Starting from the bench Prevention and control of foodborne and zoonotic diseases

Transcription

1 Starting from the bench Prevention and control of foodborne and zoonotic diseases Martin Wiedmann Department of Food Science Cornell University, Ithaca, NY

2 Yrjo

3 Overview Foodborne diseases the scope Laboratory-based subtyping techniques and their application to detect disease outbreaks and characterize transmission routes Definition of pathogen subtypes within distinct molecular and epidemiological characteristics

4 Microbial foodborne diseases - US Latest 2011 CDC study estimates 47.8 million cases of gastrointestinal illnesses ; 9.4 million due to known and 38.4 million due to unknown pathogens) 127,000 serious illnesses resulting in hospitalizations; 56,000 due to known and 71,000 due to unknown pathogens 3,037 deaths (range: 1,492 4,983); 1,351 due to known and 1,686 due to unknown pathogens

5 WHO statement on foodborne diseases Food and water-borne diarrhoeal illnesses present a growing public health problem that claim 2.2m lives annually with 1.9m of these children. Many communicable diseases including emerging zoonoses are transmitted through food.

6

7

8

9

10 Overview Foodborne diseases the scope Laboratory-based subtyping techniques and their application to detect disease outbreaks and characterize transmission routes Definition of pathogen subtypes within distinct molecular and epidemiological characteritics

11 Listeria monocytogenes Gram-positive animal and human food-borne pathogen Facultative intracellular pathogen Causes abortion, meningitis, and septicemia Can grow at low temperatures High infectious dose Causes an estimated 1,600 illness and 255 deaths/year in US As of May 2013, 47 L. monocytogenes genomes and 14 genomes for other Listeria spp. available in GenBank

12 Examples of L. monocytogenes ribotypes 12

13 DNA sequencingbased subtyping j2-045 j L99 92 j2-068 j S j1-047 c2-006 n c dd680 c n n1-079 Isolate 1 AACATGCAGACTGACGATTCGACGTAGGCTAGACGTTGACTG Isolate 2 AACATGCAGACTGACGATTCGTCGTAGGCTAGACGTTGACTG Isolate 3 AACATGCAGACTGACGATTCGACGTAGGCTAGACGTTGACTG Isolate 4 AACATGCATACTGACGATTCGACGAAGGCTAGACGTTGACTG

14 Human listeriosis cases - NYS 1/97-10/ Jan Mar May Jul Sep Nov Jan Mar Jun Aug Oct

15 Ribotyping results - Nov 8, 9 pm

16 Ribotyping results - Nov 8, 12 pm

17 Epidemic curve for 1/97-2/99 in NYS A Other Ribotypes Jan Mar May Jul Sep Nov Jan Mar Jun Aug Oct Dec Feb

18 Conclusions 101 human cases and 21 deaths in 22 US states linked to infection by the same sub-type of Listeria monocytogenes Outbreak traced back to a single specific plant in Michigan

19 PulseNet International

20 Number of Cases Number of Cases Public Health Impact of Molecular Epidemiology Western States E. coli O157 Outbreak 726 cases 4 deaths 39 d outbreak detected Day of Outbreak Meat recall 2002 Colorado E. coli O157 Outbreak outbreak detected d Day of Outbreak If only 5 cases of E. coli O157:H7 infections were averted by the recall of ground beef in the Colorado outbreak, the PulseNet system would have recovered all costs for start up and operation for 5 years. (Elbasha et al. Emerg. Infect. Dis. 6: , 2000)

21 Use of DNA fingerprinting methods to understand pathogen transmission VISIT 1 VISIT 2 VISIT 3 Sample Ribotype Sample Sample Source Source RiboPrint Pattern * 1039C (E) Floor drain, raw materials area * 1039C (E) Floor drain, hallway to finished area * 1039C (IP) Troll Red King Salmon, in brine, head area * 1039C (IP) Troll Red King Salmon, in brine, belly area * 1039C (IP) Brine, Troll Red King Salmon * 1039C (IP) Faroe Island Salmon, in brine, head area * 1039C (F) Smoked Sable * 1039C (F) Cold-Smoked Norwegian Salmon 1044A (E) Floor drain, brining cold room A (R) Raw Troll Red King Salmon, head area 1044A (IP) Brine, Faroe Island Salmon 1045 (R) Raw Troll Red King Salmon, belly area 1045 (IP) Faroe Island Salmon, in brine, head area 1053 (IP) Norwegian Salmon, in brine 1062 (E) Floor drain #1, raw materials preparation * 1039C (E) Floor drain #1, raw materials preparation * 1039C (E) Floor drain, brining cold room 1 * 1039C (E) Floor drain #2, raw materials preparation * 1039C (E) Floor drain #2, raw materials receiving * 1039C (E) Floor drain, finished product area * 1039C (E) Floor drain, hallway to finished area * 1039C (IP) Brine, Troll Red King Salmon * 1039C (F) Smoked Sable 1044A (IP) Sable, in brine 1044A (IP) Brine, Faroe Island Salmon 1062 (IP) Brine, Norwegian Salmon

22 22

23 L. monocytogenes persisted in rubber floor mats despite sanitation Listeria can be protected from sanitizer in micro-cracks, but can be squeezed out by pressure if people stand on mats

24 2000 US outbreak - Environmental persistence of L. monocytogenes? 1988: one human listeriosis case linked to hot dogs produced by plant X 2000: 29 human listeriosis cases linked to sliced turkey meats from plant X

25 Salmonella The genus Salmonella is divided into 2 species S. bongori and S. enterica, which is subdivided into 6 subspecies (enterica, salamae, arizonae, diarizonae, houtenae, indica) Over 2,500 recognized serotypes, e.g. S. enterica subsp. enterica serotype Typhimurium (Salmonella Typhimurium) Salmonellosis is one of the most common and widely distributed foodborne diseases

26 Whole Genome Sequencing It all started with the human genome project Sequencing of a bacterial genome is now feasible at costs of <$100/isolate Costs will continue to drop Commonly used platforms include Illumina HiSeq/MiSeq; Life Technologies Ion Torrent; Roche 454; PacBio RS Public health applications of microbial whole genome sequencing are rapidly increasing, including investigation of nosocomial outbreaks

27 Collaboration with CDC (C. Tarr) Rapid Whole Genome Sequencing based subtyping of bacterial pathogens 3 days DNA extraction Library prep 24 h 12 h Sequencing on Bench top sequencer (MiSeq, Ion Torrent) De novo assembly Rapid classification to subpopulation using pairwise distances based on average nucleotide identity values (BLAST) Inference of subpopulation structure based on SNP calling.

28 Some Salmonella (e.g. serovar Enteritidis) are poorly resolved by current subtyping technologies PFGE type frequency MLVA type frequency B G BQ F J W I D AI BN AC E AG V AB AF BD MLVA-PFGE type frequency B4 B34 G4 B21 BQ8 I5 W4 J4 D4 BN692 AI19 AC2 F2 V4 AG56 J21 52 PFGE types 98 MLVA types 163 combined MLVA-PFGE types

29 Xbal SpeI Den Bakker et al AEM.

30 Tip-dated maximum clade credibility tree based on SNP data for 47 Montevideo isolates

31 Overview Foodborne diseases the scope Laboratory-based subtyping techniques and their application to detect disease outbreaks and characterize transmission routes Definition of pathogen subtypes within distinct molecular and epidemiological characteristics

32 L. monocytogenes full genome phylogeny

33 Molecular characterization of human, animal, and food isolates Lineage Human isolates (n=507) Food isolates (n=502) Animal isolates (n=126) Lineage I 54.4% 37.3% 40% Lineage II 42.6% 62.4% 52% Lineages III & IV 2.4% 0.4% 8% Lineage I predominantly represents serotypes 1/2b and 4b, lineage II predominantly represents serotypes 1/2a and 1/2c

34 1) Ribotype Number of isolates P-value 1) Comments Food Human DUP-1030A 8 8 NS DUP-1030B 0 10 ** not found in food DUP-1038B **** DUP-1039A ** DUP-1039B ** DUP-1039C NS DUP-1042A NS DUP-1042B **** DUP-1042C 14 0 *** multiple food types, not in humans DUP-1043A * DUP-1044A ** DUP-1044B 1 19 *** rarely found in food DUP-1044E 10 0 ** blue cheese only DUP-1045B NS DUP-1052A * DUP-1053A * DUP-1062A **** rarely found in humans DUP-1062D 28 1 **** rarely found in humans rare * Ribotypes with 1-4 isolates uncommon NS Ribotypes with 5-8 isolates Total **** Overall analysis of ribotype vs. origin P-values refer to comparison of origin between ribotype specified in that row vs. all other ribotypes where NS = not significant, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P <

35 Human virulence attenuation of ribotype DUP-1062A Isolates with ribotype DUP-1062A carry a premature stop codon in inla, which leads to reduced invasion of human epithelial cells Wildtype inla (745 aa) MA DUP-1062A inla (631 aa) LM LM Human intestinal epithelial cell Human intestinal epithelial cell

36 inla premature stop codons in other strains A B C N N N S S S S LRR IR B Repeats 492 LPXTG MA C 800 EGD-e (Glasser et al., 2001) 460 Food isolate from France (NV8; Rousseaux et al., 2002) Human fecal carriage strains from France (Olier et al., 2002) D N S 519 Food isolate from France (NV7; Rousseaux et al., 2002) E N F 575 N S 606 G S N 656 H S N 677 Human fecal carriage strain L028 from France (Jonquieres et al., 1998) Mutation type 1; DUP-1052A & DUP-16635A Mutation type 2; DUP-1025A & DUP-1031A Food isolate from France (NV4; Rousseaux et al., 2002) I J S N 685 S N 700 Food isolate from France (NV5; Rousseaux et al., 2002) Mutation type 3; DUP-1046B & DUP-1062A Van Stelten and Nightingale et al. AEM. 2

37 Invasion into human intestinal epithelial cells of L. monocytogenes with and without premature stop codons in inla Nightingale et al. AEM. 2008

38 L. monocytogenes with premature inla stop codon: summary Found more commonly in food isolates than human isolates France: inla premature stop codon strains represent 35% of food isolates and 4% of human clinical isolates (Jacquet et al JID 189) Also found in China and Portugal Attenuated virulence in guinea pigs Not all L. monocytogenes are equally likely to cause human disease and many L. monocytogenes in foods have reduced ability to cause human disease

39

40 Salmonella Background den Bakker et al. BMC Genomics. 2011

41 den Bakker et al. BMC Genomics. 2011

42 Summary and conclusions It takes a village (of lab scientists) to raise an epidemiologists Some lab data can be useful for epidemiologists.. Some epidemiologists can be useful for data interpretation The increasing granularity of lab data provides tremendous new opportunities to (i) better understand disease transmission and (ii) better define mechanisms that may explain population-based and epidemiological observations Continued bridging of lab-based and epidemiological approaches is essential to a One-Health that delivers societal benefits

43 Acknowledgments Students and staff: H. den Bakker, T. Bergholz, M. Stasiewicz, H. Oliver, R. Orsi, K. Hoelzer, E. Fortes, R. Ivy, V. Ferreira Collaborators: Cornell: Y. Groehn, K. J. Boor, Q. Sun NYSDOH: W. Wolfgang, N. Dumas, T. Root, D. Morse, D. Schoonmaker-Bopp, K. Musser, R. Limberger CDC: C. Tarr, P. Gerner-Smidt, B. Swaminathan, L. Graves, the Listeria Working Group FDA: M. Allard, E. Brown, E. Strain Life Technologies/ABI; Broad Institute Financial support: New York Sea Grant, USDA-NRI, USDA Special Research Grants, USDA Food safety Initiative, ILSI N.A., and NIH

44