, of 233 codons, from bases 86 to 787 presumably encodes the N protein, and the second of 101 codons from base 105 (a tandem AUG) to base 410, presumably encodes the NSs protein. The N protein is

3 Short communication 1283 V D S L P NSs S G F L A N (371) AGT GGA TTC CTT GCC (385) AGT GGA TGT CTT GCC S G C L A N V D V L P NSs Fig. 2. Discrepancies between the sequences ofcdna clones at positions 378 and 379. The upper lines show the nucleotide sequence and deduced amino acid sequences obtained from clones pbun3/59, pbun308 and pbun309; the lower lines show the sequence obtained from cdna clone pbuns14. Sequence determination by primer extension on vrna as template showed the consensus sequence in the population to be that shown in the upper part of the figure. deficient in Cys residues, in agreement with data on the radiolabelling of infected cell proteins reported previously (Elliott, 1985); the NSs protein contains a single Cys residue at its carboxy terminus, which, is sufficient to radiolabel this protein, a feature used in the mapping of NSs (Elliott, 1985). Discrepancies between the sequences of cdna clones pbuns14 and clones pbun308, pbun309 and pbun3/59 were observed at positions 378 and 379 (Fig. 2). These were resolved by primer extension of an oligonucleotide complementary to virion RNA (bases 269 to 288 of positive sense RNA) to obtain the consensus sequence of the RNA population; the sequence obtained was the same as that from pbun308, pbun309 and pbun3/59. Therefore, pbuns14 may have been derived from a minor variant in the RNA population, and is interesting since it predicts a Cys residue at position 98 in the N protein. The possibility that the difference in pbuns14 arose by a reserve transcriptase-induced artefact, however, cannot be discounted. Nucleotide sequences are now available for the S RNA segments of six bunyaviruses which represent three serogroups in the Bunyavirus genus: Bunyamwera, Maguari (R. M. Elliott & A. McGregor, unpublished data) and Germiston (Gerbaud et al., 1987) viruses of the Bunyamwera serogroup, snowshoe hare (Bishop et al., 1982) and La Crosse (Akashi et al., 1983; Cabradilla et al., 1983) viruses of the California serogroup and Aino virus of Simbu serogroup (Akashi et al., 1984). The N proteins of these viruses are very similar in size, ranging from 233 to 235 amino acids; the NSs proteins are more variable in length, from 91 to 109 amino acids. The N and NSs proteins have been compared by pairwise comparison using the GAP program, followed by alignment of the 'gapped' sequences using the program PRETTY (both programs from the University of Wisconsin Genetics Computer Group; Devereux et al., 1984). The six-way alignment of the proteins is shown in Fig. 3. Overall the N proteins show about 40% similarity and the NSs proteins about 25 % similarity. Viruses within a serogroup show considerably more relatedness, 80% or greater between N proteins and 70% or greater between NSs proteins. Examination of the alignment of the N protein sequences in Fig. 3a shows that certain regions of the N proteins are well conserved, particularly between residues 62 and 102, residues 123 and 169 and the carboxy-terminal 15 residues. Presumably these conserved regions are of functional significance to the protein. Furthermore, these regions may give rise to the complement-fixing antibodies that cross-react throughout the Bunyavirus genus (Bishop, 1985). Noteworthy also is the strict conservation between all six proteins of the positions of some basic amino acid residues (at positions 51, 61, 66, 70, 94, 95, 102, 168, 181,184, 186, 199, 217 and 225). These residues may be involved in the interaction of the nucleocapsid protein with viral RNA. n contrast to the relatedness of the N proteins, the NSs proteins show greater diversity (Fig. 3 b). However, these proteins can be readily aligned with the minimum of inserted gaps, and the difference in length of the~nss proteins can be accounted for by the variability at the carboxy termini of the individual proteins. The region showing greatest similarity is between residues 71 and 91, which represents the carboxy terminus of the shortest NSs proteins. Outside this region there are only single or pairs of amino acid residues that are conserved. The significance of these residues in the, as yet unknown, function of the NSs protein awaits investigation.

4 1284 Short communication (a) 1 BUN N.MiELeFhDV AantssTFDP MAGN.MiELeFnDV AantssTFDP GERN.MELeFeDV pnnigstfdp LACN.MsDLvFyDV AstgangFDP SSHN.MsDLvFyDV AstgangFDP ANO.N manqfifqdv pqrnlatfnp Consensus -M-EL-F-DV A... TFDP EvaYanFkrv httglsydh EiaYvnFkri httglsydh EsGYtnFqrn ylpgvtldq DaGYmdFcvk naeslnlaav DaGYmaFcvk yaesvnlaav EvGYvaFiak hgaqlnfdtv E-GY--F... L-LD-- 60 RFYikgrei KtsLaKrsEW RVLYikgrei KtsLtKrsEW RFYikgrei KnsLSKrsEW RFFlnaaka KaaLSrkpER RFFlnaaka KaaLSrkpER RfFFlnqkka KmvLSKtaqp RF... K--LSK--EW 61 BUN.N evtlnlggwk tvyntnfpg MAGN evtlnlggwk VaVfNtnFPG GERN evtlnlggwk VpVNtnFPG LACN kanpkfgewq VeViNnhFPG SSHN kanpkfgewq VeVvNnhFPG ANO.N svdltfggik ftlvnnhfpq Consensus -V-L--GGWK V-V-N--FPG 121 BUN.N ksknplae kngtwndge MAG.N ksknplae kngtwadge GERN rtkvnplae kngtwesgp LAC.N rttnpiae sngvgwdsgp SSH.N kttnpiae sngvrwdsga ANO.N mekvmplae vkgctwtegl Consensus --KNPLAE -NGTW--G- NRNNPVPDdg LTLHRLSGFL NRNsPVPDdg LTLHRLSGFL NRNNaVPDyg LTFHRiSGYL NRNNPgnnd LTiHRLSGYL NRNNPnsdd LTiHRLSGYL ytanpvpdta LTLHRLSGYL NRNNPVPD-- LTLHRLSGYL EVYLSFFPGs EMFLgTFrFY EVYLSFFPGs EMFLgTFkFY EVYLSFFPGa EMFLgTFrFY EYLSFFPGt EMFLeTFkFY EYLSFFPGt EMFLeTFkFY tmylgfapga EMFLeTFeFY EVYLSFFPG- EMFL-TF-FY 120 AEYLEk.ml kvsepekli AEYiLEkilk vsd.pekli AEYLgkYa.etEpeklim AEWvLDqYne nddesqhel AEWvLEqYke nedesrrel AkWvaDqC.. ktnqiklaea AE--LE-Y... E PLaGYkVq rkemepkyle PLaGYkVq kkemepkyle PLaGYkVq rkemdpkfle PLtGhrVk qgmmdpqylk PLtGYrVk qgmmdpqylk PLvdmhrVl kdgmdvnfmr PL-GY-V... MDP-YL- BUN.N MAG.N GERN LAC.N SSHN A]NON Consensus 181 KtMRQRYmgL eaatwtvsk1 KtM-RQRYmgL eaatwtvskv KtMRQRYgi daqtwtttkl KaLRQRYgtL tadkwmsqkv KaLRQRYgsL tadkwmsqkv KvLRQRYgtL taeqwmtqk K--RQRY--L -A--W---KV tevqsaltvv sslgwkktnv nevqaaltvv sglgwkktnv geveaalkvv sglgwkktnv aaakslkdv eqlkwgkggl taakslkev eqlkwgrggl davraafnav gqlswaksgf --V--AL--V --L-W-K SaAARdFLaK FGnM*. SaAAReFLaK FGnM*. SsAAReFLsK FGrM*. SdtAktFLqK FGrLp* SdtARsFLqK FGrLp* SpAARaFLaq FGni*. S-AAR-FL-K FG-M-- (b) 1 BUN.NSS MMSLltpavl LTqrshtlTL svstplglvm MAG.NSS MMSLltpavl LTqrlhtlTL svstplglvm OERNSS.MSLitsgvl LTqsqdtlTF svttcqglrl LACNSS MMShqqvqmd LilmqgiwTs vlkmqnhstl SSHNSS MMShqqvqmd Lilmqgiwhs vlnmqnqsl ANONSS.MfLngislr LTrrsgmwhL llnmgpnss Consensus MMSL... LT... TL... L 61 BUN.NSS AGRYir FLaTGTtQF TmVLPSTasV MAG.NSS AGRYq FLaTGTvQFq TmVLPSTdsV GERNSS AGRylYsr sletgtmqcl TtVLPSTvsV LACNSS sgrwrlsi FLeTGTtQLv TtLPSTdyl SSH.NSS sgrwrlsi FLeTGTiQLt atlpstdcq ANONSS AsslhWit F..pnTqQil cqtlpslsiv Consensus AGR--Y-- FL-TGT-Q-- T-VLPST--V ttyesstlkd ttfesstlkd tkfasstlkd lqlgssssml lqlgssssmp ipldssssir --L-SS arlklvsqke vngklhltlg arlklvsqke vsgrlrltlg arlkivsqke vngklrltlg qrprlisrvs qrgrltlnle qrprll Srvs qrgrqilnle rrprwysvrr hnqvlilhlv -R--L-S... G-L-L-L- iii Dslpgtylrr c*... Dslpgtylrk f*... Dtlpgtyles tlqrqnqkss * gi*... Di*... sqdi*... D... Fig. 3. Six-way alignments of (a) the nucleocapsid (N) proteins and (b) the non-structural (NSs) proteins of Bunyamwera (BUN), Maguari (MAG), Germiston (GER), La Crosse (LAC), snowshoe hare (SSH) and Aino viruses. The alignments were prepared using the GAP and PRETTY programs of Devereux et al. (1984). The 'consensus' is based on a plurality of 4, and is a convenient way of highlighting regions of strong conservation. The comparisons described above highlight the conserved regions of the S RNA gene products. Once systems expressing these gene products have been established, the conserved areas of the proteins will provide targets for specific mutagenesis which should help both in designating function and delineating functional domains within the proteins.

5 Short communication 1285 thank Mairi Smith for technical assistance and Martina Scallan for performing direct RNA sequence analysis to resolve bases 378 and 379. The author is a Medical Research Council Senior Fellow, and this work was supported by a MRC project grant. REFERENCES AKASH, H. & BSHOP, D. H. L. (1983). Comparison of the sequences and coding of La Crosse and snowshoe hare bunyavirus S RNA species. Journal of Virology 45, AKASH, H., GAY, M., HARA, T. & BSHOP, D. H. L. (1984). Localized conserved regions of the S RNA gene products of bunyaviruses are revealed by sequence analyses of the Simbu serogroup Aino virus. Virus Research, BSHOP, D. H. L. (1985). Replication of arenaviruses and bunyaviruses. n Virology, pp Edited by B. N. Fields. New York: Raven Press. BSHOP, D. H. L., GOULD, K. G., AKASH, H. & CLERX-VAN HAASTER, C. M. (1982). The complete sequence and coding content of snowshoe hare bunyavirus small (S) viral RNA species. Nucleic Acids Research 10, CABRADLLA, C. D., HOLLOWAY, B. P. & OBJESK, J. P. (1983). Molecular cloning and sequencing of the La Crosse virus S RNA. Virology 128, CLERX-VAN HAKSTER, C. M., CLERX, J. P. M., USHJMA, H., AKASH, H., FULLER, F. & BSHOP, D. H. L. (1982). The 3' terminal RNA sequences of bunyaviruses and nairoviruses (Bunyaviridae): evidence of end sequence generic differences within the virus family. Journal of General Virology 61, DEVEREUX, J., HAEBERL, p. & SMTHES, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Research 12, ELLOTT, R. M. (1985). dentification of non-structural proteins encoded by viruses of the Bunyamwera serogroup (family Bunyaviridae). Virology 143, ESHTA, Y. & BSHOP, D. H. L. (1984). The complete sequences of the M RNA of snowshoe hare bunyavirus reveals the presence of internal hydrophobic domains in the viral glycoprotein. Virology 137, GELEBTER, J., ZEFF, R. A., MELVOLD, R. w. & NATHENSON, S. G. (1986). Mitotic recombination in germ cells generated two major histocompatibility complex mutant genes shown to be identical by RNA sequence analysis: K bin9 and K bin6. Proceedings of the National Academy of Sciences, U.S.A. 83, ~,RBAUD, S., VALAT, P., PARDGON, N., WYCHOWSK, C., GRARD, M. & BOULOY, M. (1987). The S segment of Germiston virus RNA genome can code for three proteins. Virus Research 8, GRADY, L. J., SANDERS, M. L. & CAMPBELL, W. P. (1987). The sequence of the M RNA of an isolate of La Crosse virus. Journal of General Virology 68, LEES, J. F., PRNGLE, C. R. & ELLOTT, R. M. (1984). Molecular cloning of the Bunyamwera virus genome. n Segmented Genome Viruses, pp Edited by D. H. L. Bishop & R. W. Compans. New York & London: Academic Press. LEES, J. F., PRNGLE, C. R. & ELLO''f, R. M. (1986). Nucleotide sequence of the Bunyamwera virus M RNA segment: conservation of structural features in the Bunyavirus glycoprotein gene product. Virology 148, MAXAM, A. i. & GLBERT, W. (1980). Sequencing endqabeled DNA with base-specific chemical cleavages. Methods in Enzymology 65, PARDGON, N., VALAT, P., GERBAUD, S., GRARD, M. & BOULOY, M. (1988). N ucleotide sequence of the M segment of Germiston virus: comparison of the M gene product of several bunyaviruses. Virus Research 11, PRNGLE, C. R., LEES,. F., CLARK, W. & ELLOTT, R. M. (1984). Genome sub-unit reassortment among bunyaviruses analysed by dot hybridization using molecularly cloned complementary DNA probes. Virology 135, SANGER, F., COULSON, A. R., BARRELL, B. G., SMTH, A. J. H. & ROE, S. A. (1980). Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. Journal of Molecular Biology 143, SMTHBURN, K. C., HADDOW, A. J. & MAHAFFY, A. F. (1946). A neurotropic virus isolated from Aedes mosquitoes caught in the Semliki Forest. American Journal of Tropical Medicine 26, 18~208. (Received 9 December 1988)