No evidence for a role of modified live virus vaccines in the emergence of canine parvovirus

Transcription

1 Journal of General Virology (1998), 79, Printed in Great Britain.... SHORT COMMUNICATION No evidence for a role of modified live virus vaccines in the emergence of canine parvovirus Uwe Truyen, 1 Klaus Geissler, 1 Colin R. Parrish, 2 Walter Hermanns 3 and Gu nter Siegl 4 1 Institute for Medical Microbiology, Ludwig Maximillians University, Veterinaerstr. 13, Munich, Germany 2 James A. Baker Institute for Animal Health, New York State College of Veterinary Medicine, Cornell University, Ithaca, NY 14853, USA 3 Institute for Animal Pathology, Ludwig Maximillians University Veterinaerstr. 13, Munich, Germany 4 Institute for Clinical Microbiology and Immunology, Frohbergstr. 3, CH-9000 St Gallen, Switzerland In this study the early evolution and potential origins of canine parvovirus (CPV) were examined. We cloned and sequenced the VP2 capsid protein genes of three German CPV strains isolated in , as well as two feline panleukopenia virus (FPV) vaccine viruses that were previously shown to have some restriction enzyme cleavage sites in common with CPV. Other partial VP2 gene sequences were obtained by amplifying CPV DNA from paraffin-embedded tissues of dogs which were early parvovirus disease cases in Germany in Sequences were analysed with respect to their evolutionary relationships to other CPV and FPV isolates. Those analyses did not support the hypothesis that CPV emerged as a variant of an FPV vaccine virus. Neither did they reveal ancestral sequences among the very early CPV isolates examined. Other possible sources for the origin of CPV are examined, including the involvement of viruses from wild carnivores. Canine parvovirus (CPV) is a newly recognized virus that was first isolated in Within a few years CPV spread worldwide and caused a panzootic of disease in dog populations (for review see Parrish, 1990). CPV now appears to be endemic in almost all populations of wild or domesticated dogs. CPV is antigenically and genetically closely related to the well-known feline panleukopenia virus (FPV) and is classified in the feline parvovirus subgroup, along with other closely related carnivore parvoviruses from mink, racoons, Asiatic racoon dogs and foxes (Berns et al., 1995; Truyen et al., 1995a). The origin of CPV has not yet been determined and various hypotheses explaining its derivation and sudden emergence have been put forward. One is that CPV is a natural Author for correspondence: Uwe Truyen. Fax Uwe.Truyen LRZ.uni-muenchen.de variant FPV with an extended host-range. FPV has also been suggested to be the source of mink enteritis virus (MEV), which emerged in mink in the 1940s (Schofield, 1949). Another hypothesis is that growth of modified live virus FPV or MEV vaccine strains in tissue culture might have lead to the generation of a CPV-like virus. In this model, that mutant virus could subsequently have been distributed by vaccination first in cat and later in dog populations (Siegl, 1984). Early studies (Tratschin et al., 1982) addressed these hypotheses by characterizing several vaccine viruses and early CPV isolates with neutralization assays using polyclonal sera and restriction enzyme analyses. The restriction enzyme analysis suggested a closer relationship between two of the FPV vaccine strains and early CPV isolates, although they did not prove a direct relationship between the FPV and CPV strains under study (Tratschin et al., 1982). Since its emergence antigenic and genetic variants of CPV have arisen that can be discriminated using specific monoclonal antibodies (Parrish et al., 1985, 1991). According to their temporal appearance those antigenic variants were named CPV type-2a (CPV-2a) and CPV type-2b (CPV-2b). The first CPV-2a isolates reported were isolated in 1979, while CPV type-2b viruses were not reported until 1984 (Parrish et al., 1991). The CPV-2a and CPV-2b types replaced the original type of CPV [termed CPV type-2 (CPV-2)] worldwide. The new types differ from the original CPV-2 viruses in being able to replicate and cause disease in cats (Truyen et al., 1995b; Mochizuki et al., 1996). The genetic differences between the new types and the original CPV-2 were only between four and six coding changes in the capsid protein gene (Parrish et al., 1991; Parrish, 1994). Only a few amino acids within the capsid protein gene [in particular residues 93 (Lys Asn) and 323 (Asp Asn)] control the canine host-range and antigenic difference between CPV and the FPV-like viruses (Chang et al., 1992; Truyen et al., 1995a). From the sequences of a number of FPV-like viruses from cats, mink, racoons and foxes, and CPV-like viruses from dogs and Asiatic racoon dogs, the phylogenetically important sequences which would be expected in an ancestral viruses can be predicted (Truyen et al., 1995a; Parrish, 1991) SGM BBFD

2 U. Truyen and others Table 1. Origin of the samples analysed (dog tissues, and dog isolates or vaccines) including GenBank accession number Only sequences that have not been analysed before are listed (compare Truyen et al., 1995a). GenBank Virus Origin no. Reference FPV-Panocell Vaccine virus 1970s AJ Tratschin et al. (1982); this paper FPV-Dohyvac Vaccine virus 1970s AJ Tratschin et al. (1982); this paper CPV-Quinn Dog, Germany 1980 AJ Tratschin et al. (1982); this paper CPV-ChowChow Dog, Germany 1979 AJ This paper CPV-Pudel Dog, Germany 1979 AJ This paper FPV-615 Cat, Germany 1996 AJ This paper FPV-Obihiro Cat, Japan 1974 AB Horiuchi (1997); Goto et al. (1974) FPV-Som4 Cat, Japan 1995 AB Horiuchi (1997); Horiuchi et al. (1996) FPV-TU2 Cat, Japan 1975 AB Horiuchi (1997); Mochizuki et al. (1989) FPV-483 Cat, Japan 1990 D88286 Horiuchi (1997) Horiuchi et al. (1996) CPV-314 Cat, Japan 1993 D78585 Mochizuki et al. (1996) Dog, Germany 1978 ND This paper Dog, Germany 1978 ND This paper Dog, Germany 1978 ND This paper Dog, Germany 1978 ND This paper Dog, Germany 1979 ND This paper Dog, Germany 1979 ND This paper Dog, Germany 1979 ND This paper ND, Not deposited in GenBank. Here we have therefore re-examined the relationships of some of the viruses reported in earlier studies of the relationships between CPV and FPV vaccine strains, using specific monoclonal antibodies for antigenic analysis, and DNA sequence analysis. We analysed FPV vaccine viruses that were widely used in the mid 1970s and that have been suggested as potential ancestors of CPV, and also examined some early European CPV isolates. As few early CPV isolates were available we also included parvovirus DNA sequences that were amplified from paraffin-embedded tissues taken from dogs in the first years ( ) of CPV emergence. The sequences obtained were compared to sequences available from GenBank and analysed with respect to their evolutionary status. Sequences were aligned using the program MegAlign of the University of Wisconsin Genetics Computer Group sequence analysis package. The phylogenies were calculated using the nearest neighbour interchange branch swapping algorithm of the program PAUP version (Swofford, 1993). Viruses examined are listed in Table 1. Three early CPV isolates were isolated in 1979 and 1980 in Germany and passaged twice in tissue culture. Two FPV vaccine viruses, FPV-Panocell and FPV-Dohyvac, were chosen as they have previously been reported to show a CPV-like pattern after digestion with HinfI (Tratschin et al., 1982). The viruses were antigenically typed using monoclonal antibodies and a haemagglutination inhibition (HI) test as described (Parrish & Carmichael, 1983). Viral DNA was amplified from 1 µl samples of tissue culture supernatant using primer pair B [primers M1 (5 AGCTGTCGACGAAAACGGATGGGTGGAAAT 3 ) and 41 (5 GCCCTTGTGTAGACGC3 )], amplifying the regions between nt , and primer pair E [primers M5 (5 ATAACAAACCTTCTAAATCCAATATCAAAT 3 ) and 19 (5 GAGACCAGCTGAGGTTGG 3 )], amplifying the region between nt (Fig. 1). This allowed the sequence analysis of about 85% of the VP2 capsid protein gene, including all evolutionary informative nucleotides (Truyen et al., 1995a). Few isolates from the early CPV infections of dogs in Europe were available, but many paraffin-embedded tissues of the very first German disease cases were stored in the collection of the Institute of Veterinary Pathology at the Munich BBFE

3 Canine parvovirus emergence Fig. 1. (A) Conserved nucleotide differences between the CPV- and FPV-like viruses and the viruses examined in this study. The positions of primer pairs B and E used for amplification of the capsid protein gene are indicated. Reference viruses were CPV-d (type 2), CPV-15 (type 2a) and FPV-b (FPV). Asterisks indicate the positions of isolate-specific coding nucleotide changes; the changes are detailed for each virus on the right-hand side. Additional isolate-specific non-coding changes are listed in the text. Amino acids are depicted in the one-letter code. (B) The primer pairs used for amplification of parvovirus DNA sequences from paraffin-embedded tissues of dogs are indicated. The primer pairs cover evolutionary relevant regions of the capsid protein gene. Veterinary School. Those cases were diagnosed as parvovirus disease by clinical and histopathological features and in some cases by positive parvovirus-specific immunofluorescence. Paraffin-embedded tissues were processed essentially as described previously (Truyen et al., 1994; Wright & Manos, 1990) and parvovirus DNA covering the evolutionary informative regions of the capsid protein gene (Fig. 1) was amplified by PCR as described (Truyen et al., 1994; Schunck et al., 1995). For amplification of nt primer pair D [primers M1 and M2 (5 CTCAGAAATTCAGTTGCCAA- TCTCCTGGATT 3 )], for nt primer pair F [primers M4 (5 CAAACCAACTTGGCGTTACTCA 3 ) and M42 (5 CATTTGTTACAGGAAGG 3 )], and for amplification of nt primer pair A [primers 34 (5 GTACAATATTT- CTATGC 3 ) and 63 (5 TAACAAATGAATATGAT 3 )] were used. Amplified DNA was cloned into the pcrii vector and analysed by DNA sequencing on an automated sequencer using cycle sequencing and Taq polymerase. In addition to the dog tissues described we also attempted to amplify, using various primer pairs, parvovirus DNA from a total of 13 paraffin-embedded tissue samples from cats that had been diagnosed with panleukopenia in the 1970s; however, no parvovirus DNA sequences could be amplified from any of those tissues. The viruses were antigenically typed as FPV-like viruses (FPV-Panocell, FPV-Dohyvac) or CPV-2-like viruses (CPV- Pudel, CPV-ChowChow), respectively. The CPV-Quinn isolate was antigenically and genetically identified as a CPV-2a isolate. The two FPV vaccine strains did not show features that BBFF

4 U. Truyen and others Fig. 2. (A) Antigenic profile of the viruses examined in this study. Subtype-specific monoclonal antibodies were used for typing the viruses in an HI test., HI titre 100;, HI titres 10. (B) Phylogeny of some feline parvoviruses including the FPV vaccine virus and the dog virus sequences. Both phylogenies are based on 85% of the VP2 gene and were calculated using the heuristic search of the program PAUP version 3.1; 500 bootstrap replicates were examined and bootstrap values for each branching point are indicated in italics. (C) Alignment of the DNA sequences from nucleotides 3003 to 3100, representing a region that allows discrimination of the new antigenic types CPV-2a/2b from CPV-2 (nucleotides 3045 and 3088). distinguished them substantially from other early MEV- or FPV-like viruses, and the three early CPV isolates were very closely related to other CPV-2 or CPV-2a viruses. None of the viruses showed sequences intermediate between the FPV-like and CPV-like viruses, and all clustered with the viruses commonly associated with their hosts of origin (Fig. 2). We BBFG

5 Canine parvovirus emergence could not confirm the differences in the restriction enzyme pattern reported previously for the FPV and CPV isolates (McMaster et al., 1981; Tratschin et al., 1982) as the HinfI site that differs consistently between all FPV and CPV isolates is located around nt 1905 at the left-hand site of the genome, and was not examined in this study. The HinfI site at map unit 82 stated to be variable between FPV and CPV could not be confirmed in the two vaccine viruses or in the CPV isolates. However, this HinfI site was also not present in the vast majority of FPV, MEV and CPV sequences deposited in GenBank, with MEV-13 and FPV-Carlson being the only viruses that have this restriction site. The reason for this discrepancy is not known, but this HinfI site does not appear to be a valuable feature to distinguish between FPV and CPV viruses. The unique MboI restriction pattern of the German CPV isolate (CPV-Quinn) in the Tratschin study could be explained by the sequence obtained, as this isolate is a CPV-2a virus, and these viruses have an MboI pattern identical to FPV isolates. Analysing the DNA sequences amplified from very early CPV isolates did not reveal any indication for an ancestral status of those sequences (Fig. 2). While the analysis of only four FPV vaccine strains (FPV- Panocell, FPV-Dohyvac, FPV-Philips-Roxane and FPV-Carlson) does not rule out the involvement of any FPV vaccine in the origin of CPV, it is clear that the FPV vaccine strains examined here and in previous studies were not the direct ancestor of CPV. The analysis of three further CPV isolates from the early years of CPV confirmed the presence of the distinct CPV-like clade. Beside some isolate-specific coding nucleotide changes in the capsid protein gene which are shown in Fig. 1, a few isolate-specific silent changes were also found: nt 2958 (G), 3596 (C), 4307 (G) and 4358 (T) in FPV-b; nt 3203 (C), 4307 (G) and 4358 (T) in FPV-Panocell; and nt 3086 (C) for FPV-Dohyvac. At least 12 conserved nucleotide differences were seen between all CPV isolates and all FPV-like viruses. This was also confirmed by the partial DNA sequences of isolates from tissues of dogs dying of CPV infection during 1978 and All three capsid protein gene regions could be analysed from viruses from five dogs (838 78, , , and ), and none was an intermediate between CPV and FPV. In addition, in tissues from two further dogs ( and ) only some regions could be amplified; there was also no indication of an intermediate status. The virus sequences amplified from the canine tissues suggested that most viruses were CPV type-2. However, three CPV sequences from dogs infected in 1978 (dogs , and ) showed sequences in common with the CPV-2a 2b virus (Fig. 2a). This confirms the evidence from previous phylogenetic analyses which indicated that the CPV- 2a strain derived from a common ancestor of the CPVs, presumably prior to 1978 (Parrish et al., 1991; Truyen & Parrish, 1995). Earlier studies from Parrish et al. (1988) also reported a prevalence in Denmark of CPV-2a (121 of 125 isolates analysed from 1980). If FPV vaccines were unlikely to be involved in the emergence of CPV, and if a gradual accumulation of important amino acids did not occur in dogs, where did the new canine virus come from? CPV most likely emerged in Europe, as the first serological and virological hints for the new virus come from Greece, Belgium and France (Parrish, 1990). Few isolates have been collected from wild carnivores, and the only fox isolate available, isolated from a farmed Arctic (blue) fox (Alopex lagus) from Finland, showed some indications of an ancestral DNA sequence in terms of non-coding nucleotide changes (Truyen et al., 1995a). Recently, we were able to amplify some limited parvovirus DNA sequences from the ileum of a free-ranging red fox (Vulpes vulpes) from Germany. That sequence showed an intermediate sequence character, as amino acid 103 was the FPV sequence, while amino acids 80, 93 and 323 were the CPV sequence. The identity of amino acid 87 suggested that the virus was closer to the antigenic type CPV-2 than CPV-2a or -2b (Truyen et al., 1998). Although the exact mechanisms of the emergence of the new virus CPV is still not resolved in detail, these data imply that FPV vaccine strains were not ancestors of CPV; rather, viruses of other carnivores may have been the ancestors of CPV. Our future studies will be aimed to further characterize the epidemiology of feline parvoviruses in wild carnivores. The skilful technical assistance of Gaby Platzer is gratefully acknowledged. The work was supported by grants from the Deutsche Forschungsgemeinschaft (Tr ) and the Gesellschaft fu r kynologische Forschung. References Berns, K. I., Bergoin, M., Bloom, M., Lederman, M., Muzyczka, N., Siegl, G., Tal, J. & Tattersall, P. (1995). Family Parvoviridae. InVirus Taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses, pp Edited by F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo & M. D. Summers. Vienna & New York: Springer-Verlag. Chang, S.-F., Sgro, J. Y. & Parrish, C. R. (1992). Multiple amino acids in the capsid structure of canine parvovirus coordinately determine the canine host range and specific antigenic and hemagglutination properties. Journal of Virology 66, Goto, H., Yachida, S., Sirahata, T. & Shimizu, K. (1974). Feline panleukopenia in Japan. I. Isolation and characterization of the virus. Japanese Journal of Veterinary Science 36, Horiuchi, M. (1997). Evolutionary pattern of feline panleukopenia virus differs from that of canine parvovirus. Direct submission to GenBank, December Horiuchi, M., Yuri, K., Soma, T., Katae, H., Nagasawa, H. & Shinagawa, M. (1996). Differentiation of vaccine virus from field isolates of feline panleukopenia virus by polymerase chain reaction and restriction fragment length polymorphism analysis. Veterinary Microbiology 53, McMaster, G., Tratschin, J.-D. & Siegl, G. (1981). Comparison of canine parvovirus with mink enteritis virus by restriction site mapping. Journal of Virology 38, BBFH

6 U. Truyen and others Mochizuki, M., Konishi, S., Aijiki, M. & Akaboshi, T. (1989). Comparison feline parvovirus subspecific strains using monoclonal antibodies against feline panleukopenia virus. Japanese Journal of Veterinary Science 51, Mochizuki, M., Horiuchi, M., Hiragi, H., San Gabriel, M. C., Yasuda, N. & Uno, T. (1996). Isolation of canine parvovirus from a cat manifesting clinical signs of feline panleukopenia. Journal of Clinical Microbiology 34, Parrish, C. R. (1990). Emergence, natural history and variation of canine, mink, and feline parvoviruses. Advances in Virus Research 38, Parrish, C. R. (1991). Mapping specific functions in the capsid structure of canine parvovirus and feline panleukopenia virus using infectious plasmid clones. Virology 183, Parrish, C. R. (1994). The emergence and evolution of canine parvovirus an example of recent host range mutation. Seminars in Virology 5, Parrish, C. R. & Carmichael, L. E. (1983). Antigenic structure and variation of canine parvovirus type 2, feline panleukopenia virus, and mink enteritis virus. Virology 129, Parrish, C. R., O Connell, P. H., Evermann, J. F. & Carmichael, L. E. (1985). Natural variation of canine parvovirus. Science 230, Parrish, C. R., Have, P., Foreyt, W. J., Evermann, J. F., Senda, M. & Carmichael, L. E. (1988). The global spread and replacement of canine parvovirus strains. Journal of General Virology 69, Parrish, C. R., Aquadro, C. F., Strassheim, M. L., Evermann, J. F., Sgro, J.-Y. & Mohammed, H. O. (1991). Rapid antigenic-type replacement and DNA sequence evolution of canine parvovirus. Journal of Virology 65, Schofield, F. W. (1949). Virus enteritis in mink. North American Veterinarian 30, Schunck, B., Kraft, W. & Truyen, U. (1995). A simple touchdown PCR for the detection of canine parvovirus and feline panleukopenia virus in feces. Journal of Virological Methods 55, Siegl, G. (1984). Canine parvovirus. Origin and significance of a new pathogen. In The Parvoviruses, pp Edited by K. Berns. New York: Plenum Press. Swofford, D. L. (1993). PAUP phylogenetic analysis using parsimony. Center for Biodiversity, Illinois Natural History Survey, Champaign, Illinois, USA. Tratschin, J.-D., McMaster, G. K., Kronauer, G. & Siegl, G. (1982). Canine parvovirus: relationship to wild-type and vaccine strains of feline panleukopenia virus and mink enteritis virus. Journal of General Virology 61, Truyen, U. & Parrish, C. R. (1995). The evolution and control of parvovirus host ranges. Seminars in Virology 6, Truyen, U., Platzer, G., Parrish, C. R., Ha nichen, T., Hermanns, W. & Kaaden, O.-R. (1994). Detection of canine parvovirus DNA in paraffinembedded tissue sections by the polymerase chain reaction. Journal of Veterinary Medicine Series B 41, Truyen, U., Gruenberg, A., Chang, S.-F., Veijalainen, P., Obermaier, B. & Parrish, C. R. (1995a). Evolution of the feline subgroup parvoviruses and the control of the canine host range. Journal of Virology 69, Truyen, U., Evermann, J. F., Vieler, E. & Parrish, C. R. (1995b). Evolution of canine parvovirus involved loss and gain of the feline host range. Virology 215, Truyen, U., Mu ller, T., Platzer, G., Heidrich, R., Tackmann, K. & Carmichael, L. E. (1998). Serological survey on viral pathogens in freeranging foxes in Germany with emphasis on feline parvoviruses and DNA sequence analysis of a red fox parvovirus. Epidemiology and Infection (in press). Wright, D. K. & Manos, M. M. (1990). Sample preparation from paraffinembedded tissues. In PCR Protocols. A Guide to Methods and Applications, pp Edited by M. H. Innis, D. H. Gelfand, J. J. Sninsky & T. J. White. Sydney, Australia: Academic Press. Received 11 November 1997; Accepted 12 January 1998 BBFI