Influenza hemagglutinin protein stability correlates with fitness and seasonal evolutionary dynamics
|
|
- Joel James
- 5 years ago
- Views:
Transcription
1 Influenza hemagglutinin protein stability correlates with fitness and seasonal evolutionary dynamics Eili Y. Klein, Ph.D. Assistant Professor, Department of Emergency Medicine & Fellow, Center for Disease Dynamics, Economics & Policy
2 Influenza Burden Leading causes of death, US children 18,000 hospitalizations Millions of excess outpatient visits 2 of 23
3 Influenza Burden Death toll (fraction of world population) 1E+0 1E-1 1E-2 1E-3 1E-4 1E-5 1E-6 1E-7 1E-8 World epidemics Smallpox Flu AIDS Flu Flu Ebola Flu SARS MERS Years Ago Worldwide annually (WHO) 3 million cases 250,000 to 500,000 deaths U.S. economic burden of $83.3 billion annually virus bacteria 3 of 23
4 Challenge to Successful Vaccine Viral Mutations Infection Vaccine Production Vaccination Dec-Feb Mar-Sep Oct-Nov Viral Selection Mutations Influenza Virus 4 of 23
5 Hypothesis Protein thermostability of HA protein affects fitness and evolutionary dynamics What are the primary fitness differences between co-existing virus strains that leads to persistence 1. New strain (red) dies out 2. New strain (red) persists 3. New strain (red) takes over 5 of 23
6 Stability of the Hemagglutinin Protein Successful viral replication requires the virus to assemble proteins, particularly the hemagglutinin protein 6 of 23
7 Effect of hemagglutinin protein stability on evolution More Stable Estimated Change in hemagglutinin Stability (ΔΔG) Less Stable v 9,797 H1N1pdm09 hemagglutinin sequences with full open reading frames, date information, and were isolated between 3/12/2009 and 4/9/2015 v Stability predicted by Eris Algorithm Global Initiative on Sharing All Influenza Data (GISAID) EpiFlu database (platform.gisaid.org) 7 of 23
8 Effect of hemagglutinin protein stability on evolution Estimated Change in hemagglutinin Stability (ΔΔG) Estimated Change in hemagglutinin Stability (ΔΔG)K-means clustering algorithm 8 of 23
9 Effect of hemagglutinin protein stability on evolution More Stable Estimated Change in hemagglutinin Stability (ΔΔG) Less Stable 9 of 23
10 Effect of hemagglutinin protein stability on evolution Phylogenetic Tree Tree determined using RAxML Blackbox for all non-duplicate nucleotide sequences collected after 10/1/2010 Estimated Change in hemagglutinin Stability (ΔΔG) 10 of 23
11 Effect of hemagglutinin protein stability on evolution Most Likely Ancestor Smallest pairwise distance measurement (i.e., highest relatedness) between two strains using the K80 model (Kimura 1980). In the case of ties, both ancestral strains were included of 23
12 Effect of hemagglutinin protein stability on evolution More Stable Most Likely Ancestor Estimated Change in hemagglutinin Stability (ΔΔG) Less Stable 12 of 23
13 Laboratory confirmation of computational estimates More Stable Estimated Change in hemagglutinin Stability (ΔΔG) P=0.015 Experimental test of stability Less Stable 13 of 23
14 Are more stable viruses more fit? More stable viruses produced more virus *** ** ** ** Less stable More stable 14 of 23
15 HA Protein Stability and Virus Fitness More stable viruses produced more virus and infected more cells. *** ** ** ** * * Less stable More stable Less stable More stable 15 of 23
16 Mutations and Stability 16 of 23
17 Mutations and Stability 17 of 23
18 Evolutionary Dynamics 18 of 23
19 Future work Computational forecasts of escape viruses based on stability predictions TTGCCGTAACGGATGTAAATTGCCATAACGGGCTAA TTGCCATAACGGAGGTAAATTGCCATAACGGGCTAA TTGCCATAACGGATGTAAGTTGCCATAACGGGCTAA TTGCCATAACGGATGTAAATTGCCATAAGGGGCTAA TTGCCATAACGGATATAAATTGCCATAACGGGCTAA TTGCCATCACGGATGTAAATTGCCATAACGGGCTAA TTGCCATAACGCATGTAAATTGCCATAACGGGCTAA TTGCCATTACGGATGTAAATTGCCATAACGGGCTAA TTGCCATAACGGATGTAAATTGCCAGAACGGGCTAA TTGCCATAACGGATGTAAATTGCCATAACGAGCTAA TTGCCATAACAGATGTAAATTGCCATAACGGGCTAA TTGCCATAACGGATGTTAATTGCCATAACGGGCTAA TTGCCATAACGGATGTAAATTGCCATAGCGGGCTAA TTGCCATAACGGATGTAAATTGCCATAACGGGCAAA TTGCCATAACGGATTTAAATTGCCATAACGGGCTAA Experimental antibody binding assays 19 of 23
20 Experimental Binding Assays Immune cells Antibody Viral mutant capsid gene BINDING substrate Harmless + FACS Viral mutant capsid protein mutant Escape mutant Escape mutant gene Harmless mutant Escape mutant gene SEQUENCE 20 of 23
21 Accelerated viral evolution in emulsion Drop volume: 0.5 nl Number of cells: 2 cells/drop Number of viruses: 1-10 pfu/drop Burst size: 100 pfu/infection Drop split: 10% Split rate: 500,000 drops/hour Reinjected drops passage Incubation Waste Cells 21 of 23
22 Hydrogel Display A library of proteins and their DNA code 1 DNA anchor (primer) encapsulate hydrogel hydrogel 1 mutant gene PCR in drop s hydrogel multiple gene copies BG BG BG Protein anchor (BG SNAP) Water-in-oil drop Water-in-oil drop 4 hydrogel hydrogel hydrogel Multiple protein copies Protein translation in drops hydrogel BG Antibody binding assay Wash and bind fluorescent Ab Water-in-oil drop Wash 22 of 23
23 Thanks Deena Blumenkrantz Andy Pekosz Andrew Feldman David Weitz Adrian Serohijos Eugene Shakhnovich Jeong-Mo Choi, João V. Rodrigues, Brendan D. Smith, Andrew P. Lane 23 of 23
Evolution of influenza
Evolution of influenza Today: 1. Global health impact of flu - why should we care? 2. - what are the components of the virus and how do they change? 3. Where does influenza come from? - are there animal
More informationSynthetic Genomics and Its Application to Viral Infectious Diseases. Timothy Stockwell (JCVI) David Wentworth (JCVI)
Synthetic Genomics and Its Application to Viral Infectious Diseases Timothy Stockwell (JCVI) David Wentworth (JCVI) Outline Using informatics to predict drift (strain selection) Synthetic Genomics: Preparedness
More informationMapping the Antigenic and Genetic Evolution of Influenza Virus
Mapping the Antigenic and Genetic Evolution of Influenza Virus Derek J. Smith, Alan S. Lapedes, Jan C. de Jong, Theo M. Bestebroer, Guus F. Rimmelzwaan, Albert D. M. E. Osterhaus, Ron A. M. Fouchier Science
More informationInfluenza: The Threat of a Pandemic
April, 2009 Definitions Epidemic: An increase in disease above what you what would normally expect. Pandemic: A worldwide epidemic 2 What is Influenza? Also called Flu, it is a contagious respiratory illness
More informationHuman Genome Complexity, Viruses & Genetic Variability
Human Genome Complexity, Viruses & Genetic Variability (Learning Objectives) Learn the types of DNA sequences present in the Human Genome other than genes coding for functional proteins. Review what you
More informationDiscovery of. 1892: Russian biologist Dmitri Ivanovsky publishes. 1931: first images of viruses obtained using
Discovery of (1884: invention of the Chamberland filter with pores smaller than bacteria) 1892: Russian biologist Dmitri Ivanovsky publishes a paper in which shows that extracts from diseased tobacco plants
More informationEbola Virus. Emerging Diseases. Biosciences in the 21 st Century Dr. Amber Rice December 4, 2017
Ebola Virus Emerging Diseases Biosciences in the 21 st Century Dr. Amber Rice December 4, 2017 Outline Disease emergence: a case study How do pathogens shift hosts? Evolution within hosts: The evolution
More informationReview of Influenza Activity in San Diego County
2015 Kick the Flu Summit Review of Influenza Activity in San Diego County 2014-2015 Season Jeffrey Johnson, MPH Senior Epidemiologist Epidemiology & Immunization Services Branch Public Health Services
More informationChapter 18. Viral Genetics. AP Biology
Chapter 18. Viral Genetics 2003-2004 1 A sense of size Comparing eukaryote bacterium virus 2 What is a virus? Is it alive? DNA or RNA enclosed in a protein coat Viruses are not cells Extremely tiny electron
More informationInfluenza Season and EV-D68 Update. Johnathan Ledbetter, MPH
2014-2015 Influenza Season and EV-D68 Update Johnathan Ledbetter, MPH 2014-2015 Influenza Season Influenza Reporting Individual cases are not reportable in the state of Texas Situations where influenza
More informationOverview of the Influenza Virus
Overview of the Influenza Virus Victor C. Huber, Ph.D. September 24, 2015 victor.huber@usd.edu General Features of Influenza Virus Infections Clinical Features of Influenza Sudden onset of symptoms Incubation
More informationAP Biology. Viral diseases Polio. Chapter 18. Smallpox. Influenza: 1918 epidemic. Emerging viruses. A sense of size
Hepatitis Viral diseases Polio Chapter 18. Measles Viral Genetics Influenza: 1918 epidemic 30-40 million deaths world-wide Chicken pox Smallpox Eradicated in 1976 vaccinations ceased in 1980 at risk population?
More informationSeasonality of influenza activity in Hong Kong and its association with meteorological variations
Seasonality of influenza activity in Hong Kong and its association with meteorological variations Prof. Paul Chan Department of Microbiology The Chinese University of Hong Kong Mr. HY Mok Senior Scientific
More informationJ. A. Sands, 21 October 2013 Lehigh University
J. A. Sands, 21 October 2013 Lehigh University Cryptococcus, Candidiasis, Aspergillosis Tuberculosis Cholera Plague Bact. Meningitis Salmonella Listeria Leptospirosis Staph. (MRSA) E. coli Clostridium
More informationInfluenza 2009: Not Yet The Perfect Storm
Influenza 2009: Not Yet The Perfect Storm What s needed for a pandemic strain? Novel virus (little to no immunity) Capable of causing disease in humans Highly pathogenic / virulent Capable of sustained
More informationName: Due on Wensday, December 7th Bioinformatics Take Home Exam #9 Pick one most correct answer, unless stated otherwise!
Name: Due on Wensday, December 7th Bioinformatics Take Home Exam #9 Pick one most correct answer, unless stated otherwise! 1. What process brought 2 divergent chlorophylls into the ancestor of the cyanobacteria,
More information19 2 Viruses Slide 1 of 34
1 of 34 What Is a Virus? What Is a Virus? Viruses are particles of nucleic acid, protein, and in some cases, lipids. Viruses can reproduce only by infecting living cells. 2 of 34 What Is a Virus? Viruses
More informationThe Controversy About the H5N1 Transmissibility Experiments. resumes on lethal flu strains
The Controversy About the H5N1 Transmissibility Experiments http://www.nature.com/news/work resumes on lethal flu strains 1.12266 3 M AY 2 0 1 2 VO L 4 8 5 N AT U R E 1 3 Learning Objectives Participants
More information100 years of Influenza Pandemic and the prospects for new influenza vaccines
100 years of Influenza Pandemic and the prospects for new influenza vaccines Dr John McCauley Director, WHO Collaborating Centre for Reference and Research on influenza The Francis Crick Institute London
More informationViral reproductive cycle
Lecture 29: Viruses Lecture outline 11/11/05 Types of viruses Bacteriophage Lytic and lysogenic life cycles viruses viruses Influenza Prions Mad cow disease 0.5 µm Figure 18.4 Viral structure of capsid
More informationIncidence of Seasonal Influenza
What Is All the Fuss? A Just-in in-time Primer on H1N1 Influenza A and Pandemic Influenza provided by the National Association of State EMS Officials May 1, 2009 Disclaimer This self-learning learning
More informationModeling the Antigenic Evolution of Influenza Viruses from Sequences
Modeling the Antigenic Evolution of Influenza Viruses from Sequences Taijiao Jiang Center of Systems Medicine, Chinese Academy of Medical Sciences Suzhou Institute of Systems Medicine October 8-10, 2015.
More informationExistence of reassortant A (H1N2) swine influenza viruses in Saitama Prefecture, Japan
International Congress Series 1263 (2004) 749 753 Existence of reassortant A (H1N2) swine influenza viruses in Saitama Prefecture, Japan Shin ichi Shimada a, *, Takayasu Ohtsuka b, Masayuki Tanaka b, Munehito
More informationLecture 19 Evolution and human health
Lecture 19 Evolution and human health The evolution of flu viruses The evolution of flu viruses Google Flu Trends data US data Check out: http://www.google.org/flutrends/ The evolution of flu viruses the
More informationStudy the Evolution of the Avian Influenza Virus
Designing an Algorithm to Study the Evolution of the Avian Influenza Virus Arti Khana Mentor: Takis Benos Rachel Brower-Sinning Department of Computational Biology University of Pittsburgh Overview Introduction
More informationPandemic Influenza Preparedness
Pandemic Influenza Preparedness Of the many health threats that we are preparing for, this is the one that we know will happen. Bruce G. Gellin, MD, MPH Director, National Vaccine Program Office Department
More informationOverview: Chapter 19 Viruses: A Borrowed Life
Overview: Chapter 19 Viruses: A Borrowed Life Viruses called bacteriophages can infect and set in motion a genetic takeover of bacteria, such as Escherichia coli Viruses lead a kind of borrowed life between
More informationPatterns of hemagglutinin evolution and the epidemiology of influenza
2 8 US Annual Mortality Rate All causes Infectious Disease Patterns of hemagglutinin evolution and the epidemiology of influenza DIMACS Working Group on Genetics and Evolution of Pathogens, 25 Nov 3 Deaths
More informationEvolution of the haemagglutinin gene of the influenza A(H1N1)2009 virus isolated in Hong Kong,
Rapid communications Evolution of the haemagglutinin gene of the influenza A(H1N1)2009 virus isolated in Hong Kong, 2009 2011 G C Mak 1, C K Leung 1, K C Cheng 1, K Y Wong 1, W Lim (wllim@pacific.net.hk)
More informationLESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication
DEFINITIONS OF TERMS Eukaryotic: Non-bacterial cell type (bacteria are prokaryotes).. LESSON 4.4 WORKBOOK How viruses make us sick: Viral Replication This lesson extends the principles we learned in Unit
More informationEmerging Diseases. Biosciences in the 21 st Century Dr. Amber Rice October 26, 2012
Emerging Diseases Biosciences in the 21 st Century Dr. Amber Rice October 26, 2012 Outline Disease emergence: a case study Introduction to phylogenetic trees Introduction to natural selection How do pathogens
More informationSeasonal Influenza Report
Seasonal Influenza Report 218 219 CDC Disease Week 45 (November 4 November 1, 218) Updated November 13, 218 Key findings for the 218 219 flu season Current Week (Week 45) Current Season Summary November
More informationARIZONA INFLUENZA SUMMARY Week 1 (1/4/2015 1/10/2015)
ARIZONA INFLUENZA SUMMARY Week 1 (1/4/2015 1/10/2015) 2014-2015 Season (9/28/2014 10/3/2015) Synopsis: Influenza activity is increasing in Arizona. Arizona reported Widespread activity for week 1. Influenza
More informationبسم هللا الرحمن الرحيم
- 1 - - - 1 P a g e بسم هللا الرحمن الرحيم This sheet was made from record section 1 all information are included - Introduction Our respiratory tract is divided anatomically to upper (URT),middle and
More informationVIRUS & LAST UNIVERSAL COMMON ANCESTOR
VIRUS & LAST UNIVERSAL COMMON ANCESTOR JOINT GRADUATE SEMINAR 2015 M.PHIL. STUDENT: CHEUNG KA WING, KELTON SUPERVISOR: DR. MARTIN CHAN 15 TH DEC 2015 DEPARTMENT OF MICROBIOLOGY FACULTY OF MEDICINE THE
More informationCh. 19 Viruses & Bacteria: What Is a Virus?
Ch. 19 Viruses & Bacteria: What Is a Virus? A virus is an invective agent consisting of a nucleic acid in a protein coat, able to multiply only within the living cells of a host. A bacteriophage ( bacteria
More informationHS-LS4-4 Construct an explanation based on evidence for how natural selection leads to adaptation of populations.
Unit 2, Lesson 2: Teacher s Edition 1 Unit 2: Lesson 2 Influenza and HIV Lesson Questions: o What steps are involved in viral infection and replication? o Why are some kinds of influenza virus more deadly
More informationWhat do epidemiologists expect with containment, mitigation, business-as-usual strategies for swine-origin human influenza A?
What do epidemiologists expect with containment, mitigation, business-as-usual strategies for swine-origin human influenza A? Dr Thomas TSANG Controller, Centre for Health Protection, Department of Health
More informationA Universal Trend among Proteomes Indicates an Oily Last Common Ancestor. BI Journal Club Aleksander Sudakov
A Universal Trend among Proteomes Indicates an Oily Last Common Ancestor BI Journal Club 11.03.13 Aleksander Sudakov Used literature Ranjan V. Mannige, Charles L. Brooks, and Eugene I. Shakhnovich. 2012.
More informationConfounding in influenza VE studies in seniors, and possible solutions
Confounding in influenza VE studies in seniors, and possible solutions Michael L. Jackson Group Health Research Institute 4 th December, 2012 1 Outline Focus is on non-specific outcomes (e.g. community-acquired
More informationPhylogenetic Methods
Phylogenetic Methods Multiple Sequence lignment Pairwise distance matrix lustering algorithms: NJ, UPM - guide trees Phylogenetic trees Nucleotide vs. amino acid sequences for phylogenies ) Nucleotides:
More informationSize nm m m
1 Viral size and organization Size 20-250nm 0.000000002m-0.000000025m Virion structure Capsid Core Acellular obligate intracellular parasites Lack organelles, metabolic activities, and reproduction Replicated
More informationBuilding complexity Unit 04 Population Dynamics
Building complexity Unit 04 Population Dynamics HIV and humans From a single cell to a population Single Cells Population of viruses Population of humans Single Cells How matter flows from cells through
More informationIt is well known that some pathogenic microbes undergo
Colloquium Effects of passage history and sampling bias on phylogenetic reconstruction of human influenza A evolution Robin M. Bush, Catherine B. Smith, Nancy J. Cox, and Walter M. Fitch Department of
More informationInfluenza Pandemic Preparedness for Clinicians on the Frontline
Influenza Pandemic Preparedness for Clinicians on the Frontline CAPT HA C. TANG, DO US Public Health Service Adjunct Associate Clinical Professor of Dartmouth Medical School, Community/Family Medicine
More informationDr. Gary Mumaugh. Viruses
Dr. Gary Mumaugh Viruses Viruses in History In 1898, Friedrich Loeffler and Paul Frosch found evidence that the cause of foot-and-mouth disease in livestock was an infectious particle smaller than any
More informationGrade Level: Grades 9-12 Estimated Time Allotment Part 1: One 50- minute class period Part 2: One 50- minute class period
The History of Vaccines Lesson Plan: Viruses and Evolution Overview and Purpose: The purpose of this lesson is to prepare students for exploring the biological basis of vaccines. Students will explore
More informationCE Unit. Viruses and Vaccines
CE Unit Viruses and Vaccines DO NOT WRITE What is a virus? Have you ever had a virus? What is a vaccine? How is a virus different from bacteria? What are the deadliest viruses? 10. Dengue fever 50 million
More informationViruses: Select Agents and Emerging Pathogens. Patricia Bolívar MS., CLS, PHM
Viruses: Select Agents and Emerging Pathogens Patricia Bolívar MS., CLS, PHM Objectives Review Select Agent Viruses. Key features to recognize Smallpox virus Update on emerging Viruses of possible pandemic
More informationOutbreak Response/Epidemiology Influenza Weekly Report Arkansas
Nathaniel Smith, MD, MPH, Director and State Health Officer Outbreak Response/Epidemiology Influenza Weekly Report Arkansas 2018-2019 Week Ending Saturday 10/20/2018 Dirk Haselow, MD, PhD State Epidemiologist,
More informationName Class Date. Infection in which a virus inserts its nucleic acid into the DNA of the host cell and is duplicated with the cell s DNA
Name Class Date 20.1 Viruses Lesson Objectives Explain how viruses reproduce. Explain how viruses cause infection. BUILD Vocabulary A. The chart below shows key terms from the lesson with their definitions.
More information2.1 VIRUSES. 2.1 Learning Goals
2.1 VIRUSES 2.1 Learning Goals To understand the structure, function, and how Viruses replicate To understand the difference between Viruses to Prokaryotes and Eukaryotes; namely that viruses are not classified
More informationLecture 6. Burr BIO 4353/6345 HIV/AIDS. Tetramer staining of T cells (CTL s) Andrew McMichael seminar: Background
Lecture 6 Burr BIO 4353/6345 HIV/AIDS Andrew McMichael seminar: Background Tetramer staining of T cells (CTL s) 1. Vβ 19: There are 52 T cell receptor (TCR) Vβ gene segments in germ line DNA (See following
More informationViruses. Rotavirus (causes stomach flu) HIV virus
Viruses Rotavirus (causes stomach flu) HIV virus What is a virus? A virus is a microscopic, infectious agent that may infect any type of living cell. Viruses must infect living cells in order to make more
More information18.2 Viruses and Prions
KEY CONCEPT Infections can be caused in several ways. Viruses, bacteria, viroids, and prions can all cause infection. Any disease-causing agent is called a pathogen. 1 nanometer (nm) = one billionth of
More informationLesson 20 Study Guide: Medical Biotechnology Pandemic Flu & Emergent Disease
URI CMB 190 Issues in Biotechnology Lesson 20 Study Guide: Medical Biotechnology Pandemic Flu & Emergent Disease 1. The film Contagion: (A) entirely depicts a situation that could never possibly happen
More informationEvolution of hepatitis C virus in blood donors and their respective recipients
Journal of General Virology (2003), 84, 441 446 DOI 10.1099/vir.0.18642-0 Short Communication Correspondence Jean-François Cantaloube jfc-ets-ap@gulliver.fr Evolution of hepatitis C virus in blood donors
More informationSeasonal Influenza Report
Key findings for the 2017 2018 flu season October 1 st, 2017 (CDC Disease Week 40) marked the beginning of the 2017 2018 influenza season. Influenza activity is increasing in California. As of November
More informationEVOLUTIONARY TRAJECTORY ANALYSIS: RECENT ENHANCEMENTS. R. Burke Squires
EVOLUTIONARY TRAJECTORY ANALYSIS: RECENT ENHANCEMENTS R. Burke Squires Pandemic H1N1 2009 Origin? April / May 2009 Cases of an Influenza-like Illness (ILI) occurred in California, Texas and Mexico New
More informationQ1. (a) (i) Some diseases can be tackled by using antibiotics and vaccination. Explain fully why antibiotics cannot be used to cure viral diseases.
Q. (a) (i) Some diseases can be tackled by using antibiotics and vaccination. Explain fully why antibiotics cannot be used to cure viral diseases......... (ii) A recent study found that babies in 90 %
More informationChapter 08 Lecture Outline
Chapter 08 Lecture Outline See separate PowerPoint slides for all figures and tables preinserted into PowerPoint without notes. Copyright 2016 McGraw-Hill Education. Permission required for reproduction
More informationHIV Drug Resistance. Together, we can change the course of the HIV epidemic one woman at a time.
HIV Drug Resistance Together, we can change the course of the HIV epidemic one woman at a time. #onewomanatatime #thewellproject What Is Resistance? HIV drugs are designed to keep the amount of HIV virus
More informationVaccine prevention for existing and emerging viral threats
Vaccine prevention for existing and emerging viral threats Viruses in May Blue Mountains 18 May 2018 www.ncirs.edu.au https://www.apprise.org.au/ Prof Kristine Macartney Director, NCIRS www.ncirs.usyd.edu.au
More informationPublic Health Resources: Core Capacities to Address the Threat of Communicable Diseases
Public Health Resources: Core Capacities to Address the Threat of Communicable Diseases Anne M Johnson Professor of Infectious Disease Epidemiology Ljubljana, 30 th Nov 2018 Drivers of infection transmission
More informationANISE 2018, Antananarivo, Madagascar. US Centers for Disease Control and Prevention (CDC), Co-Ag. No: U011P
Influenza disease burden in the Greater-Accra region of Ghana, 2013-2017 Michael Ntiri, Jazmin Duque, Meredith McMorrow, Talla Nzussouo, Elijah Paa Edu-Quansah, Kwadwo Koram, William Ampofo US Centers
More informationEVOLUTION: WHY DOES IT MATTER? What did evolution ever do for me?
EVOLUTION: WHY DOES IT MATTER? What did evolution ever do for me? www.christs.cam.ac.uk/darwin200 Evolution is change in living things through descent with modification Evolution is change in living things
More informationMEETING THE STANDARDS: FDA MANDATORY RAPID INFLUENZA DETECTION TEST (RIDTs) RECLASSIFICATION
MEETING THE STANDARDS: FDA MANDATORY RAPID INFLUENZA DETECTION TEST (RIDTs) RECLASSIFICATION NOVEMBER 6, 2017 SALLY A. HOJVAT M.Sc., Ph.D. Retired as Director of FDA Division of Microbiology Devices, CDRH
More informationOutbreak Response/Epidemiology Influenza Weekly Report Arkansas
Nathaniel Smith, MD, MPH, Director and State Health Officer Outbreak Response/Epidemiology Influenza Weekly Report Arkansas 7- Week Ending Saturday // Dirk Haselow, MD, PhD State Epidemiologist, Medical
More informationPhylogenetic Tree Practical Problems
Phylogenetic Tree Practical Problems Software Tools: MEGA A software package for constructing phylogenetic trees using neighbor-joining, UPGMA, and maximum parsimony. ClustalW A tool for constructing multiple
More informationFlu Watch. MMWR Week 3: January 14 to January 20, and Deaths. Virologic Surveillance. Influenza-Like Illness Surveillance
Flu Watch MMWR Week 3: January 14 to January 2, 218 All data are provisional and subject to change as more reports are received. Geographic Spread South Carolina reported widespread activity this week.
More informationInfluenza Prevention Update
Influenza Prevention Update Dean A. Blumberg, MD, FAAP Disclosure speakers bureau: sanofi pasteur, Merck Discussion off label use of FDA approved vaccines Influenza Prevention Update Seasonal influenza
More informationSeasonal Influenza Report
Key findings for the 2017 2018 flu season Seasonal Influenza Report 2017 2018 Influenza activity is widely circulating in California. As of week 52 (December 24 30, 2017), the statewide geographic distribution
More information1/29/2013. Viruses and Bacteria. Infectious Disease. Pathogens cause disease by: Chapters 16 and 17
Viruses and Bacteria Chapters 16 and 17 Infectious Disease Caused by the invasion of a host by agents whose activities harm the host s tissues Can be transmitted to others Pathogen microorganisms that
More informationFlu Watch. MMWR Week 4: January 21 to January 27, and Deaths. Virologic Surveillance. Influenza-Like Illness Surveillance
Flu Watch MMWR Week 4: January 21 to January 27, 218 All data are provisional and subject to change as more reports are received. Geographic Spread South Carolina reported widespread activity this week.
More informationIdentification of Mutation(s) in. Associated with Neutralization Resistance. Miah Blomquist
Identification of Mutation(s) in the HIV 1 gp41 Subunit Associated with Neutralization Resistance Miah Blomquist What is HIV 1? HIV-1 is an epidemic that affects over 34 million people worldwide. HIV-1
More informationSeasonal Influenza Report
Key findings for the 2017 2018 flu season Seasonal Influenza Report 2017 2018 Influenza activity remains elevated throughout California. As of 2018 week 9 (February 25 March 3, 2018), the statewide geographic
More informationBiosafety and Bioethics
Biosafety and Bioethics Special Challenges of Gain-of Function Experiments and Potential Pandemic Pathogens Marc Lipsitch, D.Phil. Eagleson Lecture, ABSA October 22, 2013 Kansas City Funded by the National
More informationRunning head: INFLUENZA VIRUS SEASON PREPAREDNESS AND RESPONSE 1
Running head: INFLUENZA VIRUS SEASON PREPAREDNESS AND RESPONSE 1 Electron micrograph of H1N1 Virus (CDC, 2009) Influenza Virus Season Preparedness and Response Patricia Bolivar Walden University Epidemiology
More informationBiology 350: Microbial Diversity
Biology 350: Microbial Diversity Strange Invaders: Viruses, viroids, and prions. Lecture #27 7 November 2007-1- Notice handouts and announcements for today: Outline and study questions A 1999 paper discussing
More informationAcute respiratory illness This is a disease that typically affects the airways in the nose and throat (the upper respiratory tract).
Influenza glossary Adapted from the Centers for Disease Control and Prevention, US https://www.cdc.gov/flu/glossary/index.htm and the World Health Organization http://www.wpro.who.int/emerging_diseases/glossary_rev_sept28.pdf?ua=1
More informationChapter 19: The Genetics of Viruses and Bacteria
Chapter 19: The Genetics of Viruses and Bacteria What is Microbiology? Microbiology is the science that studies microorganisms = living things that are too small to be seen with the naked eye Microorganisms
More informationINTERfering and Co-Evolving Prevention and Therapy (INTERCEPT) Proposers Day
INTERfering and Co-Evolving Prevention and Therapy (INTERCEPT) Proposers Day Dr. Jim Gimlett, Program Manager DARPA Biological Technologies Office (BTO) April 28, 2016 Arlington, VA INTERCEPT Agenda INTERCEPT
More informationIS THE UK WELL PREPARED FOR A REPEAT OF THE 1918 INFLUENZA PANDEMIC?
Cambridge Judge Business School Centre for Risk Studies IS THE UK WELL PREPARED FOR A REPEAT OF THE 1918 INFLUENZA PANDEMIC? Dr Andrew Coburn Chief Scientist Cambridge Centre for Risk Studies 5 December
More informationMalik Sallam. Ola AL-juneidi. Ammar Ramadan. 0 P a g e
1 Malik Sallam Ola AL-juneidi Ammar Ramadan 0 P a g e Today's lecture will be about viral upper respiratory tract infections. Those include: common cold, sinusitis, otitis, etc. Infections in the upper
More informationInfluenza. By Allison Canestaro-Garcia. Disease Etiology:
Influenza By Allison Canestaro-Garcia Disease Etiology: The flu is an infectious disease caused by a subset of viruses of the family Orthomyxoviridae. There are 7 different viruses in this family, four
More informationViruses. and Prions. ct o, ni, 21. Viruses. Table 2. Essential Questions
ct o, ni, 21 Essential Questions ;1 What is the general structure of a virus? What are similarities and differences in the lytic cycle, the lysogenic cycle, and retroviral replication? I What is the relationship
More informationInfluenza vaccine effectiveness assessment in the UK. Nick Andrews, Statistics Unit, Health Protection Agency
Influenza vaccine effectiveness assessment in the UK Nick Andrews, Statistics Unit, Health Protection Agency 1 Outline Introduction The UK swabbing schemes Assessment by the test negative case control
More informationARIZONA INFLUENZA SUMMARY
ARIZONA INFLUENZA SUMMARY Week 47 (11/19/2017 11/25/2017) Synopsis: Influenza activity is increasing. Arizona reported Local Activity for week 47. Influenza activity highlights: 2017 2018 Influenza Season
More informationHow to Use This Presentation
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right arrow key or
More informationOrigins and evolutionary genomics of the novel avian-origin H7N9 influenza A virus in China: Early findings
Origins and evolutionary genomics of the novel 2013 avian-origin H7N9 influenza A virus in : Early findings Jiankui He*, Luwen Ning, Yin Tong Department of Biology, South University of Science and Technology
More informationSex, viruses, and the statistical physics of evolution
Sex, viruses, and the statistical physics of evolution Cartoon of Evolution A TC G Selection Genotypes Mutation & Recombination Mutation...ATACG... Sex & Recombination Selection...ATGCG... Richard Neher
More informationInfluenza Updates. The newsletter of the WHO Collaborating Centre for Reference and Research on Influenza in Melbourne
Influenza Updates The newsletter of the WHO Collaborating Centre for Reference and Research on Influenza in Melbourne Volume 5, Issue 1, April 016 Preparation for the Southern Hemisphere influenza season
More informationDurham Region Influenza Bulletin: 2017/18 Influenza Season
Durham Region Influenza Bulletin: 2017/18 Influenza Season Surveillance Week 21 (May 20, 2018 to May 26, 2018) Table 1: Assessment of influenza activity in Durham Region Measure Laboratory confirmed cases
More informationImage of Ebola viruses exiting host cells HUMAN VIRUSES & THE LIMITATION OF ANTIVIRAL DRUG AGENTS
Image of Ebola viruses exiting host cells HUMAN VIRUSES & THE LIMITATION OF ANTIVIRAL DRUG AGENTS MAY 2017 1 Infectious viral pathogens are a significant global health threat to mankind 2 Since the approval
More informationRESEARCH NOTE ANTIGENIC AND GENETIC CHARACTERIZATION OF INFLUENZA B VIRUSES IN 2012 FROM SLUMS, DHAKA, BANGLADESH
RESEARCH NOTE ANTIGENIC AND GENETIC CHARACTERIZATION OF INFLUENZA B VIRUSES IN 2012 FROM SLUMS, DHAKA, BANGLADESH Mohammad Ariful Islam 1,2, Nazneen Sultana 1, Firoz Ahmed 3, M Majibur Rahman 1 and Sabita
More informationAn Evolutionary Story about HIV
An Evolutionary Story about HIV Charles Goodnight University of Vermont Based on Freeman and Herron Evolutionary Analysis The Aids Epidemic HIV has infected 60 million people. 1/3 have died so far Worst
More informationHost Dependent Evolutionary Patterns and the Origin of 2009 H1N1 Pandemic Influenza
Host Dependent Evolutionary Patterns and the Origin of 2009 H1N1 Pandemic Influenza The origin of H1N1pdm constitutes an unresolved mystery, as its most recently observed ancestors were isolated in pigs
More informationNew Brunswick Influenza Activity Summary Report: season (Data from August 30,2015 to June 4,2016)
New Brunswick Influenza ctivity Summary Report: - season (Data from ugust 30, to June 4,) Highlights of the - Influenza season: This season, we experienced later influenza activity than expected. This
More informationInfluenza Awareness in Berlin and Montpelier, VT
University of Vermont ScholarWorks @ UVM Family Medicine Block Clerkship, Student Projects College of Medicine 2017 Influenza Awareness in Berlin and Montpelier, VT Nathan L. Centybear University of Vermont
More informationInfluenza Virus: Evolution of a Deadly Virus in our World
Influenza Virus: Evolution of a Deadly Virus in our World Cathy M. St. Pierre, PhD, APRN, FNP-BC, FAANP ENRM. VA HOSPITAL Bedford, Massachusetts, USA ACKNOWLEDGEMENT THIS AUTHOR WOULD LIKE TO GRATEFULLY
More information