Benchmark datasets for phylogenomic pipeline validation

Size: px
Start display at page:

Download "Benchmark datasets for phylogenomic pipeline validation"

Transcription

1 Benchmark datasets for phylogenomic pipeline validation GenomeTrakr Meeting Sept Ruth E. Timme, PhD Research Microbiologist GenomeTrakr data coordinator

2 Validation for phylogenomics Phylogenomic pipeline = raw reads -> phylogeny Goal: validate results to ensure accuracy and reproducibility. Do not enforce standards to overall approach. 2

3 CFSAN s WGS workflow modules CFSAN Wet lab data analysis Culture handling DNA Extraction Library Preparation Sequencing GenomeTrakr QC pipeline Upload to NCBI clustering and phylogenetic inference Purity? Quality, Quantity Library Concentration Run metrics (Q30, CD, CPF) Coverage, Q scores, ID check, Contamination, WGS serotyping PD QC pipeline 6 modules: each is independently validated Each module has routine QC checks 3

4 Phylogenomic analysis within the Gen-FS community CFSAN Wet lab data analysis Culture handling DNA Extraction Library Preparation Sequencing GenomeTrakr QC pipeline Upload to NCBI clustering and phylogenetic inference clustering and phylogenetic inference Purity? Quality, Quantity Library Concentration Run metrics (Q30, CD, CPF) Coverage, Q scores, ID check, Contamination, WGS serotyping PD QC pipeline NCBI PD pipeline Maximum compatibility phylogeny CFSAN SNP pipeline Maximum likelihood phylogeny BioNumerics wgmlst Distance phylogeny Lyve-SET pipeline Maximum likelihood phylogeny 4

5 Compare pipeline results to truth 1. SNPs and other variants 2. tree topology 5

6 Empirical dataset: What is truth? well-studied outbreak concordant epi and WGS signal **validated SNPs Synthetic dataset known SNPs and tree topology 6

7 Benchmark datasets Dataset Organism # isoaltes Type of dataset Stone Fruit recall L. monocytogenes 31 Empirical Spicy Tuna outbreak S. enterica 23 Empirical Raw Milk Outbreak C. jejuni 22 Empirical Sprouts outbreak E. coli 10 Empirical Simulated outbreak S. enterica 23 Synthetic Experimental evo. E. coli 100 in vitro evolution Manuscript: R Timme et al Bacterial pathogen genome datasets for bioinformatics pipelines. PeerJ 5, e

8 grab downloading script at GitHub 8

9 Standard template for datasets header body Organism Salmonella enterica subspecies enterica Serovar Bareilly Outbreak 1203NYJAP-1 - Tuna Scrape Outbreak pmid tree source Ruth Timme datatype empirical suggested sha256sum sha256su sha256sum biosample_acc strain genbankassembly SRArun_acc outbreak datasetname Reference Assembly mread1 Read2 vouchercontact SAMN CFSAN CP006053, CP SRR outgroup 1203NYJAP-1 - Tuna Scrape Outbreak TRUE Dwayne Roberson, FDA SAMN CFSAN JMMH SRR outgroup 1203NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JMMM SRR outgroup 1203NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRDM SRR outgroup 1203NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCY SRR outgroup 1203NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JMMG SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCQ SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCO SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCN SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA checksums SAMN CFSAN JRCM SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCJ SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCI SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCG SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCD SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCB SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRCA SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRBZ SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JMMF SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRBT SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRBL SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRBK SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRBJ SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA SAMN CFSAN JRBI SRR NYJAP NYJAP-1 - Tuna Scrape Outbreak FALSE Dwayne Roberson, FDA 9

10 Permanent repository for data: NCBI sequence data, assemblies, biosamples opentreeoflife tree files Data Archiving tree.opentreeoflife.org/curator/study/edit/ot_

11 Working with the Datasets GenFSgopher.pl -o outdir spreadsheet.dataset.tsv Fastq files, fasta files, newick tree file Perform your own clustering pipeline(s) (FDA: SNP pipeline, CDC: LyveSet, NCBI: Pathogen Detection, ) Compare results! 11

12 TreeToReads: Simulated data pipeline Collaboration with Emily Jane McTavish, UC Merced Download here: McTavish, E. J., Pettengill, J., Davis, S., Rand, H., Strain, E., Allard, M., & Timme, R. E. (2017). TreeToReads - a pipeline for simulating raw reads from phylogenies. BMC Bioinformatics, 18(1),

13 Acknowledgements Gen-FS WGS Standards and Analysis workgroup (CDC/FDA/NCBI/FSIS) FDA: Ruth Timme, Hugh Rand, Steven Davis CDC: Lee S. Katz, Eija Trees, Heather A. Carleton NCBI: Richa Agarwala, Martin Shumway, Bill Klimke FSIS: Mustafa Simmons, Glenn Tillman, Philip Bronstein, Stephanie Defibaugh-Chávez Global Microbial Identifier WG3 Other contributors: Errol Strain Darlene Wagner Cheryl Tarr Maria Hoffmann Maria Sanchez-Leon 13

14

Utilization of NCBI Pathogen Detection Tool in USDA FSIS

Utilization of NCBI Pathogen Detection Tool in USDA FSIS Utilization of NCBI Pathogen Detection Tool in USDA FSIS Glenn Tillman, Ph.D. Branch Chief Microbiology: Characterization Branch FSIS Office of Public Health and Science Glenn.tillman@fsis.usda.gov 1 Background

More information

New York State Health Department's experience with implementing Whole Genome Cluster Analysis for Salmonella outbreak investigations

New York State Health Department's experience with implementing Whole Genome Cluster Analysis for Salmonella outbreak investigations New York State Health Department's experience with implementing Whole Genome Cluster Analysis for Salmonella outbreak investigations William Wolfgang Wadsworth Center NYSDOH InForm 2013 11/20/13 Current

More information

WGS Works! Shared Mission Different Roles APPLICATIONS SEQUENCING (WGS) Non-regulatory. Regulatory CDC. FDA and USDA. Peter Gerner-Smidt, MD ScD

WGS Works! Shared Mission Different Roles APPLICATIONS SEQUENCING (WGS) Non-regulatory. Regulatory CDC. FDA and USDA. Peter Gerner-Smidt, MD ScD PUBLIC HEALTH FOOD SAFETY APPLICATIONS FOR WHOLE GENOME SEQUENCING (WGS) Peter Gerner-Smidt, MD ScD Chief, Enteric Diseases Laboratory Branch 4 th Asia-Pacific International Food Safety Conference, Penang,

More information

How Whole-Genome Sequencing Impacts Outbreak Investigations A Public Health Perspective

How Whole-Genome Sequencing Impacts Outbreak Investigations A Public Health Perspective How Whole-Genome Sequencing Impacts Outbreak Investigations A Public Health Perspective Anna Carlson, PhD Nebraska Department of Health and Human Services Foodborne Disease Epidemiology Surveillance Coordinator

More information

Is Whole Genome Sequencing Really Replacing Traditional Microbiology?

Is Whole Genome Sequencing Really Replacing Traditional Microbiology? Is Whole Genome Sequencing Really Replacing Traditional Microbiology? Peter Gerner-Smidt, MD, DSc Enteric Diseases Laboratory Branch InFORM II Phoenix, AZ, 18 November 2015 National Center for Emerging

More information

GenomeTrakr database: WGS network for foodborne pathogen traceback

GenomeTrakr database: WGS network for foodborne pathogen traceback GenomeTrakr database: WGS network for foodborne pathogen traceback Conference for Food Protection WGS workshop April 16, 2016 Ruth E. Timme, PhD Research Microbiologist GenomeTrakr data manager GenomeTrakr

More information

STEC Whole Genome Sequencing Project

STEC Whole Genome Sequencing Project STEC Whole Genome Sequencing Project Eija Trees, PhD, DVM Chief, PulseNet Next Generation Subtyping Methods Unit 16 th Annual PulseNet Update Meeting August 29 th, 2012 National Center for Emerging and

More information

Vibrio outbreak and surveillance: Maryland's collaborative approach

Vibrio outbreak and surveillance: Maryland's collaborative approach Vibrio outbreak and surveillance: Maryland's collaborative approach Catey Dominguez, Ph.D Developmental Scientist Maryland Department of Health Core Sequencing James Pettengill PhD Biostatistics and Bioinformatics

More information

Outbreak Investigations and Whole Genome Sequencing

Outbreak Investigations and Whole Genome Sequencing Outbreak Investigations and Whole Genome Sequencing Adiam Tesfai, PHD FDA CFSAN Coordinated Outbreak Response and Evaluation GenomeTrakr Meeting September 7,018 Outline Role of FDA in Foodborne Outbreak

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

Whole genome sequencing

Whole genome sequencing Downloaded from orbit.dtu.dk on: Dec 20, 2017 Whole genome sequencing Torpdahl, Mia; Löfström, Charlotta; Møller Nielsen, Eva Published in: Publication date: 2014 Document Version Publisher's PDF, also

More information

Welcome to the PulseNet/OutbreakNet West Coast Regional Meeting

Welcome to the PulseNet/OutbreakNet West Coast Regional Meeting Welcome to the PulseNet/OutbreakNet West Coast Regional Meeting February 5-7, 2019 Catamaran Hotel San Diego, CA 7:00 am 8:00 am Registration Tuesday, February 5, 2019 Joint Session 8:00 am - 8:30 am Welcome

More information

Welcome to the PulseNet/OutbreakNet Central Regional Meeting

Welcome to the PulseNet/OutbreakNet Central Regional Meeting Welcome to the PulseNet/OutbreakNet Central Regional Meeting March 6-8, 2019 Doubletree Hotel Downtown Omaha, NE 7:00 am 8:00 am Registration Wednesday, March 6, 2019 Joint Session 8:00 am - 8:30 am Welcome

More information

Transitioning Public Health Microbiology to Whole Genome Sequencing: Experiences and Plans for Bacterial Foodborne Pathogens

Transitioning Public Health Microbiology to Whole Genome Sequencing: Experiences and Plans for Bacterial Foodborne Pathogens Transitioning Public Health Microbiology to Whole Genome Sequencing: Experiences and Plans for Bacterial Foodborne Pathogens Peter Gerner-Smidt, MD ScD, Chief Enteric Diseases Laboratory Branch 2015 APHL

More information

Listeria whole-genome-sequencing EFSA Project. Anses Statens Serum Institut Public Health England University of Aberdeen

Listeria whole-genome-sequencing EFSA Project. Anses Statens Serum Institut Public Health England University of Aberdeen Listeria whole-genome-sequencing EFSA Project Anses Statens Serum Institut Public Health England University of Aberdeen Closing gaps for performing a risk assessment on Listeria monocytogenes in ready-to-eat

More information

Welcome to the PulseNet/OutbreakNet East Coast Regional Meeting

Welcome to the PulseNet/OutbreakNet East Coast Regional Meeting Welcome to the PulseNet/OutbreakNet East Coast Regional Meeting January 15-17, 2019 Embassy Suites Tampa-USF Hotel Tampa, FL 7:00 am 8:00 am Registration Tuesday, January 15, 2019 Joint Session 8:00 am

More information

Retrospective Outbreak Investigations Initiated by Product or Environmental Sampling. LCDR Kari Irvin November 19, InFORM

Retrospective Outbreak Investigations Initiated by Product or Environmental Sampling. LCDR Kari Irvin November 19, InFORM Retrospective Outbreak Investigations Initiated by Product or Environmental Sampling LCDR Kari Irvin November 19, 2015 2015 InFORM 1 Traditional VS Retrospective Outbreak Investigations Investigation begins

More information

Principles of phylogenetic analysis

Principles of phylogenetic analysis Principles of phylogenetic analysis Arne Holst-Jensen, NVI, Norway. Fusarium course, Ås, Norway, June 22 nd 2008 Distance based methods Compare C OTUs and characters X A + D = Pairwise: A and B; X characters

More information

Genomic Epidemiology of Salmonella enterica Serotype Enteritidis based on Population Structure of Prevalent Lineages

Genomic Epidemiology of Salmonella enterica Serotype Enteritidis based on Population Structure of Prevalent Lineages Article DOI: http://dx.doi.org/10.3201/eid2009.131095 Genomic Epidemiology of Salmonella enterica Serotype Enteritidis based on Population Structure of Prevalent Lineages Technical Appendix Technical Appendix

More information

CDC s Advanced Molecular Detection (AMD) Program and Public Health

CDC s Advanced Molecular Detection (AMD) Program and Public Health CDC s Advanced Molecular Detection (AMD) Program and Public Health Scott Sammons Technology Officer Office of Advanced Molecular Detection National Center for Emerging and Zoonotic Infectious Diseases

More information

the Future Hold? May 30, 2018

the Future Hold? May 30, 2018 Food Safety and High-Throughput Sequencing What does the Future Hold? Government Agencies Institute for Food Safety and Health May 30, 2018 Robert Tauxe, MD, MPH Director Division of Foodborne, Waterborne

More information

Clostridium perfringens Whole Genome Sequencing improves outbreak source attribution

Clostridium perfringens Whole Genome Sequencing improves outbreak source attribution Clostridium perfringens Whole Genome Sequencing improves outbreak source attribution A case for including C. perfringens in the GenomeTrakr database GenomeTrakr meeting 9/28/18 William Wolfgang, PhD Wadsworth

More information

Exploring HIV Evolution: An Opportunity for Research Sam Donovan and Anton E. Weisstein

Exploring HIV Evolution: An Opportunity for Research Sam Donovan and Anton E. Weisstein Microbes Count! 137 Video IV: Reading the Code of Life Human Immunodeficiency Virus (HIV), like other retroviruses, has a much higher mutation rate than is typically found in organisms that do not go through

More information

Understanding the Public Health Significance of Salmonella. Betsy Booren, Ph.D. Director, Scientific Affairs

Understanding the Public Health Significance of Salmonella. Betsy Booren, Ph.D. Director, Scientific Affairs Understanding the Public Health Significance of Salmonella Betsy Booren, Ph.D. Director, Scientific Affairs June 18, 2012 2011 Salmonella Outbreaks Ground Beef Salmonella Typhimurium Kosher Broiled Chicken

More information

NJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees Supplementary Materials

NJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees Supplementary Materials NJMerge: A generic technique for scaling phylogeny estimation methods and its application to species trees Supplementary Materials Erin K. Molloy 1[ 1 5553 3312] and Tandy Warnow 1[ 1 7717 3514] Department

More information

Katrine G. Joensen. Whole genome sequencing (WGS) surveillance of VTEC and Shigella

Katrine G. Joensen. Whole genome sequencing (WGS) surveillance of VTEC and Shigella Whole genome sequencing (WGS) surveillance of VTEC and Shigella Katrine G. Joensen & Flemming Scheutz WHO Collaborating Centre for Reference and Research on Escherichia and Klebsiella Foodborne Infections

More information

PROTOCOL FOR INFLUENZA A VIRUS GLOBAL SWINE H1 CLADE CLASSIFICATION

PROTOCOL FOR INFLUENZA A VIRUS GLOBAL SWINE H1 CLADE CLASSIFICATION PROTOCOL FOR INFLUENZA A VIRUS GLOBAL SWINE H1 CLADE CLASSIFICATION January 23, 2017 1. Background Swine H1 viruses have diversified into three major genetic lineages over time. Recently, Anderson et al.

More information

a. From the grey navigation bar, mouse over Analyze & Visualize and click Annotate Nucleotide Sequences.

a. From the grey navigation bar, mouse over Analyze & Visualize and click Annotate Nucleotide Sequences. Section D. Custom sequence annotation After this exercise you should be able to use the annotation pipelines provided by the Influenza Research Database (IRD) and Virus Pathogen Resource (ViPR) to annotate

More information

2. To develop cost-effective sampling strategies that could be used by the pistachio industry to evaluate the microbial status of raw pistachios.

2. To develop cost-effective sampling strategies that could be used by the pistachio industry to evaluate the microbial status of raw pistachios. CPS 2011 RFP FINAL PROJECT REPORT Project Title Project Period January 1, 2013 December 31, 2013 Principal Investigator Linda J. Harris Department of Food Science and Technology University of California,

More information

An Introduction CORE Network

An Introduction CORE Network An Introduction CORE Network FDA s New Approach to Managing Foodborne Outbreak Surveillance, Response and Post-Response Efforts Presented by Carla Tuite, LCDR, USPHS Response Team Leader CORE August 30,

More information

Starting from the bench Prevention and control of foodborne and zoonotic diseases

Starting from the bench Prevention and control of foodborne and zoonotic diseases Starting from the bench Prevention and control of foodborne and zoonotic diseases Martin Wiedmann Department of Food Science Cornell University, Ithaca, NY E-mail: mw16@cornell.edu Yrjo Overview Foodborne

More information

DNA Sequence Bioinformatics Analysis with the Galaxy Platform

DNA Sequence Bioinformatics Analysis with the Galaxy Platform DNA Sequence Bioinformatics Analysis with the Galaxy Platform University of São Paulo, Brazil 28 July - 1 August 2014 Dave Clements Johns Hopkins University Robson Francisco de Souza University of São

More information

Progress Report. Mississippi Center for Food Safety and Post-Harvest Technology

Progress Report. Mississippi Center for Food Safety and Post-Harvest Technology Progress Report Mississippi Center for Food Safety and Post-Harvest Technology Title: Inactivation of Norovirus (MNV-1) on Fresh Oysters Meat, Tuna Salad and Salmon Sushi Using X-Ray Irradiation Award

More information

EpiSeq : A Next-Generation Sequencing Service for Infectious Disease Outbreak Management

EpiSeq : A Next-Generation Sequencing Service for Infectious Disease Outbreak Management EpiSeq : A Next-Generation Sequencing Service for Infectious Disease Outbreak Management CPTR 2016 Workshop Washington, DC M.Rodrigue April 7th, 2016 1 Healthcare Associated Infection A Global Burden KNOWING

More information

Listeria monocytogenes Outbreak Linked to Pasteurized Ice Cream Product Washington, 2014

Listeria monocytogenes Outbreak Linked to Pasteurized Ice Cream Product Washington, 2014 Listeria monocytogenes Outbreak Linked to Pasteurized Ice Cream Product Washington, 2014 Jenny Lloyd, MS Public Health - Seattle & King County, Seattle, WA Beth Melius, RN, MN, MPH Washington State Department

More information

Retrospective Investigations

Retrospective Investigations Retrospective Investigations Jessie Marus, MPH CDC Outbreak Response and Prevention Branch What are they? Why investigate? How do we do it? What is a Retrospective Outbreak? Food or Environmental Isolate

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

Opportunities to Collect Data and Improve Lm Risk Assessments

Opportunities to Collect Data and Improve Lm Risk Assessments Opportunities to Collect Data and Improve Lm Risk Assessments Janell R. Kause Scientific Advisor for Risk Assessment Food Safety and Inspection Service, USDA 2 Presentation Outline Past Risk Estimates

More information

Sequencing as a Typing Tool

Sequencing as a Typing Tool Sequencing as a Typing Tool 6/4/2018 RCPA Workshop Ms Leah Roberts PhD candidate University of Queensland Outline Sequencing in response to outbreaks Sequencing to characterise complex regions Sequencing

More information

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences

More information

Investigating Legionella: PCR Screening and Whole-Genome Sequencing

Investigating Legionella: PCR Screening and Whole-Genome Sequencing Investigating Legionella: PCR Screening and Whole-Genome Sequencing June 13, 2017 Kimberlee Musser, PhD Chief, Bacterial Diseases Wadsworth Center 1976 Philadelphia Legionnaires' disease outbreak 2 July

More information

Those Pathogens, What You Should Know

Those Pathogens, What You Should Know Those Pathogens, What You Should Know Ted F. Beals, MS, MD Short 1 We are at war over our Food Most of us here are convinced that what we eat, and why we choose is our responsibility, not the responsibility

More information

CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University of Cambridge, Clara East, The Old Schools, Cambridge CB2 1TN

CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University of Cambridge, Clara East, The Old Schools, Cambridge CB2 1TN AWARD NUMBER: W81XWH-14-1-0110 TITLE: A Molecular Framework for Understanding DCIS PRINCIPAL INVESTIGATOR: Gregory Hannon CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University

More information

Surveillance and outbreak investigation of Shiga toxin-producing Escherichia coli using whole genome sequencing- time for a change!

Surveillance and outbreak investigation of Shiga toxin-producing Escherichia coli using whole genome sequencing- time for a change! Surveillance and outbreak investigation of Shiga toxin-producing Escherichia coli using whole genome sequencing- time for a change! Dr Marie Anne Chattaway Deputy Head STEC Laboratory Gastrointestinal

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Data mining with Ensembl Biomart. Stéphanie Le Gras

Data mining with Ensembl Biomart. Stéphanie Le Gras Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:

More information

A Quick-Start Guide for rseqdiff

A Quick-Start Guide for rseqdiff A Quick-Start Guide for rseqdiff Yang Shi (email: shyboy@umich.edu) and Hui Jiang (email: jianghui@umich.edu) 09/05/2013 Introduction rseqdiff is an R package that can detect differential gene and isoform

More information

Exploring the evolution of MRSA with Whole Genome Sequencing

Exploring the evolution of MRSA with Whole Genome Sequencing Exploring the evolution of MRSA with Whole Genome Sequencing PhD student: Zheng WANG Supervisor: Professor Margaret IP Department of Microbiology, CUHK Joint Graduate Seminar Department of Microbiology,

More information

Kern Regional Crime Laboratory Laboratory Director: Dr. Kevin W. P. Miller

Kern Regional Crime Laboratory Laboratory Director: Dr. Kevin W. P. Miller Kern Regional Crime Laboratory Laboratory Director: Dr. Kevin W. P. Miller TRUEALLELE WORK AND WORKFLOW: KERN COUNTY S FIRST CASES APRIL 23, 2014 Presenters! Kelly Woolard! Garett Sugimoto! Jerry Garza

More information

Surveillance and outbreak response are major components

Surveillance and outbreak response are major components CHAPTER Performance Indicators for Foodborne Disease Programs Surveillance and outbreak response are major components of states foodborne investigation capacity and are essential for preventing and controlling

More information

USING WGS FOR SURVEILLANCE, CLUSTER DETECTION, AND EPI INVESTIGATIONS IN WASHINGTON Washington State Department of Health

USING WGS FOR SURVEILLANCE, CLUSTER DETECTION, AND EPI INVESTIGATIONS IN WASHINGTON Washington State Department of Health USING WGS FOR SURVEILLANCE, CLUSTER DETECTION, AND EPI INVESTIGATIONS IN WASHINGTON Washington State Department of Health Washington State Local Health Jurisdictions *Agency leader is both director and

More information

Main conclusions and options for response

Main conclusions and options for response RAPID RISK ASSESSMENT Multi-country outbreak of Listeria monocytogenes PCR serogroup IVb, MLST ST6 6 December 2017 Main conclusions and options for response A multi-country outbreak of Listeria monocytogenes

More information

Abstract. Laurel S. Burall*, Christopher J. Grim, Mark K. Mammel, Atin R. Datta* RESEARCH ARTICLE

Abstract. Laurel S. Burall*, Christopher J. Grim, Mark K. Mammel, Atin R. Datta* RESEARCH ARTICLE RESEARCH ARTICLE Whole Genome Sequence Analysis Using JSpecies Tool Establishes Clonal Relationships between Listeria monocytogenes Strains from Epidemiologically Unrelated Listeriosis Outbreaks Laurel

More information

Infectious Diseases New York State Department of Health, Division of Epidemiology, Bureau of Communicable Disease Control

Infectious Diseases New York State Department of Health, Division of Epidemiology, Bureau of Communicable Disease Control Infectious Diseases New York State Department of Health, Division of Epidemiology, Bureau of Communicable Disease Control Albany, New York Assignment Description The fellow s assignment will be in the

More information

The UK s National Collection of Type Cultures: Answers to 21 st century public health questions

The UK s National Collection of Type Cultures: Answers to 21 st century public health questions The UK s National Collection of Type Cultures: Answers to 21 st century public health questions Julie E. Russell Head of Culture Collections 28 th September 2016 Public Health England (PHE) Executive agency

More information

Country Ham vs. Deli Ham vs. Country Ham Sliced

Country Ham vs. Deli Ham vs. Country Ham Sliced Virginia Katherine G McCombs, MPH Foodborne Disease Epidemiology Program Coordinator Virginia Department of Health And Lauren Turner, PhD Foodborne and Advanced Pathogen Characterization Lead Scientist

More information

APril PUlseNet

APril PUlseNet Issues in Brief Pulsenet: A Critical Food Safety Surveillance System Association of Public Health Laboratories APril 2010 PUlseNet A Critical Food Safety Surveillance System Public health laboratorians

More information

Section B. Comparative Genomics Analysis of Influenza H5N2 Viruses. Objective

Section B. Comparative Genomics Analysis of Influenza H5N2 Viruses. Objective Section B. Comparative Genomics Analysis of Influenza H5N2 Viruses Objective Upon completion of this exercise, you will be able to use the Influenza Research Database (IRD; http://www.fludb.org/) to: Search

More information

Assembling complete genomes for oral pathogens and methanogens. Mia Sales, Undergraduate Research Assistant

Assembling complete genomes for oral pathogens and methanogens. Mia Sales, Undergraduate Research Assistant Assembling complete genomes for oral pathogens and methanogens Mia Sales, Undergraduate Research Assistant Jensen Lab Department of Bioengineering and Carl R. Woese Institute for Genomic Biology University

More information

SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN

SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN Structural variation (SV) Variants larger than 50bps Affect

More information

COMPASS-TB Report Design Study: First Online Survey

COMPASS-TB Report Design Study: First Online Survey COMPASS-TB Report Design Study: First Online Survey Geoff McKee, Ana Crisan, Jennifer Gardy, Tamara Mu nzner Summary Most respondents (15/17) from UK Majority (10/17) involved in clinical management, 8/17

More information

Improving surveillance and early detection of outbreaks. Frank M. Aarestrup

Improving surveillance and early detection of outbreaks. Frank M. Aarestrup Improving surveillance and early detection of outbreaks Frank M. Aarestrup www.compare-europe.eu www.genomicepidemiology.org INFECTIOUS DISEASES Direct cause of 22% of all global deaths (15 million), huge

More information

Fondation Merieux J Craig Venter Institute Bioinformatics Workshop. December 5 8, 2017

Fondation Merieux J Craig Venter Institute Bioinformatics Workshop. December 5 8, 2017 Fondation Merieux J Craig Venter Institute Bioinformatics Workshop December 5 8, 2017 Module 5: Comparative Genomics Analysis Outline Definition of comparative genomics Applications in studying human pathogens

More information

Comparative genomics of E. coli and Shigella:

Comparative genomics of E. coli and Shigella: Comparative genomics of E. coli and Shigella: Identification and characterization of pathogenic variants based on whole genome sequence analysis David A. Rasko PhD. University of Maryland School of Medicine

More information

What do we know about potential waterborne pathogens in livestock and water in NZ?

What do we know about potential waterborne pathogens in livestock and water in NZ? What do we know about potential waterborne pathogens in livestock and water in NZ? Nigel French Drinking Water Workshop, Hamilton, 19 th Sept 2017 Outline Waterborne pathogens: Campylobacter, Giardia,

More information

Module 4: Estimated Annual U.S. Foodborne Disease Burden, 2011 Foodborne Illnesses 48 million Hospitalizations 128,000 Deaths 3,000

Module 4: Estimated Annual U.S. Foodborne Disease Burden, 2011 Foodborne Illnesses 48 million Hospitalizations 128,000 Deaths 3,000 Module 4: Epidemiology Investigation Epidemiology Division Analysis and Reporting Branch 2 Module Learning Objectives Develop a case definition Explain an epidemic curve Develop an initial hypothesis List

More information

Obstacles and challenges in the analysis of microrna sequencing data

Obstacles and challenges in the analysis of microrna sequencing data Obstacles and challenges in the analysis of microrna sequencing data (mirna-seq) David Humphreys Genomics core Dr Victor Chang AC 1936-1991, Pioneering Cardiothoracic Surgeon and Humanitarian The ABCs

More information

Is it Method Verification or Validation, or Just Semantics? Michael Brodsky Brodsky Consultants

Is it Method Verification or Validation, or Just Semantics? Michael Brodsky Brodsky Consultants Is it Method Verification or Validation, or Just Semantics? Michael Brodsky Brodsky Consultants mhbrodsky@rogers.com Objectives To define and differentiate method validation from verification Consider

More information

FOODBORNE DISEASES. Why learning foodborne diseases is very important? What do you know about foodborne diseases? What do you want to know more?

FOODBORNE DISEASES. Why learning foodborne diseases is very important? What do you know about foodborne diseases? What do you want to know more? FOODBORNE DISEASES FOODBORNE DISEASES Why learning foodborne diseases is very important? What do you know about foodborne diseases? What do you want to know more? COURSES 1) Causes of foodborne diseases

More information

Foodborne Illness and Outbreak Surveillance in the USA. Alison Samuel, Naghmeh Parto, Emily Peterson

Foodborne Illness and Outbreak Surveillance in the USA. Alison Samuel, Naghmeh Parto, Emily Peterson Foodborne Illness and Outbreak Surveillance in the USA Alison Samuel, Naghmeh Parto, Emily Peterson 1 Context Where is the information coming from: Attended the CDC/ Emory University; Environmental Microbiology:

More information

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole

More information

Foodborne diseases: an ongoing global challenge

Foodborne diseases: an ongoing global challenge Foodborne diseases: an ongoing global challenge Arie Havelaar GLOBALG.A.P. Summit 2016 Amsterdam, September 27-28, 2016 Outline WHO estimates of the global burden of foodborne disease Regional differences

More information

Multistate Foodborne Outbreaks: Investigation and Communication Process

Multistate Foodborne Outbreaks: Investigation and Communication Process National Center for Emerging and Zoonotic Infectious Diseases Multistate Foodborne Outbreaks: Investigation and Communication Process Matthew Wise, MPH, PhD Deputy Branch Chief for Outbreak Response Laura

More information

Escherichia coli diagnostics

Escherichia coli diagnostics Escherichia coli diagnostics Workshop on Whole Genome Sequencing and Analysis, 19-21 Mar. 2018 Learning objective: After this lecture and exercise, you should be able to describe how the CGE methods for

More information

PulseNet on the High Wire

PulseNet on the High Wire PulseNet on the High Wire 16 th Annual PulseNet Update Meeting 8 th Annual OutbreakNet Meeting Atlanta, Georgia Efrain M. Ribot, Ph.D. PulseNet USA Centers for Disease Control and Prevention National Center

More information

Sequencing of 58 STRs using the Illumina ForenSeq TM workflow and analysis of the data with the STRinNGS v.1.0 software

Sequencing of 58 STRs using the Illumina ForenSeq TM workflow and analysis of the data with the STRinNGS v.1.0 software Sequencing of 58 STRs using the Illumina ForenSeq TM workflow and analysis of the data with the STRinNGS v.1.0 software C. Hussing, C. Huber, R. Bytyci, H.S. Mogensen, C. Børsting, and N. Morling Section

More information

Food Safety Produce Rules How Preventive Controls work From Farm to Fork

Food Safety Produce Rules How Preventive Controls work From Farm to Fork Food Safety Produce Rules How Preventive Controls work From Farm to Fork 1 9 th Dubai International Food Safety Conference Linda J. Harris, Ph.D. Department of Food Science and Technology, University of

More information

User Guide. Association analysis. Input

User Guide. Association analysis. Input User Guide TFEA.ChIP is a tool to estimate transcription factor enrichment in a set of differentially expressed genes using data from ChIP-Seq experiments performed in different tissues and conditions.

More information

Module 3. Genomic data and annotations in public databases Exercises Custom sequence annotation

Module 3. Genomic data and annotations in public databases Exercises Custom sequence annotation Module 3. Genomic data and annotations in public databases Exercises Custom sequence annotation Objectives Upon completion of this exercise, you will be able to use the annotation pipelines provided by

More information

OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES

OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES EVERY STEP OF THE WAY 1 EVERY STEP OF THE WAY MICROBIAL IDENTIFICATION METHODS DNA RNA Genotypic Sequencing of ribosomal RNA regions of bacteria

More information

IMPLEMENTATION OF GHOST FOR HAV OUTBREAK DETECTION

IMPLEMENTATION OF GHOST FOR HAV OUTBREAK DETECTION National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention IMPLEMENTATION OF GHOST FOR HAV OUTBREAK DETECTION Sumathi Ramachandran,MS,MPH,PHD Molecular Epidemiology and Bioinformatics Team Division

More information

INVESTIGATION OF A MULTISTATE OUTBREAK OF SALMONELLA BAREILLY AND SALMONELLA NCHANGA

INVESTIGATION OF A MULTISTATE OUTBREAK OF SALMONELLA BAREILLY AND SALMONELLA NCHANGA INVESTIGATION OF A MULTISTATE OUTBREAK OF SALMONELLA BAREILLY AND SALMONELLA NCHANGA Kristen Soto, MPH (Kristen Desy 05) Connecticut Department of Public Health Epidemiology Program September 25, 2013

More information

Food Microbiology 101

Food Microbiology 101 Food Microbiology 101 Nina G. Parkinson NGP Consulting November 6, 2018 Food Safety and Sanitation Conference Summary Microbiological contamination of food Routes of contamination by pathogens Overview

More information

Below, we included the point-to-point response to the comments of both reviewers.

Below, we included the point-to-point response to the comments of both reviewers. To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively

More information

Appendix 81. From OPENFLU to OPENFMD. Open Session of the EuFMD: 2012, Jerez de la Frontera, Spain 1. Conclusions and recommendations

Appendix 81. From OPENFLU to OPENFMD. Open Session of the EuFMD: 2012, Jerez de la Frontera, Spain 1. Conclusions and recommendations From OPENFLU to OPENFMD a resource for automatic and curated nomenclature and tools for the FMD community Filip Claes, Philippe Le Mercier, Dmitry Kuznetsov, Robin Liechti, Anne Gleizes, Ioannis Xenarios,

More information

33. I will recommend this primer to my colleagues. A. Strongly Agree D. Disagree B. Agree E. Strongly Disagree C. Neither agree nor disagree

33. I will recommend this primer to my colleagues. A. Strongly Agree D. Disagree B. Agree E. Strongly Disagree C. Neither agree nor disagree 27. The primer increased my ability to recognize foodborne illnesses and increased the likelihood that I will consider such illnesses in my patients. 28. The primer increased my knowledge and skills in

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

Outbreak Alert! Trends in Foodborne Illness Outbreaks in the United States ( )

Outbreak Alert! Trends in Foodborne Illness Outbreaks in the United States ( ) 5 th MEETING PAN AMERICAN COMMISSION ON FOOD SAFETY (COPAIA) Rio de Janeiro, Brazil, June 10, 2008 Provisional Agenda Item 5 COPAIA5/5 (Eng.) May, 28 th 2008 ORIGINAL: ENGLISH Outbreak Alert! Trends in

More information

Using Phylogenetic Structure to Assess the Evolutionary Ecology of Microbiota! TJS! iseem Call! April 2015!

Using Phylogenetic Structure to Assess the Evolutionary Ecology of Microbiota! TJS! iseem Call! April 2015! Using Phylogenetic Structure to Assess the Evolutionary Ecology of Microbiota! TJS! iseem Call! April 2015! How are Microbes Distributed In Nature?! A major question in microbial ecology! Used to assess

More information

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant

More information

Predicted Resistance at CDC

Predicted Resistance at CDC National Center for Emerging and Zoonotic Infectious Diseases Predicted Resistance at CDC Ian Plumb, MBBS MSc Medical Epidemiologist, NARMS Team, EDEB, DFWED PulseNet & OutbreakNet Regional Meeting, East

More information

E. coli O157:H7 Outbreak Associated with Consumption of Unpasteurized Milk, Kentucky, 2014

E. coli O157:H7 Outbreak Associated with Consumption of Unpasteurized Milk, Kentucky, 2014 E. coli O157:H7 Outbreak Associated with Consumption of Unpasteurized Milk, Kentucky, 2014 Association of Food and Drug Officials of the Southern States Fall Educational Conference September 15, 2015 Speakers

More information

Salmonella Enteritidis: Surveillance Data and Policy Implications

Salmonella Enteritidis: Surveillance Data and Policy Implications Salmonella Enteritidis: Surveillance Data and Policy Implications Alejandro Pérez, MPH Enteric Diseases Epidemiology Branch Division of Foodborne, Bacterial and Mycotic Diseases National Center for Zoonotic,

More information

This whitepaper will cover the suggested methodology to be employed when developing a PCP plan. This includes how to develop your plan in accordance

This whitepaper will cover the suggested methodology to be employed when developing a PCP plan. This includes how to develop your plan in accordance This whitepaper will cover the suggested methodology to be employed when developing a PCP plan. This includes how to develop your plan in accordance with FSMA s Final Rule for Preventive Controls for Human

More information

DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester

DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING John Archer Faculty of Life Sciences University of Manchester HIV Dynamics and Evolution, 2008, Santa Fe, New Mexico. Overview

More information

Genomic epidemiology of Gram-negative pathogens: from Acinetobacter to E. coli. Professor Mark Pallen, University of Birmingham

Genomic epidemiology of Gram-negative pathogens: from Acinetobacter to E. coli. Professor Mark Pallen, University of Birmingham Genomic epidemiology of Gram-negative pathogens: from Acinetobacter to E. coli Professor Mark Pallen, University of Birmingham The state we are in: diagnostic microbiology 21st Century problem, but 19th

More information

Illness Outbreaks Linked to Nonpasteurized (Raw) Milk

Illness Outbreaks Linked to Nonpasteurized (Raw) Milk National Center for Emerging and Zoonotic Infectious Diseases Illness Outbreaks Linked to Nonpasteurized (Raw) Milk Megin Nichols, DVM, MPH, DACVPM Enteric Zoonoses Activity, Outbreak Response and Prevention

More information

E. Coli O157:H7 and Spinach Jeff Farrar, DVM, PhD, MPH Branch Chief Food and Drug Branch California Department of Health Services

E. Coli O157:H7 and Spinach Jeff Farrar, DVM, PhD, MPH Branch Chief Food and Drug Branch California Department of Health Services E. Coli O157:H7 and Spinach 2006 Jeff Farrar, DVM, PhD, MPH Branch Chief Food and Drug Branch California Department of Health Services Number of cases of E. coli O157:H7 reported in California - 2000-2005

More information

Food Safety Performance Standards: an Epidemiologic Perspective

Food Safety Performance Standards: an Epidemiologic Perspective Food Safety Performance Standards: an Epidemiologic Perspective Institute t of Medicine i Food dforum Meeting Rajal Mody, MD MPH LCDR US Public Health Service Enteric Diseases Epidemiology Branch Centers

More information

Transcriptome Analysis

Transcriptome Analysis Transcriptome Analysis Data Preprocessing Sample Preparation Illumina Sequencing Demultiplexing Raw FastQ Reference Genome (fasta) Reference Annotation (GTF) Reference Genome Analysis Tophat Accepted hits

More information