Advanced Molecular Detection
|
|
- Martha Hicks
- 6 years ago
- Views:
Transcription
1 Advanced Molecular Detection CAPHLD /10/18 Lafayette, CA Duncan MacCannell National Center for Emerging and Zoonotic Infectious Diseases Office of Advanced Molecular Detection
2 Nucleotides per $1,000 The Impact of NGS on Life Sciences 100,000,000 Sanger Sequencing Next-Generation Sequencing 10,000,000 1,000, ,000 10,000 1,000 Moore s Law Adapted from NHGRI (
3
4 Library Data Info. ACAATTTGTGCATAACATGTGGACAGTTTTAATCACATGTGGGTAAATAGTTGTCCACATTTGCTTTTTT TGTCGAAAACCCTATCTCATATACAAACGACGTTTTTAGGTTTTAAAATACGTTTCGTATAAATATACAT TTTATATTTATTAGGTTGTACATTTGTTGCGCAACCTTATTCTTTTACCATCTTAGTAAAGGAGGGACAC CTTTGGAAAATATCTCTGATTTATGGAATAGTGCCTTAAAAGAATTAGAAAAAAAGGTAAGCAAGCCTAG TTATGAAACATGGTTAAAATCAACAACGGCTCATAACTTGAAGAAAGACGTATTAACGATTACAGCTCCA AATGAATTTGCTCGTGACTGGCTAGAATCTCATTACTCAGAACTTATTTCGGAAACACTATACGATTTAA CAGGGGCAAAATTAGCAATTCGCTTTATTATTCCCCAAAGTCAATCGGAAGAGGACATTGATCTTCCTCC AGTTAAGCGGAATCCAGCACAAGATGATTCAGCTCATTTACCACAGAGCATGTTAAATCCAAAATATACA TTTGATACATTTGTTATCGGCTCTGGTAACCGTTTTGCCCATGCAGCTTCATTAGCTGTAGCCGAGGCGC CAGCTAAAGCGTATAATCCACTCTTTATTTATGGGGGAGTTGGGCTTGGAAAGACGCATTTAATGCACGC AATTGGTCATTATGTAATTGAACATAATCCAAATGCAAAAGTTGTATATTTATCATCAGAAAAATTCACG AATGAATTTATTAACTCTATTCGTGATAATAAAGCTGTTGATTTTCGTAATAAATATCGCAACGTAGATG Input: DNA/RNA Source: Genomic Amplicon Whole sample Host/vector/ pathogen/ environment NGS Workflow: Platforms Chemistry Perf. char. Labor/TaT Expertise Cost Increasingly Universal Workflows Working to establish standardized sequencing workflows for a wide range of pathogens. Sample intake Prep/staging Extraction Conversion Library prep Sequencing Bioinformatics Workflow: Hardware/software Specialized skillsets Algorithms/pipelines Pathogen databases Data analysis/interpret/ Integration/visualization A Moving Target Rapidly evolving technology space. Changing hardware and COTS/OSS capabilities. Lots of choice, but lack of consistent standards. BIG DATA. New workforce and skillset is required. File hashes/versioning QA/QC Security Validated methods/databases Skills/proficiency Process logging/audit Standards Reporting Pathogen- and application-specific, standard and/or compliant assays Output: Information From Sequence Data Comparative Genomics Identification High res Straintyping/Subtyping Cluster identification Molecular evolution Genotypic characterization Virulence, AR, signatures Functional annotation Diagnostic dev/validation Minor populations, quasispecies Host/pathogen expression Metagenomics Pathogen identification/discovery Culture-independent diagnostics Microbial ecology/diversity Many results from a single dataset. Faster and cheaper than serial tests.
5 Advanced Molecular Detection (AMD) 2011: Bioinformatics Blue Ribbon Panel 2014: Advanced Molecular Detection and Response to Infectious Disease Outbreaks (AMD) initiative approved by Congress $30M/yr public health modernization and innovation program Five key objectives of the AMD initiative: 1. Improve pathogen detection and characterization 2. Enable new diagnostic methods to meet public health needs 3. Support genomic and bioinformatics needs in the US public health system 4. Implement enhanced, sustainable, integrated information systems 5. Develop tools for prediction, modeling and early recognition of emerging infectious threats
6 AMD: Areas of Emphasis [1] Advanced laboratory technologies and approaches Coordinate and fund the rollout of new technologies NGS for pathogen (meta)genomics and (meta) transcriptomics. Platforms: Illumina, PacBio, IonTorrent, Oxford Nanopore, others Other tech: MALDI-ToF, Optical Mapping, microfluidics, etc. CDC facilities; state/local public health laboratories. Field. Information technology IT infrastructure: storage, networking, high-performance computing, cloud. Bioinformatics and scientific computing core support; High Performance Computing Center of Excellence Lab/epi data aggregation, integration, visualization and reporting.
7 AMD: Areas of Emphasis [2] Strategic coordination and program support Funding of 30+ CDC AMD project activities/year Establishment of standard platforms, methods and shared resources. Coordination of state-based activities and initiatives. Coordination with federal (FDA, NIH, NIST, DoD, DHS), NGOs, academic centers, int l consortia. Workforce Development Training, recruitment, administrative, fellowships Collaboration, openness, partnerships and innovation.
8 Highest Impact Areas in Near Future Domain Bacterial foodborne pathogens (PulseNet, 85+ labs) Objective Move from PFGE to WGS Address the threat from culture-independent diagnostic tests (CIDT) Tuberculosis Move from MIRU/VNTR typing to WGS Develop means of WGS directly from sample Influenza Move from traditional typing of isolates to WGS directly from samples Develop cloud-based information system Hospital-acquired and antimicrobial resistant organisms Develop standards for typing Develop methods for assessing relatedness in outbreaks Develop microbiome disruption index Move GC typing from traditional phenotyping to WGS
9 Foodborne Disease Surveillance ~48 million foodborne illnesses occur in the U.S. each year, resulting in ~128,000 hospital admissions and 3,000 deaths Although most cases occur as part of unrecognized outbreaks, >1,000 outbreaks are reported each year PulseNet, a national network of public health and food regulatory agency laboratories, has played a key role in identifying and stopping outbreaks of foodborne illness Pathogens/foods linked to most foodborne illnesses Campylobacter (poultry) E. coli O157 (ground beef, leafy greens, raw milk) Listeria (deli meats, unpasteurized soft cheeses, produce) Salmonella (eggs, poultry, meat, produce) Vibrio (raw oysters) Norovirus (common in many foods) Toxoplasma (meats)
10 Salmonella Heidelberg (May-July 2013) WGS-based analysis of putative multistate cluster of PFGE-indistinguishable Salmonella Heidelberg (XbaI: JF6X ). Contemporary timeframe, similar presentations, possible link Reference-NC T-3110-M947-AL T-3109-M947-AL T-3042-M947-AL T-3040-AL T-3059-AL T-3111-AL Food T-3112-M947-AL T-3050-AL T-3041-M947-AL T-3058-M947-AL AM-0487-NYC AM-0488-NYC AM-0486-NYC 2013K-1067-NE K-1036-OH K-1038-M02163-CO K-1040-CO K-1039-CO 2013K-1037_NC ALABAMA (Funeral) 6-13 SNP differences NEW YORK (Childcare) SNP differences COLORADO (Family Gathering) 6-9 SNP differences 10
11 WGS Challenges: A Data Deluge For PulseNet USA alone: >80,000 isolates/year x 1 to 5 GB raw sequence/isolate terabytes of raw data/year Transmission, management, storage and archiving? Data architectures and analytics? Metadata? Warehousing? Distributed processing? Data compression? Integration? Is full WGS the right approach for large-scale surveillance?
12 PulseNet NG: Dataflow STATE/LOCAL PHL refid metadata pass/fail QC correct ID Sequencing Lab refid metadata Reference DB (Local) Surveillance DB (Local) * Does not imply endorsement by CDC or HHS. Taxa Identification (ANI) Basic QC (raw reads, denovo) Presumptive serotype, AST, etc Straintype (wgmlst) Assembly / Genotype Straintype (wgmlst) Assembly RAW READS MIN METADATA Allele/ Nomenclature DB refid fastq CEStore Temp storage and staging of incoming sequence data (fastq.gz) Calculation Engine (HPC) Average Nuc Ident (ANI) Read/run QC De Novo Assembly Straintype (wgmlst/snp) Surveillance DB (National)
13 Nationwide Listeriosis Surveillance Using WGS Collaboration with: Federal Agencies FDA, NCBI, USDA All state public health laboratories France, UK, Denmark, Australia, and Canada Analysis of all ~1000 annual U.S. clinical cases of Listeria monocytogenes infection and some food/environmental sources Provides foundational infrastructure and methods for next generation PulseNet and a generalizable platform for genome-scale molecular epidemiologic surveillance. Harmonization with FDA GenomeTrackr. 9,592 isolates, as of October 17, ftp://ftp.ncbi.nlm.nih.gov/pathogen/results/listeria/latest
14 Listeria Cluster Metrics Pre/Post WGS Pre-WGS (Sept 2012 Aug 2013) WGS Year 1 (Sept 2013 Aug 2014) WGS Year 2 (Sept 2014 Aug 2015) No. of clusters detected No. of clusters detected sooner or only by WGS No. of outbreaks solved (food source identified) Median no. of cases per cluster 16 No. of cases linked to food source Jackson et al. 2016
15 PulseNet Sequencing by States (FY16) Pathogen Type Isolates Sequenced STEC 3,115 Salmonella 3,207 Campylobacter 787 Listeria 394 Vibrio 18 TOTAL: 7,525 isolates Over 150% FY16 target. Yersinia 4 27 labs in 24 states are now PulseNet WGS certified. 1 PulseNet International site.
16 NCBI Metadata Submission Immediate public release (to NCBI when the sequence is uploaded) Unique sample ID (WGS_ID) Organism genus and species (e.g., Listeria monocytogenes) Organism source (clinical, environmental) Country of origin (USA) Organism DNA sequence Delayed public release (6 months delay) Isolate source (e.g., blood, cerebral spinal fluid, stool, ground beef, etc.) Organism serotype Collection date (month and year) Geographic location (Region of the US for the case-patient) Age category (in years, 0-4, 5-9, 10-19, 20-29, 30-39, 40-49, 50-59, 60-69, 70-79, 80+)
17 Antibiotic Resistance in the United States Each year, AR pathogens Sicken >2 million people Kill at least 23,000, plus 14,000 from C. difficile Cause >$20B in healthcare costs Comprehensive set of new federal actions to combat the rise of AR bacteria released in Sept 2014 (CARB report) Sets goals for reducing major AR threats over next 5 years Companion AR Action Plan March threat-report-2013/ 1. Working with partners to establish curated reference sets of genomes with attendant susceptibility profiles 2. Working to develop standards and interpretive criteria for genotypic prediction of functional AST. 3. Working to develop NGS data standards for reference AST genotype data sharing. 4. Leveraging laboratory and bioinformatic capacity for ARLN /docs/carb_national_strategy.pdf
18 Mycobacterium tuberculosis Cluster, State X Phylogenetic tree based on conventional genotyping (spoligotyping/miru-vntr) Phylogenetic tree based on WGS ~ 100 Patients
19 Fold Genome Coverage Recovery of MTb gdna from Simulated Sputum Metagenomic Background % Mtb DNA in Sputum H37Rv Genome Position Gene: rrs (16S) Gene: rrl (23S) Gene: rrf (5S) Average Read Depth Post Enrichment % Mtb in Original Sample 99.4% Genome Coverage, Approaching culture sensitivity. Selective capture of Mycobacterium tuberculosis genome, using custom NimbleGen SeqCap probeset. Unpublished data, 2015: Posey, Hopkins, Tyagi, Burns
20 Clutter Mitigation Strategies NUCLEIC ACID EXTRACTION DNA RNA TNA POST-EXTRACTION AND LIBRARY CONSTRUCTION LIBRARY SEQUENCING Differential cell lysis Filtering, Concentration Separation/Pulldown Direct amplification Laser capture, microfluidics Nucleases (RNAse/DNAse) cdna conversion rrna depletion Bind/degrade CpG methylated DNA Preferential separation (mass, seq, chem) Genome/transcriptome amplification Sequencing platform selection Library method and parameters Size selection New platforms/approaches Multiplexing and pooling Bioinformatic strategies Many variables impact sequence yield, quality and bias.
21 AMD Impact on Influenza Vaccine Strain Selection CDC Influenza division is an important player in surveillance and epidemiology of influenza Serves as US National Influenza Center and WHO Collaborating Center for Surveillance, Epidemiology and Control of Influenza Analyses 8,000 12,000 influenza samples/year in support of surveillance and selection of vaccine strains o o Vaccine is produced in a just in time fashion 150 Million vaccine doses/year in the US Evolution of influenza is very rapid Critical to find variants quickly Antigenic drift Reassortment AMD improves characterization High throughput NGS sequencing for influenza surveillance Antigenic inference
22 Transforming Influenza Surveillance: Before NGS Sample Batching & Shipping Sequence First Strategy Viral culture (typically, 2-3 passages) Phenotyping, including antigenic typing N 10,000 Selection based on antigenic type Antigenic subtyping Sanger Sequencing N weeks (longer if international) 3-4 weeks After NGS Sample NGS Selection based on sequence Viral culture (typically, 2-3 passages) N > 10,000 N week 3-4 weeks Phenotyping, including antigenic typing Advantages Faster Cheaper More samples More data Better data Wentworth, Barnes et al. Unpublished
23 Beth Neuhaus (CDC/NCIRD/ID)
24 HCV Outbreak Investigations 18 cases 154,233 reads 33,767 unique sequences Each node is a unique sequence Different patients are shown in different colors Two sequences are linked if they differ at a single nucleotide position Network analysis using GHOST
25 Other AMD Project Areas FY2016 Diagnostics MicrobeNet ID of unusual bacterial pathogens Unexplained respiratory disease outbreaks HCV infection classification Digital PCR for hepatitis viral load Malaria Anti-malarial resistance in plasmodia Insecticide resistance in vectors Multiplicity of infection WGS for bacterial pathogen typing and inference of phenotype Pneumococcus, GAS, GBS Meningococcus, H. influenza Legionella B. anthracis: forensics B. pertussis: subtyping and investigation of emergence Genomic typing of eukaryotic pathogens Cyclospora, Cryptosporidium Naegleria Leishmania Coccidioides Diagnosis and typing of viral pathogens Viral vaccine-preventable diseases HIV diagnostics and network visualization HCV ( GHOST system) Dengue, chikungunya, & Zika Pathogen discovery Application of NGS Arboviruses Filoviruses
26 AMD: Challenges [1] Pace of innovation: incredible rate of change in technology platforms and capabilities. Lack of standardization: laboratory and bioinformatic methods for sequencing, data analysis, storage, and exchange remain under active development. Data volume and complexity: new technologies represent an increase of six or more orders of magnitude; integration and management challenges outweigh data transmission and storage issues
27 AMD: Challenges [2] Limited reference databases: need comprehensive and well-curated reference databases for context to understand diversity and pathogenic characteristics of new sequences Barriers to data sharing: how do we facilitate data sharing and open, reproducible research while maintaining necessary controls over proprietary and/or personally-identifiable healthcare info? Need for specialized systems and expertise: bioinformatics and data science are new disciplines in public health; technical and computational complexity of tasks can vary widely; turnkey, deployable solutions are needed to ensure sustainable impact across a public health system with differing levels of capacity and resources. Workforce change.
28 Bioinformatics PH Workforce Capacity Like microbiology and epidemiology, good bioinformatics is increasingly critical to good public health. Challenges with recruitment and retention Skilled bioinformaticians are a highly sought-after discipline. Career bioinformaticians with relevant public health/microbiology experience are an extremely rare breed. It is more common to find microbiologists with on-the-job bioinformatics experience -- expand/enable through training. Limited state/federal workforce support (series, competencies, training ) Training and Workforce Development Interdisciplinary communication is vital: translating between program scientific needs and bioinformatics technical specialists. How do we foster bioinformatics skills/specialists in public health? Expanding impact: Regional Training Networks, FSCoE, curricula and best practices, targeted training for epidemiologists/non-lab.
29
30
31 SAS Access Excel EpiInfo for DOS SQL NoSQL Unstructured Data Genomic Data
32
33 AMD Platform Standardization CDC ENTERPRISE IT ENVIRONMENT (OCIO) 4 x Oxford Nanopore MinION 32 x Illumina Mini/MiSeq/MiSeqDx STATE PHL AMD PORTA L INFLUENZA TB Etc. HPC CLUSTERS STORAGE ARRAY (3.6PB) OID Scientific Computing (SCICOMP) 3 x 1 x 3 x Illumina NextSeq 500 Illumina HiSeq 2500 Pacific BioSciences RS II CDC USER COMMUNITY 3 x ThermoFisher IonTorrent PGM
34 AMDPortal (Coming soon!)
35 Advanced Molecular Detection FOLLOW US ON THE WEB: FOLLOW US ON
36 STATE, COUNTY and LOCAL PUBLIC HEALTH DEPARTMENTS * Does not imply endorsement by CDC or HHS. AMD Partnerships and Collaboration
37 National Center for Emerging and Zoonotic Infectious Diseases Office of Advanced Molecular Detection Questions? For more information please contact Centers for Disease Control and Prevention 1600 Clifton Road NE, Atlanta, GA Telephone: CDC-INFO ( )/TTY: Web: The findings and conclusions in this report are those of the authors and do not necessarily represent the official position of the Centers for Disease Control and Prevention.
CDC s Advanced Molecular Detection (AMD) Program and Public Health
CDC s Advanced Molecular Detection (AMD) Program and Public Health Scott Sammons Technology Officer Office of Advanced Molecular Detection National Center for Emerging and Zoonotic Infectious Diseases
More informationAdvanced Molecular Detection: An Overview
Advanced Molecular Detection: An Overview Gregory Armstrong, MD Director Office of Advanced Molecular Detection National Center for Emerging and Zoonotic Infectious Diseases Office of Advanced Molecular
More informationWGS Works! Shared Mission Different Roles APPLICATIONS SEQUENCING (WGS) Non-regulatory. Regulatory CDC. FDA and USDA. Peter Gerner-Smidt, MD ScD
PUBLIC HEALTH FOOD SAFETY APPLICATIONS FOR WHOLE GENOME SEQUENCING (WGS) Peter Gerner-Smidt, MD ScD Chief, Enteric Diseases Laboratory Branch 4 th Asia-Pacific International Food Safety Conference, Penang,
More informationAPHL Next Generation Sequencing (NGS) Survey
Next Generation Sequencing 1. How long has your lab had a sequencer? [If lab does not have a sequencer go to 1a1 through 1a3 and then end survey] [If lab does have a sequencer continue to 1a and the rest
More informationIs Whole Genome Sequencing Really Replacing Traditional Microbiology?
Is Whole Genome Sequencing Really Replacing Traditional Microbiology? Peter Gerner-Smidt, MD, DSc Enteric Diseases Laboratory Branch InFORM II Phoenix, AZ, 18 November 2015 National Center for Emerging
More informationSTEC Whole Genome Sequencing Project
STEC Whole Genome Sequencing Project Eija Trees, PhD, DVM Chief, PulseNet Next Generation Subtyping Methods Unit 16 th Annual PulseNet Update Meeting August 29 th, 2012 National Center for Emerging and
More informationMeeting the Challenge of Changing Diagnostic Testing Practices and the Impact on Public Health Surveillance
National Center for Emerging and Zoonotic Infectious Diseases Meeting the Challenge of Changing Diagnostic Testing Practices and the Impact on Public Health Surveillance Aimee Geissler, PhD, MPH FoodNet
More informationPulseNet on the High Wire
PulseNet on the High Wire 16 th Annual PulseNet Update Meeting 8 th Annual OutbreakNet Meeting Atlanta, Georgia Efrain M. Ribot, Ph.D. PulseNet USA Centers for Disease Control and Prevention National Center
More informationElectronic Test Orders and Results (ETOR)
Electronic Test Orders and Results (ETOR) Portal for Antibiotic Resistance (AR) Lab Network Problem Statement Antibiotic-resistant (AR) bacteria germs that don t respond to the drugs developed to kill
More informationAPril PUlseNet
Issues in Brief Pulsenet: A Critical Food Safety Surveillance System Association of Public Health Laboratories APril 2010 PUlseNet A Critical Food Safety Surveillance System Public health laboratorians
More informationDiagnosis of infectious diseases and confirmation of diagnosis. Molecular epidemiology of emerging/re-emerging pathogens
LA PREPARAZIONE E LA RISPOSTA ALLE EMERGENZE INFETTIVE Padova, 20 settembre 2012 Laboratory advanced technologies in the support of Public Health interventions in infectious disease emergencies Prof. Giorgio
More informationNew Mexico Emerging Infections Program Overview. Joan Baumbach NM Department of Health September 23, 2016
New Mexico Emerging Infections Program Overview Joan Baumbach NM Department of Health September 23, 2016 Emerging Infections Program History Established in 1995 as population-based, scientific, public
More informationImplementing FSMA: CDC s Surveillance Provisions
Implementing FSMA: CDC s Surveillance Provisions Dale Morse, MD, MS Food Safety Forum on Foodborne Illness Surveillance November 3, 2011 National Center for Emerging and Zoonotic Infectious Diseases Division
More informationThe Antibiotic Resistance Laboratory Network
The Antibiotic Resistance Laboratory Network 1 Antibiotic Resistance in the United States Sickens >2 million people per year Kills at least 23,000 people each year Plus 15,000 each year from C. difficile
More informationEvaluation of Tennessee Foodborne Illness and Outbreak Response Using the Council to Improve Foodborne Outbreak and Response (CIFOR) Metrics
Evaluation of Tennessee Foodborne Illness and Outbreak Response Using the Council to Improve Foodborne Outbreak and Response (CIFOR) Metrics 12/31/2014 Tennessee Integrated Food Safety Center of Excellence
More informationTransitioning Public Health Microbiology to Whole Genome Sequencing: Experiences and Plans for Bacterial Foodborne Pathogens
Transitioning Public Health Microbiology to Whole Genome Sequencing: Experiences and Plans for Bacterial Foodborne Pathogens Peter Gerner-Smidt, MD ScD, Chief Enteric Diseases Laboratory Branch 2015 APHL
More informationHow Whole-Genome Sequencing Impacts Outbreak Investigations A Public Health Perspective
How Whole-Genome Sequencing Impacts Outbreak Investigations A Public Health Perspective Anna Carlson, PhD Nebraska Department of Health and Human Services Foodborne Disease Epidemiology Surveillance Coordinator
More informationCenters for Disease Control and Prevention (CDC) FY 2009 Budget Request Summary
Centers for Disease Control and Prevention (CDC) FY 2009 Budget Request Summary The President s FY 2009 Budget Request for the Centers for Disease Control and Prevention (CDC) discretionary funding is
More informationthe Future Hold? May 30, 2018
Food Safety and High-Throughput Sequencing What does the Future Hold? Government Agencies Institute for Food Safety and Health May 30, 2018 Robert Tauxe, MD, MPH Director Division of Foodborne, Waterborne
More informationFoodborne Illness and Outbreak Surveillance in the USA. Alison Samuel, Naghmeh Parto, Emily Peterson
Foodborne Illness and Outbreak Surveillance in the USA Alison Samuel, Naghmeh Parto, Emily Peterson 1 Context Where is the information coming from: Attended the CDC/ Emory University; Environmental Microbiology:
More informationOn behalf of the Infectious Diseases Society of America (IDSA), I offer testimony in
Testimony of the Infectious Diseases Society of America (IDSA) on the Fiscal Year 2018 Department of Health and Human Services Budget Prepared for the U.S. House of Representatives Subcommittee on Labor-HHS-Education
More informationThe UK s National Collection of Type Cultures: Answers to 21 st century public health questions
The UK s National Collection of Type Cultures: Answers to 21 st century public health questions Julie E. Russell Head of Culture Collections 28 th September 2016 Public Health England (PHE) Executive agency
More informationThe Conference for Food Protection Indianapolis, Indiana April 14, 2012 CDC Updat e
The Conference for Food Protection Indianapolis, Indiana April 14, 2012 CDC Updat e Vince Radke, MPH, RS, CP-FS, DAAS, CPH National Center for Environmental Health Centers for Disease Control and Prevention
More informationListeria whole-genome-sequencing EFSA Project. Anses Statens Serum Institut Public Health England University of Aberdeen
Listeria whole-genome-sequencing EFSA Project Anses Statens Serum Institut Public Health England University of Aberdeen Closing gaps for performing a risk assessment on Listeria monocytogenes in ready-to-eat
More informationCouncil for Outbreak Response: Healthcare-Associated Infections & Antibiotic-Resistant Pathogens (CORHA) HICPAC December 1, 2016
Council for Outbreak Response: Healthcare-Associated Infections & Antibiotic-Resistant Pathogens (CORHA) HICPAC December 1, 2016 National Center for Emerging and Zoonotic Infectious Diseases Division of
More informationMultistate Foodborne Outbreaks: Investigation and Communication Process
National Center for Emerging and Zoonotic Infectious Diseases Multistate Foodborne Outbreaks: Investigation and Communication Process Matthew Wise, MPH, PhD Deputy Branch Chief for Outbreak Response Laura
More informationWhole genome sequencing
Downloaded from orbit.dtu.dk on: Dec 20, 2017 Whole genome sequencing Torpdahl, Mia; Löfström, Charlotta; Møller Nielsen, Eva Published in: Publication date: 2014 Document Version Publisher's PDF, also
More informationSurveillance and outbreak response are major components
CHAPTER Performance Indicators for Foodborne Disease Programs Surveillance and outbreak response are major components of states foodborne investigation capacity and are essential for preventing and controlling
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationOutbreak Alert! Trends in Foodborne Illness Outbreaks in the United States ( )
5 th MEETING PAN AMERICAN COMMISSION ON FOOD SAFETY (COPAIA) Rio de Janeiro, Brazil, June 10, 2008 Provisional Agenda Item 5 COPAIA5/5 (Eng.) May, 28 th 2008 ORIGINAL: ENGLISH Outbreak Alert! Trends in
More informationAdvanced Molecular Detection and Epidemiology
National Center for Emerging and Zoonotic Infectious Diseases Advanced Molecular Detection and Epidemiology LCDR Alison Laufer Halpin, PhD Lead, Metagenomics and Molecular Biology Team Clinical and Environmental
More informationDetecting HIV transmission clusters to better prioritize prevention efforts
National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention Detecting HIV transmission clusters to better prioritize prevention efforts Alexa Oster, MD Lead (Acting), Transmission and Molecular
More informationCurrent strategies, initiatives and challenges to mitigate biorisk: Indonesia s experience
Current strategies, initiatives and challenges to mitigate biorisk: Indonesia s experience Head of Delegation HERAWATI SUDOYO MD, PHD Eijkman Institute for Molecular Biology Ministry for Research and Technology
More informationCDC Update Laura G. Brown, Ph.D. National Center for Environmental Health
CDC Update Laura G. Brown, Ph.D. National Center for Environmental Health National Center for Environmental Health Division of Emergency and Environmental Health Services CDC Centers Providing Updates
More informationConference For Healthcare Transparency & Patient Safety. Kraig Humbaugh, MD, MPH Lexington, KY November 13, 2015
Conference For Healthcare Transparency & Patient Safety Kraig Humbaugh, MD, MPH Lexington, KY November 13, 2015 2 Objectives After this presentation, participants will be able to: Explain the importance
More informationIndonesia s challenges and needs in improving national capabilities for disease surveillance, detection and diagnosis and public health systems:
Indonesia s challenges and needs in improving national capabilities for disease surveillance, detection and diagnosis and public health systems: National capabilities in public health systems Indonesia
More informationBacterial Enteric Infections Detected by Culture-Independent Diagnostic Tests FoodNet, United States,
Bacterial Enteric Infections Detected by Culture-Independent Diagnostic Tests FoodNet, United States, 2012 2014 Martha Iwamoto, MD 1, Jennifer Y. Huang, MPH 1, Alicia B. Cronquist, MPH 2, Carlota Medus,
More informationTestimony of the Association for Professionals in Infection Control and Epidemiology (APIC) and
Testimony of the Association for Professionals in Infection Control and Epidemiology (APIC) and The Society for Healthcare Epidemiology of America (SHEA) to the U.S. House of Representatives Appropriations
More informationCanada-U.S. Food Safety Risk Assessment Organization: Case Study
Canada-U.S. Food Safety Risk Assessment Organization: Case Study Wilson Center, Washington DC, Monday, October 23, 2017 Yadira Tejeda, Postdoctoral Research Fellow Lawrence Centre, Ivey Business School,
More informationEuropean Society of Clinical Microbiology and Infectious Diseases (ESCMID) Health in Europe: A Strategic Approach
European Society of Clinical Microbiology and Infectious Diseases (ESCMID) Health in Europe: A Strategic Approach Comments by the ESCMID Executive Committee, http://www.escmid.org The European Society
More informationUpdate of the CDC/HICPAC Guideline: Infection Prevention in Healthcare Personnel
Update of the CDC/HICPAC Guideline: Infection Prevention in Healthcare Personnel David T. Kuhar, M.D. Medical Epidemiologist HICPAC Meeting June 6, 2013 National Center for Emerging and Zoonotic Infectious
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationOutbreak of Salmonella Newport Infections Linked to Cucumbers United States, 2014
Outbreak of Salmonella Newport Infections Linked to Cucumbers United States, 2014 Laura Gieraltowski, PhD, MPH Outbreak Response and Prevention Branch Division of Foodborne, Waterborne, and Environmental
More informationNew York State Health Department's experience with implementing Whole Genome Cluster Analysis for Salmonella outbreak investigations
New York State Health Department's experience with implementing Whole Genome Cluster Analysis for Salmonella outbreak investigations William Wolfgang Wadsworth Center NYSDOH InForm 2013 11/20/13 Current
More informationIntroduction. Future U.S. initiatives regarding the food safety for fresh produce. FoodNet Partners. FoodNet Partners
Introduction Future U.S. initiatives regarding the food safety for fresh produce This presentation is based upon FDA s testimony about the E. coli outbreaks to the U.S. Congress delivered on November 15,
More informationUSDA APHIS One Health Initiative
Biorisk Management in a One Health World USDA APHIS One Health Initiative Joseph F. Annelli, DVM, MS One Health Coordination Center U.S. Department of Agriculture Animal and Plant Health Inspection Service
More informationEpiSeq : A Next-Generation Sequencing Service for Infectious Disease Outbreak Management
EpiSeq : A Next-Generation Sequencing Service for Infectious Disease Outbreak Management CPTR 2016 Workshop Washington, DC M.Rodrigue April 7th, 2016 1 Healthcare Associated Infection A Global Burden KNOWING
More informationPeter Gerner-Smidt, M.D., D.M.S. Enteric Diseases Laboratory Branch, CDC
How International Surveillance of Foodborne Infections is Performed The Role of The WHO Global Foodborne Infections Network, PulseNet International, WHO-INFOSAN and WHO-IHR Peter Gerner-Smidt, M.D., D.M.S
More informationVibrio outbreak and surveillance: Maryland's collaborative approach
Vibrio outbreak and surveillance: Maryland's collaborative approach Catey Dominguez, Ph.D Developmental Scientist Maryland Department of Health Core Sequencing James Pettengill PhD Biostatistics and Bioinformatics
More informationAdam Aragon Lisa Onischuk Paul Torres NM DOH, Scientific Laboratory Division
Adam Aragon Lisa Onischuk Paul Torres NM DOH, Scientific Laboratory Division New Mexico Scientific Laboratories 1101 Camino de Salud, NE Albuquerque, NM 87102 Scientific Laboratory Division SLD Office
More informationWHO s code of conduct for open and timely sharing of pathogen genetic sequence data during outbreaks of infectious disease
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 WHO s code of conduct for open and timely sharing of pathogen genetic sequence data during outbreaks of infectious
More informationNashville, Tennessee. Assignment Description
Infectious Diseases-Foodborne, Infectious Diseases Tennessee Department of Health, Communicable and Environmental Disease Services and Emergency Preparedness Nashville, Tennessee Assignment Description
More informationUSING WGS FOR SURVEILLANCE, CLUSTER DETECTION, AND EPI INVESTIGATIONS IN WASHINGTON Washington State Department of Health
USING WGS FOR SURVEILLANCE, CLUSTER DETECTION, AND EPI INVESTIGATIONS IN WASHINGTON Washington State Department of Health Washington State Local Health Jurisdictions *Agency leader is both director and
More informationOn behalf of the Infectious Diseases Society of America (IDSA), I am pleased to provide
Transmitted by Jonathan Nurse, Director of Government Relations, IDSA The Infectious Diseases Society of America s (IDSA) Fiscal Year 2015 Funding Statement Submitted to the House Appropriations Subcommittee
More informationWhat's for dinner? Current issues in foodborne illness
What's for dinner? Current issues in foodborne illness Alicia Cronquist, RN, MPH Foodborne/Enteric Disease Epidemiologist Colorado Dept. of Public Health and Environment Today s Goals What s new in foodborne
More informationCDC and PHLIP. Genny Barkocy-Gallagher, Ph.D. CDC Infectious Diseases LIMS Coordinator. APHL Annual Meeting June 6, 2010
CDC and PHLIP Genny Barkocy-Gallagher, Ph.D. CDC Infectious Diseases LIMS Coordinator APHL Annual Meeting June 6, 2010 CDC Infectious Diseases and PHLIP Infectious Diseases laboratories at CDC Organization
More informationImproving surveillance and early detection of outbreaks. Frank M. Aarestrup
Improving surveillance and early detection of outbreaks Frank M. Aarestrup www.compare-europe.eu www.genomicepidemiology.org INFECTIOUS DISEASES Direct cause of 22% of all global deaths (15 million), huge
More informationCIFOR performance measure Measurement methods Target Range Minnesota 2013 Performance 1. Foodborne illness complaint reporting system:
CIFOR Target Ranges for Select Performance Measures Interested in calculating the CIFOR target range performance measures for your jurisdiction, but have questions or need assistance? Contact Joshua.rounds@state.mn.us
More informationPosition Statement Template
Submission Date: 6/27/2005 05-ID-02 Position Statement Template Committee: Infectious Disease Title: National Guidelines for Foodborne Enteric Disease Surveillance and Response Statement of the Problem:
More informationSurveillance and outbreak investigation of Shiga toxin-producing Escherichia coli using whole genome sequencing- time for a change!
Surveillance and outbreak investigation of Shiga toxin-producing Escherichia coli using whole genome sequencing- time for a change! Dr Marie Anne Chattaway Deputy Head STEC Laboratory Gastrointestinal
More informationUnderstanding the Public Health Significance of Shiga Toxin-Producing E. coli. Betsy Booren, Ph.D. Director, Scientific Affairs
Understanding the Public Health Significance of Shiga Toxin-Producing E. coli Betsy Booren, Ph.D. Director, Scientific Affairs June 21, 2011 A New Concern for the Meat Industry? The meat industry has long
More informationSimplified Modeling Framework for Microbial Food-Safety Risk Assessments
Food Safety and Inspection Service Simplified Modeling Framework for Microbial Food-Safety Risk Assessments Michael Williams Risk Assessment and Analytics Staff Food Safety and Inspection Service, USDA
More informationBenchmark datasets for phylogenomic pipeline validation
Benchmark datasets for phylogenomic pipeline validation GenomeTrakr Meeting Sept. 2018 Ruth E. Timme, PhD Research Microbiologist GenomeTrakr data coordinator Validation for phylogenomics Phylogenomic
More informationUtilization of NCBI Pathogen Detection Tool in USDA FSIS
Utilization of NCBI Pathogen Detection Tool in USDA FSIS Glenn Tillman, Ph.D. Branch Chief Microbiology: Characterization Branch FSIS Office of Public Health and Science Glenn.tillman@fsis.usda.gov 1 Background
More informationCenter for Global Health. CDC Global Health Saving Lives Overseas, Protecting Americans at Home
Center for Global Health CDC Global Health Saving Lives Overseas, Protecting Americans at Home CDC Overview Part of the U.S. Department of Health and Human Services, CDC is the nation s leading public
More informationChain of Infection Agent Mode of transmission Contact (direct, indirect, droplet spread) Airborne Common-vehicle spread Host
Goals Microbiology of Healthcare-associated Infections William A. Rutala, Ph.D., M.P.H. Director, Statewide Program for Infection Control and Epidemiology and Research Professor of Medicine, University
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationOutbreak Investigations and Whole Genome Sequencing
Outbreak Investigations and Whole Genome Sequencing Adiam Tesfai, PHD FDA CFSAN Coordinated Outbreak Response and Evaluation GenomeTrakr Meeting September 7,018 Outline Role of FDA in Foodborne Outbreak
More informationConference for Food Protection 2014 Issue Form. Accepted as
Conference for Food Protection 2014 Issue Form Internal Number: 017 Issue: 2014 I-021 Council Recommendation: Accepted as Submitted Accepted as Amended No Action Delegate Action: Accepted Rejected All
More informationE. coli O157:H7 - Multistate Outbreak Associated with Hazelnuts, 2010
Introduction This series focuses on investigations of outbreaks caused by commercially distributed food items and detected through pathogen specific surveillance. The etiologic agents often are Salmonella,
More informationFood Safety and Inspection Service ~~ Update ~~
~~ Update ~~ Farm-To-Fork Continuum 7 th Annual OutbreakNet Conference PulseNet and OutbreakNet: Evolving Connectivity in Food Safety Kristin G. Holt, D.V.M., M.P.H. FSIS Liaison to CDC September 21, 2011
More informationInfectious Disease Case Studies: What s Lurking Out There?
Infectious Disease Case Studies: What s Lurking Out There? ASCLS-WI State Convention April 14, 2016 Case Study #2 Tim Monson, MS Microbiologist Supervisor Wisconsin State Lab of Hygiene timothy.monson@slh.wisc.edu
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationWelcome to the PulseNet/OutbreakNet West Coast Regional Meeting
Welcome to the PulseNet/OutbreakNet West Coast Regional Meeting February 5-7, 2019 Catamaran Hotel San Diego, CA 7:00 am 8:00 am Registration Tuesday, February 5, 2019 Joint Session 8:00 am - 8:30 am Welcome
More informationPAMET Continuing Education 2016
PAMET Continuing Education 2016 Agent of gastroenteritis Medium/method] used for routine screening/detection in stool samples Salmonella, Shigella, MacConkey, Hektoen, Bismuth sulfite,etc. Plesiomonas
More informationWelcome to the PulseNet/OutbreakNet East Coast Regional Meeting
Welcome to the PulseNet/OutbreakNet East Coast Regional Meeting January 15-17, 2019 Embassy Suites Tampa-USF Hotel Tampa, FL 7:00 am 8:00 am Registration Tuesday, January 15, 2019 Joint Session 8:00 am
More informationUnderstanding the Public Health Significance of Salmonella. Betsy Booren, Ph.D. Director, Scientific Affairs
Understanding the Public Health Significance of Salmonella Betsy Booren, Ph.D. Director, Scientific Affairs June 18, 2012 2011 Salmonella Outbreaks Ground Beef Salmonella Typhimurium Kosher Broiled Chicken
More informationWhole genome sequencing & new strain typing methods in IPC. Lyn Gilbert ACIPC conference Hobart, November 2015
Whole genome sequencing & new strain typing methods in IPC Lyn Gilbert ACIPC conference Hobart, November 2015 Why do strain typing? Evolution, population genetics, geographic distribution 2 Why strain
More informationLocal Public Health Department. Communicable diseases Environmental health Chronic diseases Emergency preparedness Special programs
Susan I. Gerber, MD Local Public Health Department Communicable diseases Environmental health Chronic diseases Emergency preparedness Special programs Public Health Reporting Ground Zero Local government
More informationInfectious Disease Diagnostics
Infectious Disease Diagnostics Tackling Infectious Diseases Uppsala Health Summit - October10 th, 2017 Stephan Jäger, Roche Diagnostics GmbH When to tackle infectious diseases Prevention & action contribution
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationP. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
More informationFood Safety Performance Standards: an Epidemiologic Perspective
Food Safety Performance Standards: an Epidemiologic Perspective Institute t of Medicine i Food dforum Meeting Rajal Mody, MD MPH LCDR US Public Health Service Enteric Diseases Epidemiology Branch Centers
More informationWater Testing During Foodborne, Waterborne, and Zoonotic Disease Outbreak Investigations
Water Testing During Foodborne, Waterborne, and Zoonotic Disease Outbreak Investigations Vincent Hill OutbreakNet Meeting August 30, 2012 National Center for Emerging and Zoonotic Infectious Diseases Division
More informationInfectious Diseases-HAI, Infectious Diseases Arizona Department of Health Services, Public Health Services. Phoenix, Arizona. Assignment Description
Infectious Diseases-HAI, Infectious Diseases Arizona Department of Health Services, Public Health Services Phoenix, Arizona Assignment Description The Fellow will be situated in the the Office of Infectious
More informationIMPLEMENTATION OF GHOST FOR HAV OUTBREAK DETECTION
National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention IMPLEMENTATION OF GHOST FOR HAV OUTBREAK DETECTION Sumathi Ramachandran,MS,MPH,PHD Molecular Epidemiology and Bioinformatics Team Division
More informationUpdate on infections with and clinical lab guidelines for Shiga toxin-producing E. coli (STEC) in the United States
Update on infections with and clinical lab guidelines for Shiga toxin-producing E. coli (STEC) in the United States Patricia M. Griffin, MD Enteric Diseases Epidemiology Branch Centers for Disease Control
More informationChanging Trends in Foodborne and Enteric Zoonotic Outbreaks Colin Basler, DVM, MPH
Changing Trends in Foodborne and Enteric Zoonotic Outbreaks Colin Basler, DVM, MPH Veterinary Epidemiologist Outbreak Response and Prevention Branch Centers for Disease Control and Prevention Salmonella
More informationContribution of avian influenza data through OFFLU network
Dr Gounalan Pavade Chargé de Mission, OIE Headquarters Contribution of avian influenza data through OFFLU network Asia-Pacific Workshop on surveillance, prevention and control of zoonotic influenza Paro,
More informationNew Sequencing Technologies for Infectious Diseases
New Sequencing Technologies for Infectious Diseases Dr James Ussher Senior Lecturer, Microbiology and Immunology & Clinical Microbiologist, Southern Community Laboratories Antibiotic resistance: a 21
More informationOpportunities to Collect Data and Improve Lm Risk Assessments
Opportunities to Collect Data and Improve Lm Risk Assessments Janell R. Kause Scientific Advisor for Risk Assessment Food Safety and Inspection Service, USDA 2 Presentation Outline Past Risk Estimates
More informationS. Wesley Long, MD, PhD
Basic Molecular Microbiology: A Practical Case-Based Approach S. Wesley Long, MD, PhD Center for Molecular and Translational Human Infectious Diseases Research Houston Methodist Research Institute September
More informationWhen a Cluster Becomes an Outbreak The Multistate Perspective
National Center for Emerging and Zoonotic Infectious Diseases When a Cluster Becomes an Outbreak The Multistate Perspective Matthew Wise, MPH, PhD Outbreak Response and Prevention Branch Division of Foodborne,
More informationPublic Health Risks of Consuming Raw Milk Products - Surveillance and Prevention Efforts in the United States
Public Health Risks of Consuming Raw Milk Products - Surveillance and Prevention Efforts in the United States Casey Barton Behravesh, DVM, DrPH, DACVPM LCDR, US Public Health Service Enteric Diseases Epidemiology
More informationThe PulseNet Cost Benefit Study and Beyond: What We Have Learned & Where We Are Headed for Molecular Enteric Surveillance
The PulseNet Cost Benefit Study and Beyond: What We Have Learned & Where We Are Headed for Molecular Enteric Surveillance Craig Hedberg, PhD University of Minnesota Our mission is to identify and evaluate
More informationThe Role of USDA s Food Safety and Inspection Service to Ensure Foodborne Disease Control and Prevention
The Role of USDA s Food Safety and Inspection Service to Ensure Foodborne Disease Control and Prevention David Goldman, MD, MPH Assistant Administrator Office of Public Health Science Agricultural Outlook
More informationLessons Learned from an Outbreak: E. coli O157:H7 linked to Romaine Lettuce National Investigation and Communication Process
National Center for Emerging and Zoonotic Infectious Diseases Lessons Learned from an Outbreak: E. coli O157:H7 linked to Romaine Lettuce National Investigation and Communication Process Natasha Dowell,
More informationNew technologies reaching the clinic
New technologies reaching the clinic Martin Däumer May 31, 2018 Deep-sequencing Standard Sanger-sequencing...PQIYMDDHTRE... Ultra-deep-sequencing...PQIYMDDHTRE......PQIYMDDHTRE......PQIYVDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE...
More informationHaemophilus influenzae and its invisibility cloak. Anna Strain Virology Supervisor/VPD Reference Center Coordinator June 5, 2018
Haemophilus influenzae and its invisibility cloak Anna Strain Virology Supervisor/VPD Reference Center Coordinator June 5, 2018 Haemophilus influenzae Gram negative aerobic coccobacilli Pfeiffer s Bacillus-
More informationPREventing EMerging Pathogenic Threats (PREEMPT) Proposers Day
PREventing EMerging Pathogenic Threats (PREEMPT) Proposers Day Dr. Jim Gimlett, Program Manager DARPA Biological Technologies Office (BTO) January 30, 2018 Arlington, VA PREEMPT Agenda Proposers Day Objectives
More information