Utilisation du système CRISPR pour identifier les STEC du Top7

Transcription

1 LES JOURNÉES STEAEXPERT DU JUIN 2014 Utilisation du système CRISPR pour identifier les STEC du Top7 Patrick FACH Plateforme Nationale IdentyPath (Anses) Laboratoire de Sécurité des aliments de Maisons-Alfort 23 Av du général De Gaulle, Maisons-Alfort, France

2 E. coli genome plasticity: which target for detection of pathogenic STEC Genome comparison between pathogenic and non-pathogenic E.coli E.coli K12 sequences Genomic Islands Integrated prophages Only 40% of the genome of E. coli (the «core» genome) is highly conserved between strains

3 CRISPR-mediated adaptive immunity Invader: phage or plasmid DNA Degradation New spacer Plasmid Invader: phage or plasmid Cas1 / Cas2 Viral DNA Virus Direct repeat Spacer integration Cas genes iap L Cas2 Cas1 Cse3 Cas3 CRISPR array Precursor crrnas Mature crrnas CRISPR associated genes Cas protein complex X Destruction of invader

4 CRISPR-mediated adaptive immunity Invader: phage or plasmid DNA Degradation New spacer Plasmid Invader: phage or plasmid Cas1 / Cas2 Viral DNA Virus Direct repeat Spacer integration Cas genes iap L Cas2 Cas1 Cse3 Cas3 CRISPR array Precursor crrnas Mature crrnas CRISPR associated genes Cas protein complex X Destruction of invader

5 CRISPR based typing Shariat N. and Dudley E.G., AEM 2014, vol

6 Development of a CRISPR sequences database for EHEC-top7

7 Besoin d un outil informatique :

8

9 Application principale Algorithmique >FRIK2000 CGCGCTTACGTGGACGGCTCGCAATCTGGCTACTGGAAGTGCGTGCCGGTGTGTA TGTTGGTGATACATCAAAACGTATTCGGGAGATGATCTGGCAGCAAATTACCCAAC TGGCTGGTTGCGGAAATGTGGTGATGGCCTGGGCGACCAATACCGAGTCGGGTTT TGAATTTCAGACCTGGGGAGAAAACAGACGTATTCCGGTGGATTTGGATGGGTTA CGTTTGGTTTCTTTTCTTCCTGTTGATAATCAATAGGTTATGTGTTCTTTAAAAATAA GGAAATGTTTGAATTTAGTTGGTAGATTGTTGATGTGGAATAAATTTGTTTAAAAAC AGATATGTATGCTTAGTGTGTTCCCCGCGCCAGCGGGGATAAACCGTCACCAAAAC AGTGACAAAAACTGTCACCAAAGTGTTCCCCGCGCCAGCGGGGATAAACCGCTCA TATTCGGATTGATCGTGTGTTTCGGTTTGTGTTCCCCGCGCCAGCGGGGATAAACC GGCCCAGGGATTTGTTCAATCCAGCGTGCCGCTGTGTTCCCCGCATCAGCGGGGA TAAACCGGGCGCACTGGATGCGATGATGGATATCACTTAGAATTCCCCGCCCCTGC GGTAGAACACCCAGCTCCCATTTTCCAACCCATCAAGACGCCTTCGCCAACTCCCT TCACCAA Upstream 1 A 1 A 2 A 3 B 4 C Downstream Code allélique Base de données Numéro d allèle

10 Résultats Données de sortie et rendus graphiques Souche-Code allélique-numéro d allèle-timestamp Rendu graphique au format HTML Diagramme à secteurs Historamme

11 Identification of spacers associated with pathogenic or predominant strains Touchon et al. 2010: 85% of spacers are present in a single genome Shariat N. and Dudley E.G., AEM 2014, vol

12 Identification of spacers associated with EHEC O157:H7 and big6 EHEC CRISPR array Cas genes iap L Cas2 Cas1 Cse3 Cas3 CGGTTTATCCCCGCTGGCGCGGGGAACAC Direct repeat Identification of spacer sequences representative of each serotype CRISPR Oxxx:Hx

13 Characterization of E. coli entéro-hémorragique : high throughput qpcr LightCycler 1536 (Roche Diagnostics)

14 DNA sequences derived from the CRISPR loci of E. coli for specific identification of enterohaemorrhagic E. coli (EHEC) 958 E. Coli strains 10 Genetic markers EHEC strains EPEC strains STEC strains Apathogenic E. coli strains 35 Other enterobacteria - CRISPR_O157_A - CRISPR_O157_B - CRISPR_O157_C - CRISPR_O45 /O103 - CRISPR_O111 - CRISPR_O121 - CRISPR_O145 - CRISPR_O26_C - CRISPR_O26_D - CRISPR_O104

15 Sensitivity and specificity of CRISPR assays N of strains 229 O157:H7 PCR Sensitivity Specificity Cross-reactivity CRISPR_O157_B 98.7% 99.7% O55:H7 a, O55:H7 (n=2) b CRISPR_O157_C 91.7% 100% CRISPR_O157_B+C 99.6% 99.7% O55:H7 a, O55:H7 (n=2) b 1 false negative (1/229) that had lost CRISPR locus Also negative with 33 additional E. coli O157 strains expressing H-types other than H7: H NT, H12, H15, H16, H26, H39, H40 and H45 a EHEC; b EPEC; c STEC; d Non pathogenic E. coli

16 EPEC O55:H7 l ancêtre du STEC pathogène O157:H7 ou EHEC O157:H7 NSF O157:H7 Feng et al. JID 1998

17 Sensitivity and specificity of CRISPR assays N of strains 43 O26:H11 PCR Sensitivity Specificity Cross-reactivity CRISPR_O26_C 95.3% 98.9% CRISPR_O26_D 95.3% 98.5% CRISPR_O26_C+D 100% 97.5% O111:H11 (n=3) b, O118:H16 (n=2) a, O118:H8a (n=3) b, O128:H8 b, O26:H11 b O118:H16 (n=2) a, O123:H11 a, O26:H11 (n=9) b, O86:H11 (n=2) b O111:H11 (n=3) b, O118:H16 (n=3) a, O118:H8a (n=3) b, O123:H11 a, O128:H8 b, O26:H11 (n=10) b, O86:H11 (n=2) b Negative with other O26 strains (O26:H ND, O26:H31, O26:H32 and O26:H34) a EHEC; b EPEC; c STEC; d Non pathogenic E. coli

18 Sensitivity and specificity of CRISPR assays N of strains O145:H28 PCR Sensitivity Specificity Cross-reactivity 29 CRISPR_O % 99.6% O28:H28 (n=4) b Negative with other O145 strains (O145:H2, O145:H25, and O145:H34) a EHEC; b EPEC; c STEC; d Non pathogenic E. coli

19 Sensitivity and specificity of CRISPR assays N of strains O111:H8 PCR Sensitivity Specificity Cross-reactivity 49 CRISPR_O % 99.7% O45:H11 b 2 false negative (2/49): one had lost CRISPR locus, one had spacer deletions Negative with other O111 strains (O111:H ND, O111:H2, O111:H9, O111:H10, O111:H11, O111:H12, O111:H19, O111:H21, O111:H25 and O111:H45) a EHEC; b EPEC; c STEC; d Non pathogenic E. coli

20 Sensitivity and specificity of CRISPR assays N of strains O103:H2; O45:H2 PCR Sensitivity Specificity Cross-reactivity 37, 17 CRISPR_O45/O % 98.7% O118:H8a (n=3) b, O128:H2 (n=2) b, O128:H8 b, O128ac:H2 b, O46:H38 c, O8:H8 c, O103 d, O142 d, O145:H2 d Negative with other O103 strains (O103:H ND, O103:H8, O103:H21, and O103:H25) and other O45 strains (O45:H ND, O45:H4, O45:H9, O45:H11 and O45:H16) a EHEC; b EPEC; c STEC; d Non pathogenic E. coli

21 Sensitivity and specificity of CRISPR assays N of strains O121:H19 PCR Sensitivity Specificity Cross-reactivity 23 CRISPR_O % 99.7% O104:H7 c, O121:H19 b, O121:H19 d 1 false negative (1/23) Negative with other O121 strains (O121:H7, O121:H10, O121:H11, O121:H14, O121:H45) a EHEC; b EPEC; c STEC; d Non pathogenic E. coli

22 Sensitivity and specificity of CRISPR assays Detection of E. coli O104:H4 CRISPR locus 1321 E. coli strains CRISPR O104:H4 N of strains PCR Sensitivity Specificity Cross-reactivity 48 CRISPR_O % 99.1% Ont:H2, O43:H2, O141:H2, O174:H2 Negative with other O104 strains (O104:H2, O104:H7, O104:H11, O104:H12 and O104:H21)

23 Phylogenetic relationship of of CRISPR loci Split decomposition analysis using neighbor net with the uncorrected p distance Comparison of the CRISPR loci of O104:H4 strains, O104:nonH4 strains, and other strains that reacted with CRISPR O104:H4. E. coli strains that reacted with the CRISPR O104:H4 assay are noted in bold. Sequence homogeneity according to serotype

24 Conclusion Sequencing the CRISPR locus of many strains Patented Sequences. The CRISPR sequences are not all available in GeneBank - sensitivity estimates: 95.7% to 100% - specificity estimates: 97.5% to 99.7% Strains belonging to the top 7 serogroups but with H-types different than that of the priority serotypes tested negative, regardless of their E. coli pathogroup.

25 Détection spécifique des EHEC par l utilisation des CRISPR

26 Yin S et al Appl. Environ. Microbiol. 79(18):

27 Yin S et al Appl. Environ. Microbiol. 79(18): To better evaluate the sensitivity and specificity of this qpcr method (Delannoy et al. 2012), the CRISPR loci of 252 O157 and bigsix STEC isolates were sequenced and analyzed along with 563 CRISPR1 and 624 CRISPR2 sequences available in GenBank. In conclusion, for O157 and the big six serotypes, the CRISPR alleles within strains of each serogroup were generally similar in their spacer content and order regardless of the isolation source. Our study confirms that the CRISPR-based qpcr method described previously (Delannoy et al. 2012) is an effective way of screening for STEC, while also demonstrating that spacer deletion and conservation of sequences between isolates of a common H antigen are sources of the small number of false positives and negatives observed.

28 CRISPR as alternate targets for detecting EHEC O157:H7 in beef samples O157 vs CRISPR_O157 N=348 RfbE O157+ n=22 CRISPR_O157+ n=0 n=0 n=22 n=0 n=326

29 CRISPR as alternate targets for detecting EHEC O157:H7 in Beef samples O157 + H7 vs CRISPR_O157 N=348 O157+, H7+ n=7 SP_O157+ n=0 n=0 n=7 n=0 n=341

30 EHEC: Alternate targets for detection stx1/stx2 + eae + CRISPR_O157 + Serogroup +

31 Merci - Sabine Delannoy (Anses) - Lothar Beutin (BfR) - Aubin Fleiss (Paris VI) Anses, Laboratoire de Sécurité des Aliments plateforme IdentyPath 23 Av du général De Gaulle, Maisons-Alfort, France