Benchmark datasets for phylogenomic pipeline validation
|
|
- Andrew Hodge
- 5 years ago
- Views:
Transcription
1 Benchmark datasets for phylogenomic pipeline validation GenomeTrakr Meeting Sept Ruth E. Timme, PhD Research Microbiologist GenomeTrakr data coordinator
2 Validation for phylogenomics Phylogenomic pipeline = raw reads -> phylogeny Goal: validate results to ensure accuracy and reproducibility. Do not enforce standards to overall approach. 2
3 CFSAN s WGS workflow modules CFSAN Wet lab data analysis Culture handling DNA Extraction Library Preparation Sequencing GenomeTrakr QC pipeline Upload to NCBI clustering and phylogenetic inference Purity? Quality, Quantity Library Concentration Run metrics (Q30, CD, CPF) Coverage, Q scores, ID check, Contamination, WGS serotyping PD QC pipeline 6 modules: each is independently validated Each module has routine QC checks 3
4 Phylogenomic analysis within the Gen-FS community CFSAN Wet lab data analysis Culture handling DNA Extraction Library Preparation Sequencing GenomeTrakr QC pipeline Upload to NCBI clustering and phylogenetic inference clustering and phylogenetic inference Purity? Quality, Quantity Library Concentration Run metrics (Q30, CD, CPF) Coverage, Q scores, ID check, Contamination, WGS serotyping PD QC pipeline NCBI PD pipeline Maximum compatibility phylogeny CFSAN SNP pipeline Maximum likelihood phylogeny BioNumerics wgmlst Distance phylogeny Lyve-SET pipeline Maximum likelihood phylogeny 4
5 Compare pipeline results to truth 1. SNPs and other variants 2. tree topology 5
6 Empirical dataset: What is truth? well-studied outbreak concordant epi and WGS signal **validated SNPs Synthetic dataset known SNPs and tree topology 6
7 Benchmark datasets Dataset Organism # isoaltes Type of dataset Stone Fruit recall L. monocytogenes 31 Empirical Spicy Tuna outbreak S. enterica 23 Empirical Raw Milk Outbreak C. jejuni 22 Empirical Sprouts outbreak E. coli 10 Empirical Simulated outbreak S. enterica 23 Synthetic Experimental evo. E. coli 100 in vitro evolution Manuscript: R Timme et al Bacterial pathogen genome datasets for bioinformatics pipelines. PeerJ 5, e
8 grab downloading script at GitHub 8
9 Standard template for datasets header body Organism Salmonella enterica subspecies enterica Serovar Bareilly Outbreak 1203NYJAP-1 - Tuna Scrape Outbreak pmid tree source Ruth Timme datatype empirical suggested sha256sum sha256su sha256sum biosample_acc strain genbankassembly SRArun_acc outbreak datasetname Reference Assembly mread1 Read2 vouchercontact SAMN CFSAN CP006053, CP SRR outgroup 1203NYJAP-1 - Tuna Scrape Outbreak TRUE Dwayne Roberson, FDA SAMN CFSAN JMMH SRR outgroup 1203NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JMMM SRR outgroup 1203NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRDM SRR outgroup 1203NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCY SRR outgroup 1203NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JMMG SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCQ SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCO SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCN SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA checksums SAMN CFSAN JRCM SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCJ SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCI SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCG SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCD SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCB SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCA SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRBZ SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JMMF SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRBT SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRBL SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRBK SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRBJ SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRBI SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA 9
10 Permanent repository for data: NCBI sequence data, assemblies, biosamples opentreeoflife tree files Data Archiving tree.opentreeoflife.org/curator/study/edit/ot_
11 Working with the Datasets GenFSgopher.pl -o outdir spreadsheet.dataset.tsv Fastq files, fasta files, newick tree file Perform your own clustering pipeline(s) (FDA: SNP pipeline, CDC: LyveSet, NCBI: Pathogen Detection, ) Compare results! 11
12 TreeToReads: Simulated data pipeline Collaboration with Emily Jane McTavish, UC Merced Download here: McTavish, E. J., Pettengill, J., Davis, S., Rand, H., Strain, E., Allard, M., & Timme, R. E. (2017). TreeToReads - a pipeline for simulating raw reads from phylogenies. BMC Bioinformatics, 18(1),
13 Acknowledgements Gen-FS WGS Standards and Analysis workgroup (CDC/FDA/NCBI/FSIS) FDA: Ruth Timme, Hugh Rand, Steven Davis CDC: Lee S. Katz, Eija Trees, Heather A. Carleton NCBI: Richa Agarwala, Martin Shumway, Bill Klimke FSIS: Mustafa Simmons, Glenn Tillman, Philip Bronstein, Stephanie Defibaugh-Chávez Global Microbial Identifier WG3 Other contributors: Errol Strain Darlene Wagner Cheryl Tarr Maria Hoffmann Maria Sanchez-Leon 13
14
Utilization of NCBI Pathogen Detection Tool in USDA FSIS
Utilization of NCBI Pathogen Detection Tool in USDA FSIS Glenn Tillman, Ph.D. Branch Chief Microbiology: Characterization Branch FSIS Office of Public Health and Science Glenn.tillman@fsis.usda.gov 1 Background
More informationNew York State Health Department's experience with implementing Whole Genome Cluster Analysis for Salmonella outbreak investigations
New York State Health Department's experience with implementing Whole Genome Cluster Analysis for Salmonella outbreak investigations William Wolfgang Wadsworth Center NYSDOH InForm 2013 11/20/13 Current
More informationWGS Works! Shared Mission Different Roles APPLICATIONS SEQUENCING (WGS) Non-regulatory. Regulatory CDC. FDA and USDA. Peter Gerner-Smidt, MD ScD
PUBLIC HEALTH FOOD SAFETY APPLICATIONS FOR WHOLE GENOME SEQUENCING (WGS) Peter Gerner-Smidt, MD ScD Chief, Enteric Diseases Laboratory Branch 4 th Asia-Pacific International Food Safety Conference, Penang,
More informationHow Whole-Genome Sequencing Impacts Outbreak Investigations A Public Health Perspective
How Whole-Genome Sequencing Impacts Outbreak Investigations A Public Health Perspective Anna Carlson, PhD Nebraska Department of Health and Human Services Foodborne Disease Epidemiology Surveillance Coordinator
More informationIs Whole Genome Sequencing Really Replacing Traditional Microbiology?
Is Whole Genome Sequencing Really Replacing Traditional Microbiology? Peter Gerner-Smidt, MD, DSc Enteric Diseases Laboratory Branch InFORM II Phoenix, AZ, 18 November 2015 National Center for Emerging
More informationGenomeTrakr database: WGS network for foodborne pathogen traceback
GenomeTrakr database: WGS network for foodborne pathogen traceback Conference for Food Protection WGS workshop April 16, 2016 Ruth E. Timme, PhD Research Microbiologist GenomeTrakr data manager GenomeTrakr
More informationSTEC Whole Genome Sequencing Project
STEC Whole Genome Sequencing Project Eija Trees, PhD, DVM Chief, PulseNet Next Generation Subtyping Methods Unit 16 th Annual PulseNet Update Meeting August 29 th, 2012 National Center for Emerging and
More informationVibrio outbreak and surveillance: Maryland's collaborative approach
Vibrio outbreak and surveillance: Maryland's collaborative approach Catey Dominguez, Ph.D Developmental Scientist Maryland Department of Health Core Sequencing James Pettengill PhD Biostatistics and Bioinformatics
More informationOutbreak Investigations and Whole Genome Sequencing
Outbreak Investigations and Whole Genome Sequencing Adiam Tesfai, PHD FDA CFSAN Coordinated Outbreak Response and Evaluation GenomeTrakr Meeting September 7,018 Outline Role of FDA in Foodborne Outbreak
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationWhole genome sequencing
Downloaded from orbit.dtu.dk on: Dec 20, 2017 Whole genome sequencing Torpdahl, Mia; Löfström, Charlotta; Møller Nielsen, Eva Published in: Publication date: 2014 Document Version Publisher's PDF, also
More informationWelcome to the PulseNet/OutbreakNet West Coast Regional Meeting
Welcome to the PulseNet/OutbreakNet West Coast Regional Meeting February 5-7, 2019 Catamaran Hotel San Diego, CA 7:00 am 8:00 am Registration Tuesday, February 5, 2019 Joint Session 8:00 am - 8:30 am Welcome
More informationWelcome to the PulseNet/OutbreakNet Central Regional Meeting
Welcome to the PulseNet/OutbreakNet Central Regional Meeting March 6-8, 2019 Doubletree Hotel Downtown Omaha, NE 7:00 am 8:00 am Registration Wednesday, March 6, 2019 Joint Session 8:00 am - 8:30 am Welcome
More informationTransitioning Public Health Microbiology to Whole Genome Sequencing: Experiences and Plans for Bacterial Foodborne Pathogens
Transitioning Public Health Microbiology to Whole Genome Sequencing: Experiences and Plans for Bacterial Foodborne Pathogens Peter Gerner-Smidt, MD ScD, Chief Enteric Diseases Laboratory Branch 2015 APHL
More informationListeria whole-genome-sequencing EFSA Project. Anses Statens Serum Institut Public Health England University of Aberdeen
Listeria whole-genome-sequencing EFSA Project Anses Statens Serum Institut Public Health England University of Aberdeen Closing gaps for performing a risk assessment on Listeria monocytogenes in ready-to-eat
More informationWelcome to the PulseNet/OutbreakNet East Coast Regional Meeting
Welcome to the PulseNet/OutbreakNet East Coast Regional Meeting January 15-17, 2019 Embassy Suites Tampa-USF Hotel Tampa, FL 7:00 am 8:00 am Registration Tuesday, January 15, 2019 Joint Session 8:00 am
More informationRetrospective Outbreak Investigations Initiated by Product or Environmental Sampling. LCDR Kari Irvin November 19, InFORM
Retrospective Outbreak Investigations Initiated by Product or Environmental Sampling LCDR Kari Irvin November 19, 2015 2015 InFORM 1 Traditional VS Retrospective Outbreak Investigations Investigation begins
More informationPrinciples of phylogenetic analysis
Principles of phylogenetic analysis Arne Holst-Jensen, NVI, Norway. Fusarium course, Ås, Norway, June 22 nd 2008 Distance based methods Compare C OTUs and characters X A + D = Pairwise: A and B; X characters
More informationGenomic Epidemiology of Salmonella enterica Serotype Enteritidis based on Population Structure of Prevalent Lineages
Article DOI: http://dx.doi.org/10.3201/eid2009.131095 Genomic Epidemiology of Salmonella enterica Serotype Enteritidis based on Population Structure of Prevalent Lineages Technical Appendix Technical Appendix
More informationCDC s Advanced Molecular Detection (AMD) Program and Public Health
CDC s Advanced Molecular Detection (AMD) Program and Public Health Scott Sammons Technology Officer Office of Advanced Molecular Detection National Center for Emerging and Zoonotic Infectious Diseases
More informationthe Future Hold? May 30, 2018
Food Safety and High-Throughput Sequencing What does the Future Hold? Government Agencies Institute for Food Safety and Health May 30, 2018 Robert Tauxe, MD, MPH Director Division of Foodborne, Waterborne
More informationClostridium perfringens Whole Genome Sequencing improves outbreak source attribution
Clostridium perfringens Whole Genome Sequencing improves outbreak source attribution A case for including C. perfringens in the GenomeTrakr database GenomeTrakr meeting 9/28/18 William Wolfgang, PhD Wadsworth
More informationExploring HIV Evolution: An Opportunity for Research Sam Donovan and Anton E. Weisstein
Microbes Count! 137 Video IV: Reading the Code of Life Human Immunodeficiency Virus (HIV), like other retroviruses, has a much higher mutation rate than is typically found in organisms that do not go through
More informationUnderstanding the Public Health Significance of Salmonella. Betsy Booren, Ph.D. Director, Scientific Affairs
Understanding the Public Health Significance of Salmonella Betsy Booren, Ph.D. Director, Scientific Affairs June 18, 2012 2011 Salmonella Outbreaks Ground Beef Salmonella Typhimurium Kosher Broiled Chicken
More informationNJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees Supplementary Materials
NJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees Supplementary Materials Erin K. Molloy 1[ 1 5553 3312] and Tandy Warnow 1[ 1 7717 3514] Department
More informationKatrine G. Joensen. Whole genome sequencing (WGS) surveillance of VTEC and Shigella
Whole genome sequencing (WGS) surveillance of VTEC and Shigella Katrine G. Joensen & Flemming Scheutz WHO Collaborating Centre for Reference and Research on Escherichia and Klebsiella Foodborne Infections
More informationPROTOCOL FOR INFLUENZA A VIRUS GLOBAL SWINE H1 CLADE CLASSIFICATION
PROTOCOL FOR INFLUENZA A VIRUS GLOBAL SWINE H1 CLADE CLASSIFICATION January 23, 2017 1. Background Swine H1 viruses have diversified into three major genetic lineages over time. Recently, Anderson et al.
More informationa. From the grey navigation bar, mouse over Analyze & Visualize and click Annotate Nucleotide Sequences.
Section D. Custom sequence annotation After this exercise you should be able to use the annotation pipelines provided by the Influenza Research Database (IRD) and Virus Pathogen Resource (ViPR) to annotate
More information2. To develop cost-effective sampling strategies that could be used by the pistachio industry to evaluate the microbial status of raw pistachios.
CPS 2011 RFP FINAL PROJECT REPORT Project Title Project Period January 1, 2013 December 31, 2013 Principal Investigator Linda J. Harris Department of Food Science and Technology University of California,
More informationAn Introduction CORE Network
An Introduction CORE Network FDA s New Approach to Managing Foodborne Outbreak Surveillance, Response and Post-Response Efforts Presented by Carla Tuite, LCDR, USPHS Response Team Leader CORE August 30,
More informationStarting from the bench Prevention and control of foodborne and zoonotic diseases
Starting from the bench Prevention and control of foodborne and zoonotic diseases Martin Wiedmann Department of Food Science Cornell University, Ithaca, NY E-mail: mw16@cornell.edu Yrjo Overview Foodborne
More informationDNA Sequence Bioinformatics Analysis with the Galaxy Platform
DNA Sequence Bioinformatics Analysis with the Galaxy Platform University of São Paulo, Brazil 28 July - 1 August 2014 Dave Clements Johns Hopkins University Robson Francisco de Souza University of São
More informationProgress Report. Mississippi Center for Food Safety and Post-Harvest Technology
Progress Report Mississippi Center for Food Safety and Post-Harvest Technology Title: Inactivation of Norovirus (MNV-1) on Fresh Oysters Meat, Tuna Salad and Salmon Sushi Using X-Ray Irradiation Award
More informationEpiSeq : A Next-Generation Sequencing Service for Infectious Disease Outbreak Management
EpiSeq : A Next-Generation Sequencing Service for Infectious Disease Outbreak Management CPTR 2016 Workshop Washington, DC M.Rodrigue April 7th, 2016 1 Healthcare Associated Infection A Global Burden KNOWING
More informationListeria monocytogenes Outbreak Linked to Pasteurized Ice Cream Product Washington, 2014
Listeria monocytogenes Outbreak Linked to Pasteurized Ice Cream Product Washington, 2014 Jenny Lloyd, MS Public Health - Seattle & King County, Seattle, WA Beth Melius, RN, MN, MPH Washington State Department
More informationRetrospective Investigations
Retrospective Investigations Jessie Marus, MPH CDC Outbreak Response and Prevention Branch What are they? Why investigate? How do we do it? What is a Retrospective Outbreak? Food or Environmental Isolate
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationOpportunities to Collect Data and Improve Lm Risk Assessments
Opportunities to Collect Data and Improve Lm Risk Assessments Janell R. Kause Scientific Advisor for Risk Assessment Food Safety and Inspection Service, USDA 2 Presentation Outline Past Risk Estimates
More informationSequencing as a Typing Tool
Sequencing as a Typing Tool 6/4/2018 RCPA Workshop Ms Leah Roberts PhD candidate University of Queensland Outline Sequencing in response to outbreaks Sequencing to characterise complex regions Sequencing
More informationP. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
More informationInvestigating Legionella: PCR Screening and Whole-Genome Sequencing
Investigating Legionella: PCR Screening and Whole-Genome Sequencing June 13, 2017 Kimberlee Musser, PhD Chief, Bacterial Diseases Wadsworth Center 1976 Philadelphia Legionnaires' disease outbreak 2 July
More informationThose Pathogens, What You Should Know
Those Pathogens, What You Should Know Ted F. Beals, MS, MD Short 1 We are at war over our Food Most of us here are convinced that what we eat, and why we choose is our responsibility, not the responsibility
More informationCONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University of Cambridge, Clara East, The Old Schools, Cambridge CB2 1TN
AWARD NUMBER: W81XWH-14-1-0110 TITLE: A Molecular Framework for Understanding DCIS PRINCIPAL INVESTIGATOR: Gregory Hannon CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University
More informationSurveillance and outbreak investigation of Shiga toxin-producing Escherichia coli using whole genome sequencing- time for a change!
Surveillance and outbreak investigation of Shiga toxin-producing Escherichia coli using whole genome sequencing- time for a change! Dr Marie Anne Chattaway Deputy Head STEC Laboratory Gastrointestinal
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationData mining with Ensembl Biomart. Stéphanie Le Gras
Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:
More informationA Quick-Start Guide for rseqdiff
A Quick-Start Guide for rseqdiff Yang Shi (email: shyboy@umich.edu) and Hui Jiang (email: jianghui@umich.edu) 09/05/2013 Introduction rseqdiff is an R package that can detect differential gene and isoform
More informationExploring the evolution of MRSA with Whole Genome Sequencing
Exploring the evolution of MRSA with Whole Genome Sequencing PhD student: Zheng WANG Supervisor: Professor Margaret IP Department of Microbiology, CUHK Joint Graduate Seminar Department of Microbiology,
More informationKern Regional Crime Laboratory Laboratory Director: Dr. Kevin W. P. Miller
Kern Regional Crime Laboratory Laboratory Director: Dr. Kevin W. P. Miller TRUEALLELE WORK AND WORKFLOW: KERN COUNTY S FIRST CASES APRIL 23, 2014 Presenters! Kelly Woolard! Garett Sugimoto! Jerry Garza
More informationSurveillance and outbreak response are major components
CHAPTER Performance Indicators for Foodborne Disease Programs Surveillance and outbreak response are major components of states foodborne investigation capacity and are essential for preventing and controlling
More informationUSING WGS FOR SURVEILLANCE, CLUSTER DETECTION, AND EPI INVESTIGATIONS IN WASHINGTON Washington State Department of Health
USING WGS FOR SURVEILLANCE, CLUSTER DETECTION, AND EPI INVESTIGATIONS IN WASHINGTON Washington State Department of Health Washington State Local Health Jurisdictions *Agency leader is both director and
More informationMain conclusions and options for response
RAPID RISK ASSESSMENT Multi-country outbreak of Listeria monocytogenes PCR serogroup IVb, MLST ST6 6 December 2017 Main conclusions and options for response A multi-country outbreak of Listeria monocytogenes
More informationAbstract. Laurel S. Burall*, Christopher J. Grim, Mark K. Mammel, Atin R. Datta* RESEARCH ARTICLE
RESEARCH ARTICLE Whole Genome Sequence Analysis Using JSpecies Tool Establishes Clonal Relationships between Listeria monocytogenes Strains from Epidemiologically Unrelated Listeriosis Outbreaks Laurel
More informationInfectious Diseases New York State Department of Health, Division of Epidemiology, Bureau of Communicable Disease Control
Infectious Diseases New York State Department of Health, Division of Epidemiology, Bureau of Communicable Disease Control Albany, New York Assignment Description The fellow s assignment will be in the
More informationThe UK s National Collection of Type Cultures: Answers to 21 st century public health questions
The UK s National Collection of Type Cultures: Answers to 21 st century public health questions Julie E. Russell Head of Culture Collections 28 th September 2016 Public Health England (PHE) Executive agency
More informationCountry Ham vs. Deli Ham vs. Country Ham Sliced
Virginia Katherine G McCombs, MPH Foodborne Disease Epidemiology Program Coordinator Virginia Department of Health And Lauren Turner, PhD Foodborne and Advanced Pathogen Characterization Lead Scientist
More informationAPril PUlseNet
Issues in Brief Pulsenet: A Critical Food Safety Surveillance System Association of Public Health Laboratories APril 2010 PUlseNet A Critical Food Safety Surveillance System Public health laboratorians
More informationSection B. Comparative Genomics Analysis of Influenza H5N2 Viruses. Objective
Section B. Comparative Genomics Analysis of Influenza H5N2 Viruses Objective Upon completion of this exercise, you will be able to use the Influenza Research Database (IRD; http://www.fludb.org/) to: Search
More informationAssembling complete genomes for oral pathogens and methanogens. Mia Sales, Undergraduate Research Assistant
Assembling complete genomes for oral pathogens and methanogens Mia Sales, Undergraduate Research Assistant Jensen Lab Department of Bioengineering and Carl R. Woese Institute for Genomic Biology University
More informationSVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN
SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN Structural variation (SV) Variants larger than 50bps Affect
More informationCOMPASS-TB Report Design Study: First Online Survey
COMPASS-TB Report Design Study: First Online Survey Geoff McKee, Ana Crisan, Jennifer Gardy, Tamara Mu nzner Summary Most respondents (15/17) from UK Majority (10/17) involved in clinical management, 8/17
More informationImproving surveillance and early detection of outbreaks. Frank M. Aarestrup
Improving surveillance and early detection of outbreaks Frank M. Aarestrup www.compare-europe.eu www.genomicepidemiology.org INFECTIOUS DISEASES Direct cause of 22% of all global deaths (15 million), huge
More informationFondation Merieux J Craig Venter Institute Bioinformatics Workshop. December 5 8, 2017
Fondation Merieux J Craig Venter Institute Bioinformatics Workshop December 5 8, 2017 Module 5: Comparative Genomics Analysis Outline Definition of comparative genomics Applications in studying human pathogens
More informationComparative genomics of E. coli and Shigella:
Comparative genomics of E. coli and Shigella: Identification and characterization of pathogenic variants based on whole genome sequence analysis David A. Rasko PhD. University of Maryland School of Medicine
More informationWhat do we know about potential waterborne pathogens in livestock and water in NZ?
What do we know about potential waterborne pathogens in livestock and water in NZ? Nigel French Drinking Water Workshop, Hamilton, 19 th Sept 2017 Outline Waterborne pathogens: Campylobacter, Giardia,
More informationModule 4: Estimated Annual U.S. Foodborne Disease Burden, 2011 Foodborne Illnesses 48 million Hospitalizations 128,000 Deaths 3,000
Module 4: Epidemiology Investigation Epidemiology Division Analysis and Reporting Branch 2 Module Learning Objectives Develop a case definition Explain an epidemic curve Develop an initial hypothesis List
More informationObstacles and challenges in the analysis of microrna sequencing data
Obstacles and challenges in the analysis of microrna sequencing data (mirna-seq) David Humphreys Genomics core Dr Victor Chang AC 1936-1991, Pioneering Cardiothoracic Surgeon and Humanitarian The ABCs
More informationIs it Method Verification or Validation, or Just Semantics? Michael Brodsky Brodsky Consultants
Is it Method Verification or Validation, or Just Semantics? Michael Brodsky Brodsky Consultants mhbrodsky@rogers.com Objectives To define and differentiate method validation from verification Consider
More informationFOODBORNE DISEASES. Why learning foodborne diseases is very important? What do you know about foodborne diseases? What do you want to know more?
FOODBORNE DISEASES FOODBORNE DISEASES Why learning foodborne diseases is very important? What do you know about foodborne diseases? What do you want to know more? COURSES 1) Causes of foodborne diseases
More informationFoodborne Illness and Outbreak Surveillance in the USA. Alison Samuel, Naghmeh Parto, Emily Peterson
Foodborne Illness and Outbreak Surveillance in the USA Alison Samuel, Naghmeh Parto, Emily Peterson 1 Context Where is the information coming from: Attended the CDC/ Emory University; Environmental Microbiology:
More informationACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole
More informationFoodborne diseases: an ongoing global challenge
Foodborne diseases: an ongoing global challenge Arie Havelaar GLOBALG.A.P. Summit 2016 Amsterdam, September 27-28, 2016 Outline WHO estimates of the global burden of foodborne disease Regional differences
More informationMultistate Foodborne Outbreaks: Investigation and Communication Process
National Center for Emerging and Zoonotic Infectious Diseases Multistate Foodborne Outbreaks: Investigation and Communication Process Matthew Wise, MPH, PhD Deputy Branch Chief for Outbreak Response Laura
More informationEscherichia coli diagnostics
Escherichia coli diagnostics Workshop on Whole Genome Sequencing and Analysis, 19-21 Mar. 2018 Learning objective: After this lecture and exercise, you should be able to describe how the CGE methods for
More informationPulseNet on the High Wire
PulseNet on the High Wire 16 th Annual PulseNet Update Meeting 8 th Annual OutbreakNet Meeting Atlanta, Georgia Efrain M. Ribot, Ph.D. PulseNet USA Centers for Disease Control and Prevention National Center
More informationSequencing of 58 STRs using the Illumina ForenSeq TM workflow and analysis of the data with the STRinNGS v.1.0 software
Sequencing of 58 STRs using the Illumina ForenSeq TM workflow and analysis of the data with the STRinNGS v.1.0 software C. Hussing, C. Huber, R. Bytyci, H.S. Mogensen, C. Børsting, and N. Morling Section
More informationFood Safety Produce Rules How Preventive Controls work From Farm to Fork
Food Safety Produce Rules How Preventive Controls work From Farm to Fork 1 9 th Dubai International Food Safety Conference Linda J. Harris, Ph.D. Department of Food Science and Technology, University of
More informationUser Guide. Association analysis. Input
User Guide TFEA.ChIP is a tool to estimate transcription factor enrichment in a set of differentially expressed genes using data from ChIP-Seq experiments performed in different tissues and conditions.
More informationModule 3. Genomic data and annotations in public databases Exercises Custom sequence annotation
Module 3. Genomic data and annotations in public databases Exercises Custom sequence annotation Objectives Upon completion of this exercise, you will be able to use the annotation pipelines provided by
More informationOVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES
OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES EVERY STEP OF THE WAY 1 EVERY STEP OF THE WAY MICROBIAL IDENTIFICATION METHODS DNA RNA Genotypic Sequencing of ribosomal RNA regions of bacteria
More informationIMPLEMENTATION OF GHOST FOR HAV OUTBREAK DETECTION
National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention IMPLEMENTATION OF GHOST FOR HAV OUTBREAK DETECTION Sumathi Ramachandran,MS,MPH,PHD Molecular Epidemiology and Bioinformatics Team Division
More informationINVESTIGATION OF A MULTISTATE OUTBREAK OF SALMONELLA BAREILLY AND SALMONELLA NCHANGA
INVESTIGATION OF A MULTISTATE OUTBREAK OF SALMONELLA BAREILLY AND SALMONELLA NCHANGA Kristen Soto, MPH (Kristen Desy 05) Connecticut Department of Public Health Epidemiology Program September 25, 2013
More informationFood Microbiology 101
Food Microbiology 101 Nina G. Parkinson NGP Consulting November 6, 2018 Food Safety and Sanitation Conference Summary Microbiological contamination of food Routes of contamination by pathogens Overview
More informationBelow, we included the point-to-point response to the comments of both reviewers.
To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively
More informationAppendix 81. From OPENFLU to OPENFMD. Open Session of the EuFMD: 2012, Jerez de la Frontera, Spain 1. Conclusions and recommendations
From OPENFLU to OPENFMD a resource for automatic and curated nomenclature and tools for the FMD community Filip Claes, Philippe Le Mercier, Dmitry Kuznetsov, Robin Liechti, Anne Gleizes, Ioannis Xenarios,
More information33. I will recommend this primer to my colleagues. A. Strongly Agree D. Disagree B. Agree E. Strongly Disagree C. Neither agree nor disagree
27. The primer increased my ability to recognize foodborne illnesses and increased the likelihood that I will consider such illnesses in my patients. 28. The primer increased my knowledge and skills in
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationOutbreak Alert! Trends in Foodborne Illness Outbreaks in the United States ( )
5 th MEETING PAN AMERICAN COMMISSION ON FOOD SAFETY (COPAIA) Rio de Janeiro, Brazil, June 10, 2008 Provisional Agenda Item 5 COPAIA5/5 (Eng.) May, 28 th 2008 ORIGINAL: ENGLISH Outbreak Alert! Trends in
More informationUsing Phylogenetic Structure to Assess the Evolutionary Ecology of Microbiota! TJS! iseem Call! April 2015!
Using Phylogenetic Structure to Assess the Evolutionary Ecology of Microbiota! TJS! iseem Call! April 2015! How are Microbes Distributed In Nature?! A major question in microbial ecology! Used to assess
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationPredicted Resistance at CDC
National Center for Emerging and Zoonotic Infectious Diseases Predicted Resistance at CDC Ian Plumb, MBBS MSc Medical Epidemiologist, NARMS Team, EDEB, DFWED PulseNet & OutbreakNet Regional Meeting, East
More informationE. coli O157:H7 Outbreak Associated with Consumption of Unpasteurized Milk, Kentucky, 2014
E. coli O157:H7 Outbreak Associated with Consumption of Unpasteurized Milk, Kentucky, 2014 Association of Food and Drug Officials of the Southern States Fall Educational Conference September 15, 2015 Speakers
More informationSalmonella Enteritidis: Surveillance Data and Policy Implications
Salmonella Enteritidis: Surveillance Data and Policy Implications Alejandro Pérez, MPH Enteric Diseases Epidemiology Branch Division of Foodborne, Bacterial and Mycotic Diseases National Center for Zoonotic,
More informationThis whitepaper will cover the suggested methodology to be employed when developing a PCP plan. This includes how to develop your plan in accordance
This whitepaper will cover the suggested methodology to be employed when developing a PCP plan. This includes how to develop your plan in accordance with FSMA s Final Rule for Preventive Controls for Human
More informationDETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester
DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING John Archer Faculty of Life Sciences University of Manchester HIV Dynamics and Evolution, 2008, Santa Fe, New Mexico. Overview
More informationGenomic epidemiology of Gram-negative pathogens: from Acinetobacter to E. coli. Professor Mark Pallen, University of Birmingham
Genomic epidemiology of Gram-negative pathogens: from Acinetobacter to E. coli Professor Mark Pallen, University of Birmingham The state we are in: diagnostic microbiology 21st Century problem, but 19th
More informationIllness Outbreaks Linked to Nonpasteurized (Raw) Milk
National Center for Emerging and Zoonotic Infectious Diseases Illness Outbreaks Linked to Nonpasteurized (Raw) Milk Megin Nichols, DVM, MPH, DACVPM Enteric Zoonoses Activity, Outbreak Response and Prevention
More informationE. Coli O157:H7 and Spinach Jeff Farrar, DVM, PhD, MPH Branch Chief Food and Drug Branch California Department of Health Services
E. Coli O157:H7 and Spinach 2006 Jeff Farrar, DVM, PhD, MPH Branch Chief Food and Drug Branch California Department of Health Services Number of cases of E. coli O157:H7 reported in California - 2000-2005
More informationFood Safety Performance Standards: an Epidemiologic Perspective
Food Safety Performance Standards: an Epidemiologic Perspective Institute t of Medicine i Food dforum Meeting Rajal Mody, MD MPH LCDR US Public Health Service Enteric Diseases Epidemiology Branch Centers
More informationTranscriptome Analysis
Transcriptome Analysis Data Preprocessing Sample Preparation Illumina Sequencing Demultiplexing Raw FastQ Reference Genome (fasta) Reference Annotation (GTF) Reference Genome Analysis Tophat Accepted hits
More information