Viral genome sequencing: applications to clinical management and public health. Professor Judy Breuer
|
|
|
- Dennis Norton
- 6 years ago
- Views:
Transcription
1 Viral genome sequencing: applications to clinical management and public health Professor Judy Breuer
2 Why do whole viral genome sequencing Genome sequencing allows detection of multigenic resistance in widely spaced genes Genome sequencing may resolve nosocomial transmission events especially for DNA viruses where there is insuffient variation in small fragments Genome sequencing may identify outbreaks or patterns of spread
3 Nosocomial Transmission Index case Samples Contacts Samples Patient 1 Varicella vesicle (4) n/a n/a Subject 2 Varicella vesicle (3) Patient 3 Varicella vesicle (2) Subject 4 Zoster Vesicle (1) Patient 5 Varicella vesicle (1) Subject 6 Varicella vesicle (1) Patient 7 Varicella vesicle (1) Patient 8 Zoster vesicle (1) Patients 9 & 10 Varicella vesicle (1,1) Specimen 1 Varicella vesicle (1) n/a n/a Specimen 2 Varicella vesicle (1) n/a n/a Specimen 3 Varicella Skin swab n/a n/a Specimen 4 Gastric biopsy n/a n/a
4 Clade 1 Clade 3 Clade 5
5 Clade 1 Clade 3 Clade 5
6 Fatal varicella in renal transplant recipients Transferred to ITU Shingles diagnosed chickenpox chickenpox death
7 Clade 1 Clade 3 Clade 5
8 Clade 1 viruses are the most common clade 1 clade 2 clade 3 clade 5 clade 4 VZV > 99% similarity between viruses from a single clade
9 Problems with whole viral genome sequencing Virus are intracellular organisms and unlike bacteria, sufficient viral nucleic acid for good quality NGS sequencing cannot easily be obtained from culture (human DNA overwhelms sequence) PCR can be used to amplify fragments for sequencing but this is not suitable for larger viruses or small volume clinical specimens (contain too little viral nucleic acid)
10 Purifying viral DNA for NGS (1) Total DNA extracted from clinical sample (± WGA) (2) Fragmentation and library preparation ( Illumina-based protocol) (3) Target DNA isolated by hybridisation with custom 120-mer RNA baits (4) Sequencing (Illumina) generating paired-end reads (76bp) Incl rounds PCR (5) Quality control: Removes poor quality reads (QUASR) (6) Reference guided assembly using Burrows-Wheeler Aligner (mapped vs. VZV strain Dumas, poka or voka)
11 SureSelect enriches for target DNA VZV EBV KSHV Sample Ratio of Viral: Human Genome copies % on target reads % Genome coverage Pre-hybridisation Post-hybridisation >5-fold >100-fold Mean read depth per base Vesicle >99% >97% 3022 CSF >99% >97% 2416 Saliva % >98% 1096 Blood >99% >98% fold enrichment High % of on target reads Cell lysate >98% >97% 2599 Cell lysate >98% >93% 1773 Determined by qpcr quantification of ORF27 (VZV) and KRAS (Human) Depledge et al. PLoS One, 2011 Near full length genome coverage Very high per-base read depth
12 Sequencing Evolution viruses and pathogenesis by NGS A C A A T Consensus Multiple sequence reads for each base Biallelic positions- important for minority variant resistance etc
13 Method Validated Targeted enrichment 1. Highly sensitive can recover <1000 VZV genomes in < 10ng DNA Depledge Reproducible and representative of the original Depledge 2013 Error<1% 3. Less mutagenic than PCR (without loss of population structure due to culture) Depledge 2011
14 Kundu, Depledge unpub Viruses from transmission cluster
15 Clade 1 Clade 3 Clade 5 Clade 4 Clade 2 Kundu, Depledge unpub
16 Outbreak monitoring
17 Kundu Clin Infect Dis 2013
18 Kundu Clin Infect Dis 2013
19 Kundu Clin Infect Dis 2013
20 Kundu Clin Infect Dis 2013
21 Substitutions between A and B 20 SNPs, (6 coding for aa substitution) 9 Informative ie biallelic Kundu Clin Infect Dis 2013
22 Direction of Transmission Minority variant in B becomes fixed in A following transmission bottleneck Confirms direction of transmission is B to A Kundu Clin Infect Dis 2013
23 What does this study tell us 1. Whole genome sequencing identifies nosocomial transmission(even where patients are isolated) 2. Norovirus shed by immunocompromised is infectious (A became infected only after moving to same ward as B) 3. Norovirus infection triggers chronic diarrhoea in immunocompromised A developed diarrhoea only after becoming infected with norovirus 4. Deep sequencing data can be used to identify direction of spread
24 Breuer group UCL Viral genome sequencing Dan Depledge Samit Kundu Julianne Lockwood Eleanor Grey Fanny Wegner Rachel Williams Helena Tutil Mark Quinlivan Mette Christiansson Cambridge University Ian Goodfellow Lucy Thorne UCL Genomics Mike Hubank GOSH John Hartley PHE Portsmouth Gill Underhill
Next generation sequencing to understand norovirus in immunocompromised children. Thesis for the degree of. Doctor of Philosophy (PhD) UCL
Next generation sequencing to understand norovirus in immunocompromised children Thesis for the degree of Doctor of Philosophy (PhD) UCL Julianne Rose Brown 2017 1 2 Declaration I, Julianne Rose Brown,
High Viral Diversity and Mixed Infections in Cerebral Spinal Fluid From Cases of Varicella Zoster Virus Encephalitis
The Journal of Infectious Diseases MAJOR ARTICLE High Viral Diversity and Mixed Infections in Cerebral Spinal Fluid From Cases of Varicella Zoster Virus Encephalitis Daniel P. Depledge, 1,a Juliana Cudini,
Recommendations for VZV management in. Dan Engelhard, Pierre Reusser, Rafael de la Camara, Hermann Einsele, Jan Styczynski, Kate Ward, Per Ljungman
Recommendations for VZV management in patients Cas cliniques with leukemia Dan Engelhard, Pierre Reusser, Rafael de la Camara, Hermann Einsele, Jan Styczynski, Kate Ward, Per Ljungman Introduction Acute
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE. ICH Considerations
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH Considerations General Principles to Address Virus and Vector Shedding 1.0 Introduction
NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY. 16th International WAVLD symposium, 10th OIE Seminar
NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY S. Van Borm, I. Monne, D. King and T. Rosseel 16th International WAVLD symposium, 10th OIE Seminar 07.06.2013 Viral livestock
Whole genome sequencing & new strain typing methods in IPC. Lyn Gilbert ACIPC conference Hobart, November 2015
Whole genome sequencing & new strain typing methods in IPC Lyn Gilbert ACIPC conference Hobart, November 2015 Why do strain typing? Evolution, population genetics, geographic distribution 2 Why strain
Laboratory diagnosis of congenital infections
Laboratory diagnosis of congenital infections Laboratory diagnosis of HSV Direct staining Tzanck test Immunostaining HSV isolation Serology PCR Tzanck test Cell scrape from base of the lesion smear on
Analysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
Characterizing intra-host influenza virus populations to predict emergence
Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems
Future applications of full length virus genome sequencing
Future applications of full length virus genome sequencing Paul Kellam Virus Genomics Revisiting early HIV resistance ideas AIDS 1991 Nature 1993 Virus genome sequencing Population or single genome Whole
Real-Time PCR Detects Viral Nucleic Acids in Universal Transport Medium (UTM-RT) with Flocked Swabs
Real-Time PCR Detects Viral Nucleic Acids in Universal Transport Medium (UTM-RT) with Flocked Swabs S. CASTRICIANO*, A. PETRICH, M. SMIEJA and M.A. CHERNESKY Departments of Pathology & Molecular Medicine,
LESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication
DEFINITIONS OF TERMS Eukaryotic: Non-bacterial cell type (bacteria are prokaryotes).. LESSON 4.4 WORKBOOK How viruses make us sick: Viral Replication This lesson extends the principles we learned in Unit
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
Viral Agents of Paediatric Gastroenteritis
Viral Agents of Paediatric Gastroenteritis Dr Carl Kirkwood -------------------- Enteric Virus Research Group Murdoch Childrens Research Institute Royal Children s Hospital Victoria. WHO Collaborating
Viruses. Poxviridae. DNA viruses: 6 families. Herpesviridae Adenoviridae. Hepadnaviridae Papovaviridae Parvoviridae
Viruses DNA viruses: 6 families Poxviridae Herpesviridae Adenoviridae Hepadnaviridae Papovaviridae Parvoviridae Human herpesviruses Three subfamilies (genome structure, tissue tropism, cytopathologic effect,
VARICELLA. Dr Louise Cooley Royal Hobart Hospital
VARICELLA Dr Louise Cooley Royal Hobart Hospital Varicella Zoster Virus (VZV): The Basics Herpes virus Exclusively human infection Primary infection: varicella (chickenpox) Neurotropic, establishing latency
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
Viruses 101., and concluded that living organisms do not crystallize. In other words,.
Viruses 101 In 1897, Dutch scientist called tiny particles in the liquid extracted from a plant disease, which is the Latin word for. In 1935, American biochemist isolated crystals of, and concluded that
Human Herpes Viruses (HHV) Mazin Barry, MD, FRCPC, FACP, DTM&H Assistant Professor and Consultant Infectious Diseases KSU
Human Herpes Viruses (HHV) Mazin Barry, MD, FRCPC, FACP, DTM&H Assistant Professor and Consultant Infectious Diseases KSU HERPES VIRUS INFECTIONS objectives: ØTo know the clinically important HHVs. ØTo
Disease and Contemporary Society
Disease and Contemporary Society Alan Mortimer PhD Lecture 1 The notes to accompany this lecture series are provided for the educational use of the course participants. It is believed that images may be
point-of-care test (POCT) Definition: an analytical or diagnostic test undertaken in a setting distinct from a normal hospital or non-hospital
point-of-care test (POCT) Definition: an analytical or diagnostic test undertaken in a setting distinct from a normal hospital or non-hospital laboratory performed by a health care professional or non-medical
Update on the development of clinical diagnostic run controls at NIBSC. Neil Almond Division of Virology
Update on the development of clinical diagnostic run controls at NIBSC Neil Almond Division of Virology BACKGROUND Molecular techniques are increasingly being used for microbiological diagnoses Assays
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
De Novo Viral Quasispecies Assembly using Overlap Graphs
De Novo Viral Quasispecies Assembly using Overlap Graphs Alexander Schönhuth joint with Jasmijn Baaijens, Amal Zine El Aabidine, Eric Rivals Milano 18th of November 2016 Viral Quasispecies Assembly: HaploClique
Viral Infections. 1. Prophylaxis management of patient exposed to Chickenpox:
This document covers: 1. Chickenpox post exposure prophylaxis 2. Chickenpox treatment in immunosuppressed/on treatment patients 3. Management of immunosuppressed exposed to Measles All children with suspected
Section 1 Individual viruses. Introduction to virology. History of viruses. Viral taxonomy
Section 1 Individual viruses Introduction to virology History of viruses The existence of viruses was first suspected in the nineteenth century when it was shown that filtered extract of infective material
Some living things are made of ONE cell, and are called. Other organisms are composed of many cells, and are called. (SEE PAGE 6)
Section: 1.1 Question of the Day: Name: Review of Old Information: N/A New Information: We tend to only think of animals as living. However, there is a great diversity of organisms that we consider living
Structure of viruses
Antiviral Drugs o Viruses are obligate intracellular parasites. o lack both a cell wall and a cell membrane. o They do not carry out metabolic processes. o Viruses use much of the host s metabolic machinery.
Downloaded from:
Ruis, C; Roy, S; Brown, JR; Allen, DJ; Goldstein, RA; Breuer, J (2017) The emerging GII.P16-GII.4 Sydney 2012 norovirus lineage is circulating worldwide, arose by late-2014 and contains polymerase changes
OCCUPATIONAL HEALTH DISEASE SPECIFIC RECOMMENDATIONS
Herpes simplex virus (HSV) Cold sores Genital herpes Herpetic whitlow OCCUPATIONAL HEALTH DISEASE SPECIFIC RECOMMENDATIONS contact with primary or recurrent lesions, infectious saliva or genital secretions
Viral Diseases. T Bamdad, PhD, Tarbiat Modares University
Viral Diseases 1 Categorizing viral infections by the organ system most commonly affected (eg, lungs, GI tract, skin, liver, CNS, mucous membranes) can be clinically useful, although certain viral disorders
Spots and Pox: Contact Tracing and Follow Up for Measles and Chickenpox
Chickenpox Spots and Pox: Contact Tracing and Follow Up for Measles and Chickenpox Noelle Bessette, MPH Surveillance Specialist New Jersey Department of Health Vaccine Preventable Disease Program Caused
Spots and Pox: Contact Tracing and Follow Up for Measles and Chickenpox
Spots and Pox: Contact Tracing and Follow Up for Measles and Chickenpox Noelle Bessette, MPH Surveillance Specialist New Jersey Department of Health Vaccine Preventable Disease Program Chickenpox Caused
A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis
APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown
Persistent Infections
Persistent Infections Lecture 17 Biology 3310/4310 Virology Spring 2017 Paralyze resistance with persistence WOODY HAYES Acute vs persistent infections Acute infection - rapid and self-limiting Persistent
SECTION 25-1 REVIEW STRUCTURE. 1. The diameter of viruses ranges from about a. 1 to 2 nm. b. 20 to 250 nm. c. 1 to 2 µm. d. 20 to 250 µm.
SECTION 25-1 REVIEW STRUCTURE VOCABULARY REVIEW Define the following terms. 1. virus 2. capsid 3. retrovirus 4. viroid 5. prion MULTIPLE CHOICE Write the correct letter in the blank. 1. The diameter of
HIV-1 Dual Infection and Neurocognitive Impairment
HIV-1 Dual Infection and Neurocognitive Impairment Gabriel Wagner, MD Assistant Professor of Medicine Infectious Diseases & Global Public Health UC San Diego HIV-Associated End Organ Damage Antiretroviral
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
Medical Virology. Herpesviruses, Orthomyxoviruses, and Retro virus. - Herpesviruses Structure & Composition: Herpesviruses
Medical Virology Lecture 2 Asst. Prof. Dr. Dalya Basil Herpesviruses, Orthomyxoviruses, and Retro virus - Herpesviruses Structure & Composition: Herpesviruses Enveloped DNA viruses. All herpesviruses have
No mutations were identified.
Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123
Molecular epidemiology used to track viral outbreaks norovirus and beyond
Molecular epidemiology used to track viral outbreaks norovirus and beyond Viruses in May 2018 - The Carrington Hotel, Katoomba NSW 18 th May 2018 Professor Peter White Molecular Microbiology Lab School
USING ADVANCED GENOMIC ANALYSIS FOR POTENTIAL HAEMORRHAGIC FEVER CAUSATIVE AGENTS. J H Kofi Bonney, PhD
USING ADVANCED GENOMIC ANALYSIS FOR POTENTIAL HAEMORRHAGIC FEVER CAUSATIVE AGENTS J H Kofi Bonney, PhD Noguchi Memorial Institute Medical Research Noguchi Memorial Institute for Medical Research University
Clinical utility of NGS for the detection of HIV and HCV resistance
18 th Annual Resistance and Antiviral Therapy Meeting v Professor Janke Schinkel Academic Medical Centre, Amsterdam, The Netherlands Thursday 18 September 2014, Royal College of Physicians, London Clinical
AN UNUSUAL VIRUS IN TREES WITH CITRUS BLIGHT RON BRLANSKY UNIVERSITY OF FLORIDA, CREC
AN UNUSUAL VIRUS IN TREES WITH CITRUS BLIGHT RON BRLANSKY UNIVERSITY OF FLORIDA, CREC CITRUS BLIGHT KNOWN IN FLORIDA FOR OVER 100 YEARS; FIRST DESCRIBED IN 1874 PROBLEM IN FLORIDA IN THE 1970 S WITH INCREASE
Cytomegalovirus (CMV) End-Point PCR Kit Product# EP36300
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cytomegalovirus (CMV) End-Point PCR Kit Product# EP36300 Product
New technologies reaching the clinic
New technologies reaching the clinic Martin Däumer May 31, 2018 Deep-sequencing Standard Sanger-sequencing...PQIYMDDHTRE... Ultra-deep-sequencing...PQIYMDDHTRE......PQIYMDDHTRE......PQIYVDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE...
Restricted VZV transcription in human trigeminal ganglia
JVI Accepts, published online ahead of print on 27 June 2012 J. Virol. doi:10.1128/jvi.01331-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Restricted VZV transcription
Nucleic acid: singled stranded, double stranded, RNA, or DNA, linear or circular. Capsid: protein coat that is most of the mass of the virus.
Viruses General Characteristics of Viruses 1. Depending on view may be regarded as exceptionally complex aggregates of nonliving chemicals or as exceptionally simple living microbes. 2. Contain a single
History electron microscopes
Viruses History Through the 1800s, many scientists discovered that something smaller than bacteria could cause disease and they called it virion (Latin word- poison) In the 1930s, after the invention of
Overview: Chapter 19 Viruses: A Borrowed Life
Overview: Chapter 19 Viruses: A Borrowed Life Viruses called bacteriophages can infect and set in motion a genetic takeover of bacteria, such as Escherichia coli Viruses lead a kind of borrowed life between
IMPLEMENTATION OF GHOST FOR HAV OUTBREAK DETECTION
National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention IMPLEMENTATION OF GHOST FOR HAV OUTBREAK DETECTION Sumathi Ramachandran,MS,MPH,PHD Molecular Epidemiology and Bioinformatics Team Division
Human Immunodeficiency Virus. Acquired Immune Deficiency Syndrome AIDS
Human Immunodeficiency Virus Acquired Immune Deficiency Syndrome AIDS Sudden outbreak in USA of opportunistic infections and cancers in young men in 1981 Pneumocystis carinii pneumonia (PCP), Kaposi s
Virology Introduction. Definitions. Introduction. Structure of virus. Virus transmission. Classification of virus. DNA Virus. RNA Virus. Treatment.
DEVH Virology Introduction Definitions. Introduction. Structure of virus. Virus transmission. Classification of virus. DNA Virus. RNA Virus. Treatment. Definitions Virology: The science which study the
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
VIRAL AGENTS CAUSING GASTROENTERITIS
VIRAL AGENTS CAUSING GASTROENTERITIS VIRAL AGENTS CAUSING GASTROENTERITIS Pathogens discussed in our lectures 1. Rotavirus 2. Enteric adenoviruses 3. Caliciviruses 4. Astroviruses 5. Toroviruses Viruses
Alphaherpesvirinae. Simplexvirus (HHV1&2/ HSV1&2) Varicellovirus (HHV3/VZV)
Alphaherpesvirinae Simplexvirus (HHV1&2/ HSV1&2) Varicellovirus (HHV3/VZV) HERPES SIMPLEX VIRUS First human herpesvirus discovered (1922) Two serotypes recognised HSV-1 & HSV-2 (1962) HSV polymorphism
Chronic shedders as reservoir for nosocomial. transmission of norovirus
JCM Accepts, published online ahead of print on 1 September 2010 J. Clin. Microbiol. doi:10.1128/jcm.01308-10 Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All
ExiPrep TM Dx Fully Automated Nucleic Acid Extraction
20150629 Ver.1(EN) ExiPrep TM Dx Fully Automated Nucleic Acid Extraction 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon, 34302, Republic of Korea Tel: +82-42-930-8777 Fax: +82-42-930-8688 E-mail: sales@bioneer.com
Lecture 2: Virology. I. Background
Lecture 2: Virology I. Background A. Properties 1. Simple biological systems a. Aggregates of nucleic acids and protein 2. Non-living a. Cannot reproduce or carry out metabolic activities outside of a
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii
Update on Adult Immunization Strategies: Understanding the Current Recommendations
Update on Adult Immunization Strategies: Understanding the Current Recommendations EDWARD A. DOMINGUEZ, MD, FACP, FIDSA Medical Director, Organ Transplant Infectious Diseases Methodist Dallas Medical Center,
VZV, EBV, and HHV-6-8
VZV, EBV, and HHV-6-8 Anne Gershon Common Features of Herpesviruses Morphology Basic mode of replication Primary infection followed by latency Ubiquitous Ability to cause recurrent infections (reactivation
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
Large DNA viruses: Herpesviruses, Poxviruses, Baculoviruses and Giant viruses
Large DNA viruses: Herpesviruses, Poxviruses, Baculoviruses and Giant viruses Viruses are the only obstacles to the domination of the Earth by mankind. -Joshua Lederberg Recommended reading: Field s Virology
2.1 VIRUSES. 2.1 Learning Goals
2.1 VIRUSES 2.1 Learning Goals To understand the structure, function, and how Viruses replicate To understand the difference between Viruses to Prokaryotes and Eukaryotes; namely that viruses are not classified
NGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
ccfdna Webinar Series: The Basics and Beyond
ccfdna Webinar Series: The Basics and Beyond Part I Maxwell RSC ccfdna Plasma Kit and Maxwell RSC instrument are For Research Use Only. Not for Use in Diagnostic Procedures. Introduction to Circulating,
Diagnosis of infectious diseases and confirmation of diagnosis. Molecular epidemiology of emerging/re-emerging pathogens
LA PREPARAZIONE E LA RISPOSTA ALLE EMERGENZE INFETTIVE Padova, 20 settembre 2012 Laboratory advanced technologies in the support of Public Health interventions in infectious disease emergencies Prof. Giorgio
Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
Human Herpesviruses. VZV, EBV, and HHV-6-8. The rash of VZV is vesicular. MID 34
VZV, EBV, and HHV-6-8 Anne Gershon Human Herpesviruses Replication (lytic infection) occurs in a cascade Latency occurs when the cascade is interrupted Transcription of viral genome and protein synthesis
Table of Contents (continued)
Emerging Molecular and Immunohematology Blood Typing, Grouping And Infectious Disease NAT Screening Assays And Companies Developing New Technologies and Products Table of Contents 1. Blood Typing and Grouping
NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca
NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA
Hepatitis E FAQs for Health Professionals
Hepatitis E FAQs for Health Professionals Index of Questions ± Overview and Statistics What is Hepatitis E? How common is Hepatitis E in the United States? Where is Hepatitis E most common? Are there different
Viruses: Select Agents and Emerging Pathogens. Patricia Bolívar MS., CLS, PHM
Viruses: Select Agents and Emerging Pathogens Patricia Bolívar MS., CLS, PHM Objectives Review Select Agent Viruses. Key features to recognize Smallpox virus Update on emerging Viruses of possible pandemic
AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients
AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:
The Study of Congenital Infections. A/Prof. William Rawlinson Dr. Sian Munro
The Study of Congenital Infections A/Prof. William Rawlinson Dr. Sian Munro Current Studies SCIP Study of Cytomegalovirus (CMV) Infection in Pregnancy ASCI Amniotic Fluid Study of Congenital Infections
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
Norgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product # 33840 Product Insert Background Information
Immunodeficiency. (2 of 2)
Immunodeficiency (2 of 2) Acquired (secondary) immunodeficiencies More common Many causes such as therapy, cancer, sarcoidosis, malnutrition, infection & renal disease The most common of which is therapy-related
Advances in Gastrointestinal Pathogen Detection
Advances in Gastrointestinal Pathogen Detection Erin McElvania TeKippe, Ph.D., D(ABMM) Director of Clinical Microbiology Children s Health System, Assistant Professor of Pathology and Pediatrics UT Southwestern
Severe Herpes Zoster Following Varicella Vaccination in Immunocompetent Young Children
Original Article Severe Herpes Zoster Following Varicella Vaccination in Immunocompetent Young Children Journal of Child Neurology 2019, Vol. 34(4) 184-188 ª The Author(s) 2019 Article reuse guidelines:
STANDARD OPERATING PROCEDURE (SOP) CHICKENPOX [VARICELLA ZOSTER VIRUS (VZV)]
![STANDARD OPERATING PROCEDURE (SOP) CHICKENPOX [VARICELLA ZOSTER VIRUS (VZV)]](/thumbs/85/92218605.jpg "STANDARD OPERATING PROCEDURE (SOP) CHICKENPOX [VARICELLA ZOSTER VIRUS (VZV)]")
Page 1 of 9 SOP Objective To ensure that patients with chickenpox (Varicella Zoster Virus) are cared for appropriately and actions are taken to minimise the risk of cross-infection. This SOP applies to
Norgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended
Acyclovir dose for chicken pox
Buscar... Acyclovir dose for chicken pox Acyclovir (Zovirax) treats infections caused by the herpes viruses including genital herpes, cold sores, shingles and chicken pox. Includes Acyclovir side effects.
Properties of Herpesviruses
Herpesviruses Properties of Herpesviruses Structure and Composition Spherical icosahedron, 150-200 nm Double-stranded DNA, linear More than 35 proteins Enveloped Replication from nucleus (budding) Features
VirusDetect pipeline - virus detection with small RNA sequencing
VirusDetect pipeline - virus detection with small RNA sequencing CSC webinar 16.1.2018 Eija Korpelainen, Kimmo Mattila, Maria Lehtivaara Big thanks to Jan Kreuze and Jari Valkonen! Outline Small interfering
Foodborne viruses: the known unknowns. Martin D Agostino Virologist, Campden BRI 8 th June 2016
Foodborne viruses: the known unknowns Martin D Agostino Virologist, Campden BRI 8 th June 2016 What are Foodborne Viruses? Submicroscopic organisms No intrinsic metabolism Obligate parasites They cannot
Atlantic Provinces Pediatric Hematology Oncology Network Réseau d oncologie et d hématologie pédiatrique des provinces de l Atlantique
Atlantic Provinces Pediatric Hematology Oncology Network Réseau d oncologie et d hématologie pédiatrique des provinces de l Atlantique Reviewed and approved by specialists at the IWK Health Centre, Halifax,
(and what you can do about them)
(and what you can do about them) What s an outbreak? In general, more cases than expected (baseline) More cases clustered in a specific unit or facility than you d expect at a particular time of year Some
Deep-Sequencing of HIV-1
Deep-Sequencing of HIV-1 The quest for true variants Alexander Thielen, Martin Däumer 09.05.2015 Limitations of drug resistance testing by standard-sequencing Blood plasma RNA extraction RNA Reverse Transcription/
Annual Epidemiological Report
September 2018 Annual Epidemiological Report Key Facts Viral Meningitis, not 1 otherwise specified, in Ireland, 2017 In 2017, 259 cases of viral meningitis (NOS) (VM) were notified in Ireland (5.4/100,000
Trends in molecular diagnostics
Trends in molecular diagnostics Detection of target genes of interest Quantification Infectious diseases HIV Hepatitis C & B TB / MAC Cytomegalovirus Herpes simplex Varicella zoster CT/GC HPV Profiling
Disseminated shingles acyclovir
Disseminated shingles acyclovir The Borg System is 100 % Disseminated shingles acyclovir Two developed disseminated herpes zoster, one developed cytomegalovirus. Reduced response to acyclovir,. Disseminated
Evaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
Test Requested Specimen Ordering Recommendations
Microbiology Essentials Culture and Sensitivity (C&S) Urine C&S Catheter Surgical (excluding kidney aspirates) Voided Requisition requirements o Specific method of collection MUST be indicated o Indicate