Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Size: px
Start display at page:

Download "Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers"

Transcription

1 Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1

2 To Cancer Genetics Studies Introduction Next Generation Sequencing (NGS) on Illumina platform is suitable for clinical applications that require large amounts of information, accurate quantification and high-sensitivity detection Mutation detection in tumours (from biopsies / circulating tumour cells (CTC)). Pathogen detection e.g. organism identification for epidemiological investigations Gut microbial flora genomics Detection of the presence of antibiotic resistance genes Comparison of novel sequences / genes to those in public databases 2

3 Applications of NGS to Cancer Genetics Some Commonly Applied Techniques Sequencing The Genome Reference alignment, targeted resequencing for polymorphism and mutation discovery De novo assembly for characterisation of novel genes, genomes. Paired-end sequencing highlights larger structural variants (inherited/acquired) Sequencing The Transcriptome RNA-Seq allows absolute quantification of gene expression across transcriptome No prior knowledge of content needed quantify expression of unknown genes Profiling of mrna, ncrna, mirna Sequencing The Cistrome ChIP-Seq allows profiling of cis-acting targets (DNA binding sites) of a trans-acting factor (transcription factor, restriction enzyme, etc) on a genome scale. Determine how proteins interact with DNA to regulate gene expression Determine how TFs and other proteins influence phenotype-affecting mechanisms SImilar approach can be used to characterise genomic methylation patterns the methylome 3

4 Applications of NGS to Cancer Genetics Levels of information extraction, data integration Variant Detection RNA-Seq Quantification RNA-Seq Discovery ChIP-Seq Integrate Associate observed variants with regulation/transcriptional changes; link to external databases Analyse Identify Process Generate Overlapping Genes Differential Expression Novel Isoforms Associated Genes Variant Detection Expression levels Novel gene models Motif finding Targeted Resequencing Density on known exons Novel Transcripts Binding Sources Consensus Sequence Identify splice-crossing reads Enriched regions De novo assembly / reads mapped to (un) annotated reference sequence short DNA fragments Level of Information Extraction 4

5 Human Resequencing and Variant Detection Reference Assembly, Targeted Resequencing And Variant Detection Search for alterations at nucleotide level to explain changes in regulation/transcription Single Ended (SE) sequencing ~85% of complex genome accessible suitable for SNPs, small indels (DIPs) Paired-Ended (PE) sequencing ~99% of complex genome accessible Find longer DIPs Find larger structural variations Span repeat regions 5

6 Human Resequencing and Variant Detection 2009 Nature Paper Cytogenetically normal AML genome sequenced (32x) Comparison with matched normal tissue (14x) 98 full runs on Illumina GA to achieve required depth Alignment, variant discovery performed by MAQ 97.7% of variants in AML genome also in normal Further restricted to annotated gene-coding regions Across all tumour cells: found 10 genes with acquired mutations (8 novel) present in all cells at presentation and relapse Our study establishes whole genome sequencing as an unbiased method for discovering initiating mutations in cancer genomes, and for identifying novel genes that may respond to targeted therapies 6

7 Polymorphism detections within P53 P53 Variant detection study Guardian of the genome (Lane, 1992) Protects fidelity of DNA replication Directs cell arrest/apoptosis when stressed Mutated in more than half of human cancers 7

8 Polymorphism detections within P53 P53 Variant detection study Guardian of the genome (Lane, 1992) Protects fidelity of DNA replication Directs cell arrest/apoptosis when stressed 17p13.1 Mutated in more than half of human cancers Human TP53 gene located on 17p13.1 Region sometimes deleted in human cancer 8

9 Polymorphism detections within P53 P53 Variant detection study Guardian of the genome (Lane, 1992) Protects fidelity of DNA replication Directs cell arrest/apoptosis when stressed 17p13.1 Mutated in more than half of human cancers Human TP53 gene located on 17p13.1 Region sometimes deleted in human cancer PCR amplification Study Search for variants on P53 gene in matched tumour samples. Use gene specific PCR to amplify exons only to maximise depth of coverage 9

10 Polymorphism detections within P53 P53 Variant detection study Guardian of the genome (Lane, 1992) Protects fidelity of DNA replication Directs cell arrest/apoptosis when stressed Coverage of p53 gene Mutated in more than half of human cancers Human TP53 gene located on 17p13.1 Region sometimes deleted in human cancer Study Search for variants on P53 gene in matched tumour samples. Use gene specific PCR to amplify exons only to maximise depth of coverage Coverage per base position Use MAQ for alignment, variant discovery against P53 reference gene Gene position Comparison with results from 454, Sanger 10

11 Polymorphism detections within BRCA1 BRCA1 Variant detection study Human tumour suppressor gene Primarily expressed in breast tissue Helps repair damaged DNA (if possible) Mutations to BRCA1 allow uncontrolled replication of damaged cells. 11

12 Polymorphism detections within BRCA1 BRCA1 Variant detection study Human tumour suppressor gene Primarily expressed in breast tissue Helps repair damaged DNA (if possible) CASAVA Demultiplex (11 samples) Map reads to ref (BRCA1) Mutations to BRCA1 allow uncontrolled replication of damaged cells. Pilot Study Search for variants on BRCA1 gene Use gene specific PCR to amplify exons only to maximise depth of coverage Multiplexed 11 samples loaded into one lane Use CASAVA for de-multiplexing, alignment Use SAMtools for consensus/indel calling, filtering Validation of results against known variants. SAMTools Conversion to SAM format Conversion to Pileup format Consensus/Indel Calling Filter for variants Comparison with Known variants 12

13 RNA-Seq: Transcriptome Analysis RNA-Seq Sequence RNA (translated to cdna) Mapped to annotated reference genome (annotated genes, known variants) Expression levels deduced from total number of reads that map to exons of a gene. RNA-Seq versus Microarray More sensitive to low-abundance transcripts absolute gene expression levels detectable can detect single molecules no prior knowledge required of content Greater ability to distinguish isoforms Ability to determine allelic expression Less biased 13

14 RNA-Seq: Transcriptome Analysis RNA-Seq Study of ovarian cancer cell lines Identification of changes in gene expression in strains with acquired drug-resistance Special interest in ncrna expression data Use Bowtie and Tophat to map reads, identify splice sites Use Cufflinks to assemble transcripts, calculate abundances ~87% of reads mapped to genome Use DESeq to perform differential expression tests Use DAVID (Database for Annotation, Visualisation and Integrated Discovery ( for pathway analysis Found significant representation of cancer pathways and focal adhesion genes BOWTIE Maps reads to reference genome (hg19) TOPHAT Identifies splice sites (known/novel) CUFFLINKS Transcript Assembly, Quantification DESeq Differential Gene Expression of RNA-Seq data DAVID Pathways Analysis of deregulated genes 14

15 ChIP-Seq: Genome-wide protein-dna interactions ChIP-Seq Chromatin-immunoprecipitation (ChIP) isolates proteinbound DNA Follow by deep sequencing of DNA fragments (Seq) Facilitates genome wide mapping pf DNA-protein interactions How TFs, other chromatin associated factors can affect phenotype. Regulation/Structural Analysis ChIP-Seq vs. ChIP-chip no prior knowledge of content required Similar approach can be used to map genomic methylation 15

16 ChIP-Seq: Genome-wide protein-dna interactions ChIP-Seq Study ofhaematopoietic Stem Cells Interest in Haematopoiesis and genetic circuitry of blood cell development Tal1 T-cell acute lymphocytic leukaemia protein 1 TF that controls development and differentiation of Haematopoietic Stem Cells (HSCs) Very few target genes had been validated. ChIP-Seq approach taken to generate a genome-wide catalogue of Tal1 binding events in stem cell line Use Illumina BeadStudio ChIP-Seq module to identify peaks (potential chromatin binding sites) Followed by in vivo validation (foetal liver, transgenic mice) Allows construction of in vivo validated network of 17 factors and respective regulatory elements 16

17 Applications of NGS to Cancer Genetics Levels of information extraction, data integration Variant Detection RNA-Seq Quantification RNA-Seq Discovery ChIP-Seq Integrate Associate observed variants with regulation/transcriptional changes; link to external databases Analyse Identify Process Generate Overlapping Genes Differential Expression Novel Isoforms Associated Genes Variant Detection Expression levels Novel gene models Motif finding Targeted Resequencing Density on known exons Novel Transcripts Binding Sources Consensus Sequence Identify splice-crossing reads Enriched regions De novo assembly / reads mapped to (un) annotated reference sequence short DNA fragments Level of Information Extraction 17

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

Ambient temperature regulated flowering time

Ambient temperature regulated flowering time Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis

More information

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences

More information

Transcriptome Analysis

Transcriptome Analysis Transcriptome Analysis Data Preprocessing Sample Preparation Illumina Sequencing Demultiplexing Raw FastQ Reference Genome (fasta) Reference Annotation (GTF) Reference Genome Analysis Tophat Accepted hits

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

Introduction to Systems Biology of Cancer Lecture 2

Introduction to Systems Biology of Cancer Lecture 2 Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology

More information

Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples

Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples LIBRARY

More information

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological

More information

Analyse de données de séquençage haut débit

Analyse de données de séquençage haut débit Analyse de données de séquençage haut débit Vincent Lacroix Laboratoire de Biométrie et Biologie Évolutive INRIA ERABLE 9ème journée ITS 21 & 22 novembre 2017 Lyon https://its.aviesan.fr Sequencing is

More information

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA

More information

ChIP-seq data analysis

ChIP-seq data analysis ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional

More information

Performance Characteristics BRCA MASTR Plus Dx

Performance Characteristics BRCA MASTR Plus Dx Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics

More information

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length

More information

Accessing and Using ENCODE Data Dr. Peggy J. Farnham

Accessing and Using ENCODE Data Dr. Peggy J. Farnham 1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not

More information

Transcript reconstruction

Transcript reconstruction Transcript reconstruction Summary I Data types, file formats and utilities Annotation: Genomic regions Genes Peaks bedtools Alignment: Map reads BAM/SAM Samtools Aggregation: Summary files Wig (UCSC) TDF

More information

RNA-seq Introduction

RNA-seq Introduction RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated

More information

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS RNA SEQUENCING AND DATA ANALYSIS Download slides and package http://odin.mdacc.tmc.edu/~rverhaak/package.zip http://odin.mdacc.tmc.edu/~rverhaak/rna-seqlecture.zip Overview Introduction into the topic

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

Lecture 8 Understanding Transcription RNA-seq analysis. Foundations of Computational Systems Biology David K. Gifford

Lecture 8 Understanding Transcription RNA-seq analysis. Foundations of Computational Systems Biology David K. Gifford Lecture 8 Understanding Transcription RNA-seq analysis Foundations of Computational Systems Biology David K. Gifford 1 Lecture 8 RNA-seq Analysis RNA-seq principles How can we characterize mrna isoform

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant

More information

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

BIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro.

BIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro. RNA sequencing overview BIMM 143 Genome Informatics II Lecture 14 Barry Grant http://thegrantlab.org/bimm143 In vivo In vitro In silico ( control) Goal: RNA quantification, transcript discovery, variant

More information

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015 Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a

More information

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing

More information

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by

More information

A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis

A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies

More information

Global regulation of alternative splicing by adenosine deaminase acting on RNA (ADAR)

Global regulation of alternative splicing by adenosine deaminase acting on RNA (ADAR) Global regulation of alternative splicing by adenosine deaminase acting on RNA (ADAR) O. Solomon, S. Oren, M. Safran, N. Deshet-Unger, P. Akiva, J. Jacob-Hirsch, K. Cesarkas, R. Kabesa, N. Amariglio, R.

More information

Results. Abstract. Introduc4on. Conclusions. Methods. Funding

Results. Abstract. Introduc4on. Conclusions. Methods. Funding . expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole

More information

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017 Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of

More information

Simple, rapid, and reliable RNA sequencing

Simple, rapid, and reliable RNA sequencing Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the

More information

EPIGENOMICS PROFILING SERVICES

EPIGENOMICS PROFILING SERVICES EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation

More information

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin

More information

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic

More information

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing

More information

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes

More information

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b) KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set

More information

cis-regulatory enrichment analysis in human, mouse and fly

cis-regulatory enrichment analysis in human, mouse and fly cis-regulatory enrichment analysis in human, mouse and fly Zeynep Kalender Atak, PhD Laboratory of Computational Biology VIB-KU Leuven Center for Brain & Disease Research Laboratory of Computational Biology

More information

Computational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory

Computational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory Computational aspects of ChIP-seq John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory ChIP-seq Using highthroughput sequencing to investigate DNA

More information

Supplemental Information For: The genetics of splicing in neuroblastoma

Supplemental Information For: The genetics of splicing in neuroblastoma Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,

More information

Reporting TP53 gene analysis results in CLL

Reporting TP53 gene analysis results in CLL Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

Introduction to Genetics

Introduction to Genetics Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20

More information

Deploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven

Deploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Deploying the full transcriptome using RNA sequencing Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Roadmap Biogazelle the power of RNA reasons to study non-coding RNA

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016

Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016 Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf Rachel Schwope EPIGEN May 24-27, 2016 What does H3K4 methylation do? Plant of interest: Vitis vinifera Culturally important

More information

Research Strategy: 1. Background and Significance

Research Strategy: 1. Background and Significance Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity

More information

ChIP-seq hands-on. Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs

ChIP-seq hands-on. Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs ChIP-seq hands-on Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs Main goals Becoming familiar with essential tools and formats Visualizing and contextualizing raw data Understand

More information

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,

More information

Summary... 2 TRANSLATIONAL RESEARCH Tumour gene expression used to direct clinical decision-making for patients with advanced cancers...

Summary... 2 TRANSLATIONAL RESEARCH Tumour gene expression used to direct clinical decision-making for patients with advanced cancers... ESMO 2016 Congress 7-11 October, 2016 Copenhagen, Denmark Table of Contents Summary... 2 TRANSLATIONAL RESEARCH... 3 Tumour gene expression used to direct clinical decision-making for patients with advanced

More information

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold

More information

DNA Sequence Bioinformatics Analysis with the Galaxy Platform

DNA Sequence Bioinformatics Analysis with the Galaxy Platform DNA Sequence Bioinformatics Analysis with the Galaxy Platform University of São Paulo, Brazil 28 July - 1 August 2014 Dave Clements Johns Hopkins University Robson Francisco de Souza University of São

More information

NGS for Cancer Predisposition

NGS for Cancer Predisposition NGS for Cancer Predisposition Colin Pritchard MD, PhD University of Washington Dept. of Lab Medicine AMP Companion Society Meeting USCAP Boston March 22, 2015 Disclosures I am an employee of the University

More information

Inference of Isoforms from Short Sequence Reads

Inference of Isoforms from Short Sequence Reads Inference of Isoforms from Short Sequence Reads Tao Jiang Department of Computer Science and Engineering University of California, Riverside Tsinghua University Joint work with Jianxing Feng and Wei Li

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive

More information

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor

More information

Circular RNAs (circrnas) act a stable mirna sponges

Circular RNAs (circrnas) act a stable mirna sponges Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding

More information

DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK

DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence

More information

RNA- seq Introduc1on. Promises and pi7alls

RNA- seq Introduc1on. Promises and pi7alls RNA- seq Introduc1on Promises and pi7alls DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different func1onal RNAs Which RNAs (and some1mes

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

EXPression ANalyzer and DisplayER

EXPression ANalyzer and DisplayER EXPression ANalyzer and DisplayER Tom Hait Aviv Steiner Igor Ulitsky Chaim Linhart Amos Tanay Seagull Shavit Rani Elkon Adi Maron-Katz Dorit Sagir Eyal David Roded Sharan Israel Steinfeld Yossi Shiloh

More information

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences

More information

Viral genome sequencing: applications to clinical management and public health. Professor Judy Breuer

Viral genome sequencing: applications to clinical management and public health. Professor Judy Breuer Viral genome sequencing: applications to clinical management and public health Professor Judy Breuer Why do whole viral genome sequencing Genome sequencing allows detection of multigenic resistance in

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole

More information

Methods: Biological Data

Methods: Biological Data Transcriptome analysis of short read Illumina RNA sequencing: investigating baseline variability in gene expression levels and splice variants among human brain and Lymphoblastoid samples Abstract Understanding

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 28

More information

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock

More information

Genome-wide Association Studies (GWAS) Pasieka, Science Photo Library

Genome-wide Association Studies (GWAS) Pasieka, Science Photo Library Lecture 5 Genome-wide Association Studies (GWAS) Pasieka, Science Photo Library Chi-squared test to evaluate whether the odds ratio is different from 1. Corrected for multiple testing Source: wikipedia.org

More information

Genomic Medicine: What every pathologist needs to know

Genomic Medicine: What every pathologist needs to know Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and

More information

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different

More information

Biomarker development in the era of precision medicine. Bei Li, Interdisciplinary Technical Journal Club

Biomarker development in the era of precision medicine. Bei Li, Interdisciplinary Technical Journal Club Biomarker development in the era of precision medicine Bei Li, 23.08.2016 Interdisciplinary Technical Journal Club The top ten highest-grossing drugs in the United States help between 1 in 25 and 1 in

More information

DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester

DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING John Archer Faculty of Life Sciences University of Manchester HIV Dynamics and Evolution, 2008, Santa Fe, New Mexico. Overview

More information

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized

More information

RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB

RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB CSF-NGS January 22, 214 Contents 1 Introduction 1 2 Experimental Details 1 3 Results And Discussion 1 3.1 ERCC spike ins............................................

More information

Transcriptome and isoform reconstruc1on with short reads. Tangled up in reads

Transcriptome and isoform reconstruc1on with short reads. Tangled up in reads Transcriptome and isoform reconstruc1on with short reads Tangled up in reads Topics of this lecture Mapping- based reconstruc1on methods Case study: The domes1c dog De- novo reconstruc1on method Trinity

More information

Accel-Amplicon Panels

Accel-Amplicon Panels Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation

More information

TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer.

TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer. AWARD NUMBER: W81XWH-14-1-0080 TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer. PRINCIPAL INVESTIGATOR: Christopher B. Umbricht, MD, PhD CONTRACTING ORGANIZATION: Johns

More information

Introduction. Introduction

Introduction. Introduction Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts

More information

MutationTaster & RegulationSpotter

MutationTaster & RegulationSpotter MutationTaster & RegulationSpotter Pathogenicity Prediction of Sequence Variants: Past, Present and Future Dr. rer. nat. Jana Marie Schwarz Klinik für Pädiatrie m. S. Neurologie Exzellenzcluster NeuroCure

More information

New Drug development and Personalized Therapy in The Era of Molecular Medicine

New Drug development and Personalized Therapy in The Era of Molecular Medicine New Drug development and Personalized Therapy in The Era of Molecular Medicine Ramesh K. Ramanathan MD Virginia G. Piper Cancer Center Translational Genomics Research Institute Scottsdale, AZ Clinical

More information

RNA-Seq Atlas of Glycine max: A guide to the Soybean Transcriptome

RNA-Seq Atlas of Glycine max: A guide to the Soybean Transcriptome RNA-Seq Atlas of Glycine max: A guide to the Soybean Transcriptome How do novel structures or functions evolve? A more relevant example Symbiosis and Nitrogen Fixation Limpens & Bisseling (23) Curr. Opin.

More information

ABS04. ~ Inaugural Applied Bayesian Statistics School EXPRESSION

ABS04. ~ Inaugural Applied Bayesian Statistics School EXPRESSION ABS04-2004 Applied Bayesian Statistics School STATISTICS & GENE EXPRESSION GENOMICS: METHODS AND COMPUTATIONS Mike West Duke University Centro Congressi Panorama, Trento,, Italy 15th-19th 19th June 2004

More information

EXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%)

EXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%) Dr Kate Goodhealth Goodhealth Medical Clinic 123 Address Road SUBURBTOWN NSW 2000 Melanie Citizen Referring Doctor Your ref Address Dr John Medico 123 Main Street, SUBURBTOWN NSW 2000 Phone 02 9999 9999

More information

Section D: The Molecular Biology of Cancer

Section D: The Molecular Biology of Cancer CHAPTER 19 THE ORGANIZATION AND CONTROL OF EUKARYOTIC GENOMES Section D: The Molecular Biology of Cancer 1. Cancer results from genetic changes that affect the cell cycle 2. Oncogene proteins and faulty

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases. Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information