(*Next Generation Sequencing)
|
|
- Felicity Haynes
- 5 years ago
- Views:
Transcription
1 (*Next Generation Sequencing) Patricia Aguilar Martinez, MD, PhD CHU de Montpellier, FRANCE & ENERCA WP leader 6 th European Symposium on Rare Anaemias-1 st Dutch-Belgian meeting for patients and health professionals 1
2 2 Disclosures Company name Research support Employee Consultant Stockholder Speakers bureau Advisory board Other Nothing to disclose 6 th European Symposium on Rare Anaemias-1 st Dutch-Belgian meeting for patients and health professionals
3 3 This talk is applicable for: Thalassaemia Sickle cell disease Membrane disorders (e.g. spherocytosis) Enzyme defects (e.g. G6PD,PKD) PNH Other forms of rare anaemias Definite Probable 6 th European Symposium on Rare Anaemias-1 st Dutch-Belgian meeting for patients and health professionals
4 4 outline Why do we perform genetic tests (for Rare Anaemias)? What has changed in 2015? Are genetic tests available on the internet reliable? What can we expect from NGS (next generation sequencing)? 6 th European Symposium on Rare Anaemias-1 st Dutch-Belgian meeting for patients and health professionals
5 1-Whydo weperformgenetictests for rare anaemias? Pastand present 6 th European Symposium on Rare Anaemias-1 st Dutch-Belgian meeting for patients and health professionals 5
6 6 Rare anaemias Most rare anaemias(ras) are inherited The driver of heredity is DNA Genetic tests can be useful for people carrying a RA 6 th European Symposium on Rare Anaemias-1 st Dutch-Belgian meeting for patients and health professionals
7 7 DNA is present in our cells cell Chromosomes nucleus
8 8 Chromosomes are made of DNA 46 2 x DNA X Y Protein* * e.g.: G6PD, pyruvate kinase, (haemo)globins
9 9 DNA (deoxyribonucleic acid) 4 subunits (A, T G, C) : nucleotides or bases 3 billion bases ACTGTAATGGGCGTGACATTACCCGC DNA sequence (arrangement of bases) of Human beings is 99.9% identical-only 0.1% is unique
10 10 Genes DNA contain genes Genes code for proteins Genetic diseases Ex: globin genes code for globin chains (haemoglobin) DNA
11 11 Genetic testing (analysis of DNA) Diagnosisof a disease Confirm a (difficult) diagnosis : Unstable hemoglobins Blackfan Diamond Anemia(DBA) Prenatal /pre-implantation diagnosis Preparation of prenatal diagnosis : DNA analysis of the carrier parents Prognosis of a disease Ex : (type of mutation, genetic modifiers ) Thalassemia major or intermedia Sickle cell disease
12 12 Genetic testing : methods DNA Sequencing (Sanger) Analysis of portions of genes or fragments of DNA CCTCACATGTGGAGCCACACCTA mutation? Genetic disease
13 13 2 -What has changed in 2015? Present (& future) 6 th European Symposium on Rare Anaemias-1 st Dutch-Belgian meeting for patients and health professionals
14 14 Main revolutions in genetic testing i. The role played by the web ii. Next generation sequencing (NGS) 6 th European Symposium on Rare Anaemias-1 st Dutch-Belgian meeting for patients and health professionals
15 15 i. Are genetic tests available on the internet reliable? 6 th European Symposium on Rare Anaemias-1 st Dutch-Belgian meeting for patients and health professionals
16 16 Traditional prescription of genetic tests prescription Officially labelled of genetic diagnosis laboratory Blood sample Parents, patients Specialized physician, geneticist Specialized (authorized) biologists GENETIC RESULTS GENETIC RESULTS
17 17 Direct To Consumer genetictesting(dtc) Order genetic test online Saliva sample Laboratory Parents, patients GENETIC RESULTS
18 18 DTC genetic tests : what can you order online? Disease risk DTC > Ancestry research Paternity or maternity tests Companies 23andme Navigenetics DeCODEme DNAexplain. Market (2009) : 20,000 30,000 people US $ per test Total around US $10 20 million* *Genetics IN Medicine Volume 12, Number 9, September 2010
19 19 Example of DTC Provider: decodeme Price: from EUR 840 Duration: Website: about 21 days 47 disease risks and genetic predispositions are analysed. Ancestry tests: Origin analysis Paternity test Paternity test without sample of the father Maternity test Maternity test without sample of the mother Prenatal paternity test Test with Trace Samples Reconstruction Test for Twins Lifestyle Gene Tests: GenePartner- Love is no coincidence! Warrior-Gene test Lifestyle Gentest Package (Warrior Gene & Factoids) Baby Gender DNA test Diagnostic Gene Tests: Genetic Health Tests Animal DNA Tests:
20 20 DTC genetictests in the USA
21 21 Problems with DTC genetic tests (1) 1. Risk of the method? Ex: contamination of the sample by another DNA 2. Safety of the result? Ex 1: Expertise of the laboratory analysis? Ex 2: Expertise of the biologists?
22 22 Problems with DTC genetic tests (2) 3. Interpretation of the result? Ex: complexity of the genetic results no doctor to explain Ex: Legal issues : for some illness it is mandatory to inform the relatives (e.g. France) 4. Privacy & related questions? My genome data available online? To whom? For what purpose? Insurance Legal issues
23 23 DTC genetictests in Europe
24 24 Genetictests in Europe
25 Information on genetictests 25
26 26 ii. Next Generation Sequencing (NGS) 6 th European Symposium on Rare Anaemias-1 st Dutch-Belgian meeting for patients and health professionals
27 DNA sequencing: Sanger method Analysis of fragments of DNA / portions of genes DNA Time consuming Cost
28 28 Next generation sequencing (NGS) High number of DNA fragments High number of genes
29 29 Next generation sequencing (NGS) All the coding regions of a gene : exome All the genome(coding and non coding regions)
30 30 International HumanGenomeProject (HGP) International scientific research project (> 20 labs : USA, UK, France, Australia, China and other spontaneous relationships.) Goal : determine the sequence of human DNA and mapping all the genes. $3 billion Begun in 1990(15 year-project) Declared completed in April : 1 genome $1,000 in one day
31 31 Next generation sequencing (NGS) Interest? Genetic diseases due to very big genes Genetic diseases due to several genes Ex: Blackfan Diamond anaemia Complex associations : multigene disorders Diseases with genetic modifiers Rapidity Decreased cost
32 32 Next generation sequencing (NGS) Problems? Too much data (bioinformatics) New ways of working for biologist New ethical and legal issues
33 33 «Incidentalfindings» in genescreens inadvertent discoveries made while looking for something else.
34 34 «Incidentalfindings» in genescreens The American College of Medical Genetics and Genomics (ACMG) recommended that every time a lab conducts DNA sequencing, the lab should also test for several dozen specific genes associated with other disorders should report the incidental findingsto anyone who ordered the tests, usually a physician. published a list of variants to be reported (does not include any RA)
35 35 Future is now NGS allows analysing the whole genome of an individual predicting diseases (even at birth) making a complete genetic card of an individual A new way to use genetic testing Probably a new area in medical practice 6 th European Symposium on Rare Anaemias-1 st Dutch-Belgian meeting for patients and health professionals
36 Laboratoire d hématologie, CHU de Montpellier, France Molecular Biology unit Collaborators Patricia Aguilar Martinez Séverine Cunat Muriel Giansily-Blaizot Olivier Guillot Grégory Moulis, Fabienne Danton Florence Rousseau Jean-François Schved Catherine Badens, Marseille Nathalie Couque, J Elion, Paris Lydie Da Costa, Paris Philippe Joly, Lyon Véronique Picard, Bicêtre Serge Pissard, Paris Jacques Rochette, Amiens Dimitris Loukopoulos, Greece (Hematimage),France Andrea Mosca, Italy Lydie da Costa, France Achille Iolascon, Italy Clara Camaschella, Italy Mayka Sanchez, Spain L Ribeiro, Portugal Mirela Ranglova, Bulgaria MD Capellini, Italy Panayiotis D Bamidis,Greece Didi Jasmin (ESH), France Beatrice Gulbis, Belgium Swee Lay Thein, UK JL Vives/Maria Manu, Spain Richard van Wijk, NL Barbara de la Salle, UK Marina Kleanthous, Cyprus 36
37 37 Thank you for your attention bedankt voor je aandacht 6 th European Symposium on Rare Anaemias-1 st Dutch-Belgian meeting for patients and health professionals
Education & training on rare anaemias: how to improve them? Patricia Aguilar Martinez CHU de Montpellier, FRANCE ENERCA
Education & training on rare anaemias: how to improve them? Patricia Aguilar Martinez CHU de Montpellier, FRANCE ENERCA Education & training on rare anaemias Past and present Medical education on rare
More information1. Define the public. 2. Describe the goals. 3. Find the adequate tools
Educational resources on rare anaemias in Europe : the role of ENERCA Dr Patricia Aguilar-Martinez, France Did you say Education? Medical education on rare anaemias 1. Define the public 2. Describe the
More informationRARE ANAEMIAS 2 ND EUROPEAN SYMPOSIUM ON MARCH 2008 FIRST ANNOUNCEMENT. ABSTRACT SUBMISSION Last day of Abstract submission 15 January 2008
FIRST ANNOUNCEMENT 2 ND EUROPEAN SYMPOSIUM ON RARE ANAEMIAS 13-14 MARCH 2008 Dear colleagues, On behalf of the Enerca working group, we would like to invite you to the Second European Symposium on Rare
More information21th -22th November 2015 Amsterdam The Netherlands
6 th EUROPEAN SYMPOSIUM ON RARE ANAEMIAS 1st Dutch-Belgian meeting for patients and health professionals 21th -22th November 2015 Amsterdam The Netherlands The 6 th European Symposium on Rare Anaemias
More informationGenetic Counselling in relation to genetic testing
Genetic Counselling in relation to genetic testing Dr Julie Vogt Consultant Geneticist West Midlands Regional Genetics Service September 2016 Disclosures for Research Support/P.I. Employee Consultant Major
More informationDeliverable D16.4: Report on the ENERCA educational day on sickle cell disease and thalassaemias. Executive summary
Deliverable D16.4: Report on the ENERCA educational day on sickle cell disease and thalassaemias Report version: Executive summary Project number: 2008 12 10 Project Acronym: ENERCA 3 Title: European Reference
More informationPartnership between sickle cell nurse and families in outpatient clinic
Partnership between sickle cell nurse and families in outpatient clinic Ngalula Mujinga Malou Nurse (sickle cell disease) University Children Hospital Queen Fabiola (HUDERF)(Belgium) 6 th EUROPEAN SYMPOSIUM
More informationEnerca: The European Network for Patients with Rare Anaemias
Mini Review imedpub Journals http://wwwimedpub.com Journal of Rare Disorders: Diagnosis & Therapy DOI: 10.21767/2380-7245.100009 Enerca: The European Network for Patients with Rare Anaemias Joan-Lluis
More informationThe European Reference Network in Rare Hematological Diseases
The European Reference Network in Rare Hematological Diseases Pierre Fenaux ERN-EuroBloodNet coordinator www.eurobloodnet.eu The context of ERNs Share. Care. Cure. Due to the small patient number and the
More informationHuman beings contain tens of thousands of genes, the basic material for cell
II. A Brief Overview of Genetics and Genetic Research Human beings contain tens of thousands of genes, the basic material for cell function including the transmission of hereditary characteristics. Genes
More informationThalassaemia and Abnormal Haemoglobins in Pregnancy
1. Purpose Thalassaemias and abnormal haemoglobins are detected in approximately 4% of patients of reproductive age attending the Women's. In almost half of these cases, the abnormality is not evident
More informationMedical Genetics in Undergraduate Medicine
Medical Genetics in Undergraduate Medicine Sandra Marles Section Leader without Separate Clerkship Overall Goal of New Genetics Curriculum To integrate teaching of genetic principles, genetic diseases
More informationGLOBAL GENETIC TESTING MARKET. Growth Trends & Forecasts. mordorintelligence.com
GLOBAL GENETIC TESTING MARKET 2014-2020 Growth Trends & Forecasts mordorintelligence.com TABLE OF CONTENTS 1 Introduction 1.1 Report Description 1.2 Research Methodology 2. Genetic Testing Market Overview
More informationWhat is New in Genetic Testing. Steven D. Shapiro MS, DMD, MD
What is New in Genetic Testing Steven D. Shapiro MS, DMD, MD 18th Annual Primary Care Symposium Financial and Commercial Disclosure I have a no financial or commercial interest in my presentation. 2 Genetic
More informationHormone related problems (Endocrinopathies and osteoporosis) Vincenzo de Sanctis Ferrara.
Hormone related problems (Endocrinopathies and osteoporosis) Vincenzo de Sanctis Ferrara vdesanctis@libero.it 6 th EUROPEAN SYMPOSIUM ON RARE ANAEMIAS 1 st Dutch-Belgian meeting for patients and health
More informationGenomics and Genetics in Healthcare. By Mary Knutson, RN, MSN
Genomics and Genetics in Healthcare By Mary Knutson, RN, MSN Clinical Objectives Understand the importance of genomics to provide effective nursing care Integrate genetic knowledge and skills into nursing
More informationResults of Newborn Blood-Spot screening
Results of Newborn Blood-Spot screening Carrier of a sickle cell gene sometimes called trait Hb AS Newborn Blood-Spot screening tests have shown that your baby carries a gene for sickle cell. Your baby
More informationChapter 1 : Genetics 101
Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic
More informationCarrying Beta Thalassaemia A carrier can use this booklet to
Carrying Beta Thalassaemia A carrier can use this booklet to help explain carrying beta to their partner, blood relatives and others. show to any health professional (doctor, nurse or midwife) they see
More informationCounselling and prenatal diagnosis. Antonis Kattamis, Greece
Counselling and prenatal diagnosis Antonis Kattamis, Greece Epidemiology of Hemoglobinopathies 7% of world population carriers of hemoglobinopathies 500.000 newborns annually affected 300.000 : Thalassemias
More informationScreening for haemoglobinopathies in pregnancy
Policy Statement All Southern Health patients will receive clinical care that reflects best practice and is based on the best available evidence. Index of chapters within background 1. Prevalence of haemoglobinopathies
More informationAgro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17
Agro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17 INTRODUCTION - Our genes underlie every aspect of human health, both in function and
More informationUnderstanding The Genetics of Diamond Blackfan Anemia
Understanding The Genetics of Diamond Blackfan Anemia Jason Farrar, MD jefarrar@ About Me Assistant Professor of Pediatrics at University of Arkansas for Medical Sciences & Arkansas Children s Hospital
More informationSNP Microarray. Prenatal
SNP Microarray Prenatal SNP Microarray Reveal SNP Microarray is a test that analyzes chromosomes for changes that can explain certain kinds of birth defects. This brochure is designed to answer some of
More informationYour blood test results show you may be a carrier of alpha thalassaemia
Your blood test results show you may be a carrier of alpha thalassaemia 1 Introduction This leaflet is for women who have had a test for sickle cell and thalassaemia in pregnancy and have been told they
More informationScreening for. and thalassaemia in pregnancy
Screening for Your sickle blood cell group and and thalassaemia pregnancy in pregnancy www.antenatalscreening.wales.nhs.uk Copyright 2018 2016 Public Health Wales NHS Trust. All All rights rights reserved.
More informationCongenital Dyserythropoietic anemias: where we are
Congenital Dyserythropoietic anemias: where we are Achille Iolascon Department of Molecular Medicine and Medical Biotechnology University Federico II of Naples, Italy achille.iolascon@unina.it 6 th EUROPEAN
More informationPREVENTION OF HAEMOGLOBINOPATHIES: New methodologies and procedures Non-invasive Prenatal Diagnosis
PREVENTION OF HAEMOGLOBINOPATHIES: New methodologies and procedures Non-invasive Prenatal Diagnosis Marina Kleanthous Cyprus School of Molecular Medicine The Cyprus Institute of Neurology and Genetics
More informationIntroduction to alpha thalassaemia
Many people originating from the Mediterranean area, the Middle East, Africa or Asia carry thalassaemia. It is common in these regions because it helps to protect carriers against some types of malaria.
More informationIntegrating the Latest in Genomic Science into Modern Medical Practice
Integrating the Latest in Genomic Science into Modern Medical Practice Mayo Clinic Center for Individualized Medicine Datapalooza DC, 2017 4/21/2017 1 My Genome is an iron overloaded, lipid accumulating,
More informationLab Activity Report: Mendelian Genetics - Genetic Disorders
Name Date Period Lab Activity Report: Mendelian Genetics - Genetic Disorders Background: Sometimes genetic disorders are caused by mutations to normal genes. When the mutation has been in the population
More informationIn adults, the predominant Hb (HbA) molecule has four chains: two α and two β chains. In thalassemias, the synthesis of either the α or the β chains
Thalassaemias Thalassemia Thalassemia is an inherited autosomal recessive blood disease. Associated with absence or reduction in a or b globin chains. Reduced synthesis of one of the globin chains can
More informationIllumina Clinical Services Laboratory
Illumina Clinical Services Laboratory Illumina, Inc. 5200 Illumina Way San Diego, CA 92122, USA Phone: 858.736.8080 Fax: 858.255.5285 everygenome@illumina.com CLIA Certificate No.: 05D1092911 Illumina
More informationChallenges and Opportunities with Rapidly-Changing Biomedical Technologies:
Challenges and Opportunities with Rapidly-Changing Biomedical Technologies: Insights from Genetic Testing for Colorectal Cancer 2016 CADTH Symposium Joanne Kim, M.Sc., Ph.D. 1 Disclosure The views expressed
More informationIVF & SURROGACY STANDARD OPTION PRICING LIV FERTILITY CENTER, PUERTO VALLARATA, MEXICO AUTUMN 2015
IVF & SURROGACY STANDARD OPTION PRICING LIV FERTILITY CENTER, PUERTO VALLARATA, MEXICO AUTUMN 2015 SURROGACY WITH 3 RD PARTY EGG DONOR Standard Fees & Payment Schedule Agency Fee: $4,500 USD a Consultancy
More informationResearch Ethics Board Research Consent Form Genetic Analysis
Participant name: DOB: HSC #: Research Ethics Board Research Consent Form Genetic Analysis Title of Research Project: Molecular and Genomic Analysis of Autism Spectrum and Associated Neurodevelopmental
More informationNeonatal Screening for Genetic Blood Diseases. Shaikha Al-Arayyed, PhD* A Aziz Hamza, MD** Bema Sultan*** D. K. Shome, MRCPath**** J. P.
Bahrain Medical Bulletin, Vol. 29, No. 3, September, 2007 Neonatal Screening for Genetic Blood Diseases Shaikha Al-Arayyed, PhD* A Aziz Hamza, MD** Bema Sultan*** D. K. Shome, MRCPath**** J. P. Bapat,PhD****
More informationBenefits and pitfalls of new genetic tests
Benefits and pitfalls of new genetic tests Amanda Krause Division of Human Genetics, NHLS and University of the Witwatersrand Definition of Genetic Testing the analysis of human DNA, RNA, chromosomes,
More informationpatient education Fact Sheet PFS007: BRCA1 and BRCA2 Mutations MARCH 2015
patient education Fact Sheet PFS007: BRCA1 and BRCA2 Mutations MARCH 2015 BRCA1 and BRCA2 Mutations Cancer is a complex disease thought to be caused by several different factors. A few types of cancer
More informationThalassemias:general aspects and molecular pathology
Thalassemias:general aspects and molecular pathology Prof. Renzo Galanello Pediatric Clinic 2 University of Cagliari Ospedale Regionale Microcitemie-ASL8 HEMOGLOBINOPATHIES CLASSIFICATION Structurally
More informationNational Haemoglobinopathy Reference Laboratory. Information for Users
National Haemoglobinopathy Reference Laboratory Information for Users Summary The NHRL offers a service for the identification of haemoglobinopathy genotypes by the molecular analysis of DNA and haematological
More informationCase Studies and Informed Consent. Ashley Cannon, PhD, MS, CGC Genomics Immersion Course 10/14/2015
Case Studies and Informed Consent Ashley Cannon, PhD, MS, CGC Genomics Immersion Course 10/14/2015 Case Study 1 You are studying the gene mutations in the NF1 gene in the hope of establishing genotype-phenotype
More informationCNNH NeuroGenomics Program Peer-to-Peer Service Consent/Information Form
CNNH NeuroGenomics Program Peer-to-Peer Service Consent/Information Form WHO WEARE The Center for Neurological and Neurodevelopmental Health (CNNH) is an innovative patient- and family-centered "Specialty
More informationGENETIC SCREENING. Prof Dr Karen Sermon, MD, PhD LEARNING OBJECTIVES DISCLOSURE
GENETIC SCREENING Prof Dr Karen Sermon, MD, PhD LEARNING OBJECTIVES At the conclusion of this presentation, participants should be able to answer the following questions: What is (genetic) screening? Why
More informationHeartland Genetics and Newborn Screening Collaborative Conference
Heartland Genetics and Newborn Screening Collaborative Conference Laurel K. Willig, MD Assistant Medical Director for the Center for Pediatric Genomic Medicine and Joshua E. Petrikin, MD Director of Neonatal
More informationGeneticsNow TM. A Guide to Testing Hereditary Conditions in Women & Men. Patient & Physician Information
GeneticsNow TM A Guide to Testing Hereditary Conditions in Women & Men Patient & Physician Information How can BRCA status affect your health? Everyone has BRCA1 and BRCA2 genes. However, sometimes the
More informationGENETIC TESTING. for Children with Autism Spectrum Disorder
GENETIC TESTING for Children with Autism Spectrum Disorder What Do We Know About Genetics and Autism Spectrum Disorder? We are learning more each day about the role genetics plays in autism spectrum disorder
More informationDeveloping Guidelines
Assessing Genomic Sequencing Information for Health Care Decision Making: A Workshop Developing Guidelines Howard M. Saal, M.D. Cincinnati Children s Hospital Medical Center University of Cincinnati College
More informationD7.1 Report summarising results of survey of EU countries to identify volumes and trends in relation to the import and export of stem cells
Disclaimer: The content of this Deliverable represents the views of the author only and is his/her sole responsibility; it cannot be considered to reflect the views of the European Commission and/or the
More informationD7.1 Report summarising results of survey of EU countries to identify volumes and trends in relation to the import and export of stem cells
Disclaimer: The content of this Deliverable represents the views of the author only and is his/her sole responsibility; it cannot be considered to reflect the views of the European Commission and/or the
More informationGenetics and Genetic Testing for Autism:
STAR Training 2/22/2018 Genetics and Genetic Testing for Autism: Demystifying the Journey to Find a Cause Alyssa (Ah leesa) Blesson, MGC, CGC Certified Genetic Counselor Center for Autism and Related Disorders
More informationArticle Preimplantation diagnosis and HLA typing for haemoglobin disorders
RBMOnline - Vol 11. No 3. 2005 362-370 Reproductive BioMedicine Online; www.rbmonline.com/article/1853 on web 20 July 2005 Article Preimplantation diagnosis and HLA typing for haemoglobin disorders Dr
More informationCancer Survivorship Symposium Cancer and Heredity January 16, Jeanne P. Homer, MS Licensed Certified Genetic Counselor
Cancer Survivorship Symposium Cancer and Heredity January 16, 2017 Jeanne P. Homer, MS Licensed Certified Genetic Counselor Outline Cancer and Heredity Hereditary Cancer Risk Assessment & Genetic testing
More informationGenomics for Rare Diseases
Genomics for Rare Diseases Gemma Chandratillake & Karola Rehnström East of England NHS Genomic Medicine Centre 21 st March 2018 Overview The genetic basis of rare disease Why is it useful to know the genetic
More informationTalking Genomes with Your Patients. Meagan Cochran, MS, CGC Certified Genetic Counselor HudsonAlpha Institute for Biotechnology
Talking Genomes with Your Patients Meagan Cochran, MS, CGC Certified Genetic Counselor HudsonAlpha Institute for Biotechnology Objectives Review the importance of physician familiarity with genomic testing
More informationWhat are the various Motives for Patients to Travel? -Dr Samit Sekhar Executive Director
What are the various Motives for Patients to Travel? -Dr Samit Sekhar Executive Director Reproductive Tourism Assisted reproductive technology (ART) lures people across borders. The willingness to travel
More informationGENETIC TESTING AND COUNSELING FOR HERITABLE DISORDERS
Status Active Medical and Behavioral Health Policy Section: Laboratory Policy Number: VI-09 Effective Date: 03/17/2014 Blue Cross and Blue Shield of Minnesota medical policies do not imply that members
More informationDNA Basics. We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work.
DNA Basics We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work. DNA is packaged into structures called chromosomes. Each chromosome contains many genes and each
More informationA Guide for Understanding Genetics and Health
2 Does it Run in the Family? A Guide for Understanding Genetics and Health National Council of La Raza Contents Why is genetics important to my family and me? 1 What makes me unique? 2 Tell me more about
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name and description (please provide any alternative names you wish listed) (A)-Testing
More informationNGS Types of gene dossier applications UKGTN can evaluate
NGS Types of gene dossier applications UKGTN can evaluate Jo Whittaker on behalf of the Genetic Test Evaluation Working Group & UKGTN Project team NGS used in a number of ways Replacement technology for
More informationPerspective on performance: The Haemoglobinopathies. Barbara Wild
Perspective on performance: The Haemoglobinopathies Barbara Wild Perspective on Performance: Performance assessment process DNA diagnostics for Haemoglobinopathies scheme Outcomes of shadow scoring exercise
More informationCorporate Medical Policy
Corporate Medical Policy Invasive Prenatal (Fetal) Diagnostic Testing File Name: Origination: Last CAP Review: Next CAP Review: Last Review: invasive_prenatal_(fetal)_diagnostic_testing 12/2014 3/2018
More informationGenetics of Thalassemia
Genetics of Thalassemia Submitted by : Raya Samir Al- Hayaly Sura Zuhair Salih Saad Ghassan Al- Dulaimy Saad Farouq Kassir Sama Naal Salouha Zahraa Jasim Al- Aarajy Supervised by : Dr. Kawkab Adris Mahmod
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationJoint Programming in Neurodegenerative Disease Research (JPND)
Joint Programming in Neurodegenerative Disease Research (JPND) Building Alliances and Collaborations Prof. Philippe Amouyel, MD, PhD JPND Chair France Disclosure CEO of Fondation Plan Alzheimer Conference
More informationNext Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii
More informationLearning Objectives. Genomic Medicine and Primary Care. Clinical Applications of Genome-Level DNA Sequencing. Molecular Medicine.
Presenter Disclosure Information 9:45 10:25am Genomic Medicine and Primary Care SPEAKER Wayne W. Grody, MD, PhD, FACMG, FCAP The following relationships exist related to this presentation: Wayne W. Grody,
More information1.2 Genes: Answers and Questions
1.2 Genes: Answers and Questions https://www.youtube.com/watch?v=ubq4eu_tdfc The Nucleus: control centre of the cell The nucleus contains the master set of instructions that determines: what each cell
More informationDisclosures. Update on Medical Genetics for Family Practitioners. Objectives. Genetic Testing. Types of Genetic Tests. Dogma of Genetics 08/05/2018
Update on Medical Genetics for Family Practitioners Genetic Testing, Newborn Screening, and Direct to Consumer Testing Sandhya Parkash, MD, FRCPC, FCCMG Maritime Medical Genetics Service, IWK Health Centre
More informationManuel Cardoso RARHA Executive Coordinator Public Health MD Senior Advisor Deputy General-Director of SICAD - Portugal
Manuel Cardoso RARHA Executive Coordinator Public Health MD Senior Advisor Deputy General-Director of SICAD - Portugal Public Health Public health is the science and art of preventing disease, prolonging
More informationInformation for fathers invited for a screening test for sickle cell disease and thalassaemia major
Information for fathers invited for a screening test for sickle cell disease and thalassaemia major Who is this leaflet for? This leaflet is for fathers invited to have a screening test for haemoglobin
More informationHearing Loss: The Statistics
: The Statistics 2015 Global Statistics It is hard to know precise numbers of how many people experience hearing loss across the EU, Europe, and indeed the world. There are many sources of information
More informationBRCAnowTM It s Your Decision
Hereditary Breast and Ovarian Cancer BRCAnowTM It s Your Decision Patient & Physician Information What is BRCA? The breast cancer genes BRCA1 and BRCA2 are found within an individual s normal genetic makeup;
More informationA Guide for Understanding Genetics and Health
2 D o e s i t Ru n i n t h e Fa m i ly? A Guide for Understanding Genetics and Health Institute for Cultural Partnerships Contents Why is genetics important to my family and me? 1 What makes me unique?
More informationThalassaemia and other haemoglobinopathies
EXECUTIVE BOARD EB118/5 118th Session 11 May 2006 Provisional agenda item 5.2 Thalassaemia and other haemoglobinopathies Report by the Secretariat PREVALENCE OF HAEMOGLOBINOPATHIES 1. Haemoglobinopathies,
More informationPreimplantation Genetic Testing Where are we going? Genomics Clinical Medicine Symposium Sept 29,2012 Jason Flanagan, MS,CGC
Preimplantation Genetic Testing Where are we going? Genomics Clinical Medicine Symposium Sept 29,2012 Jason Flanagan, MS,CGC Overview Discuss what PGD and PGS are Pt examples What we have learned Where
More informationA Guide for Understanding Genetics and Health
2 Does it Run in the Family? A Guide for Understanding Genetics and Health brookdale hospital and medical center Contents Why is genetics important to my family and me? 1 What makes me unique? 2 Tell me
More informationThe University of Arizona Pediatric Residency Program. Primary Goals for Rotation. Genetics
The University of Arizona Pediatric Residency Program Primary Goals for Rotation Genetics 1. GOAL: Understand the role of the pediatrician in preventing genetic disease, and in counseling and screening
More informationDisclosure. Agenda. I do not have any relevant financial/non financial relationships with any proprietary interests
Luis Rohena, MD Chief, Medical Genetics San Antonio Military Medical Center Assistant Professor of Pediatrics USUHS & UTHSCSA 15JUNE2014 51st Annual Teaching Conference Pediatrics for the Practitioner
More informationIntroduction to Evaluating Hereditary Risk. Mollie Hutton, MS, CGC Certified Genetic Counselor Roswell Park Comprehensive Cancer Center
Introduction to Evaluating Hereditary Risk Mollie Hutton, MS, CGC Certified Genetic Counselor Roswell Park Comprehensive Cancer Center Objectives Describe genetic counseling and risk assessment Understand
More informationGenetics update and implications for (General) Practice
Genetics update and implications for (General) Practice May 12 th 2018 Women s Health Symposium Clearwater Estate Dr Kate Gibson MB BCh, MRCP, FRACP Topics NZ Clinical Genetics delivery New Technologies
More informationPitfalls in the premarital testing for thalassaemia
Pitfalls in the premarital testing for thalassaemia Dr. Riad Amer MB ChB, MSc, FRCP, FRCPath, JBH Assistant Professor of Medicine Al Najah University Consultant Haematologist Case 1 Husband and Wife are
More informationWhat is the relationship between genes and chromosomes? Is twinning genetic or can a person choose to have twins?
WHAT WILL YOU KNOW? What is the relationship between genes and chromosomes? Is twinning genetic or can a person choose to have twins? How could a person have the gene for something that is never apparent?
More informationVan test naar diagnose naar
Van test naar diagnose naar V therapie op maat Marjolein Kriek, LUMC Joris Veltman, RUNMC Exome diagnostics in genetically heterogeneous disease Joris Veltman, PhD Department of Human Genetics Radboud
More informationHuman Genetics Notes:
Human Genetics Notes: Human Chromosomes Cell biologists analyze chromosomes by looking at. Cells are during mitosis. Scientists then cut out the chromosomes from the and group them together in pairs. A
More informationDr Banu Kaya Consultant Haematologist Barts Health NHS Trust Royal London Hospital, London, UK SICKLE CELL AND THALASSAEMIA OVERVIEW
Dr Banu Kaya Consultant Haematologist Barts Health NHS Trust Royal London Hospital, London, UK SICKLE CELL AND THALASSAEMIA OVERVIEW Objectives Gain awareness of haemoglobinopathy inheritance, pathophysiology
More informationDimensions of Wellness :
Chapter 1: Self, Family, and Community Dimensions of Wellness : Health and Wellness Health: state of complete physical, mental, social, and spiritual well-being Wellness: process of adopting patterns of
More informationChapter 1. Self, Family, and Community
Chapter 1 Self, Family, and Community 1 Dimensions of Wellness 2 Health and Wellness Health: state of complete physical, mental, social, and spiritual well-being Wellness: process of adopting patterns
More informationCurriculum Vitae Prof. Silverio Perrotta
Curriculum Vitae Prof. Silverio Perrotta Date and place of birth: 14/11/1962, Naples (Italy) Working Address: Dipartimento della Donna, del Bambino e di Chirurgia Generale e Specialistica, University of
More informationGENEPLANET. The value proposition of genetic testing as an insurance offering
GENEPLANET The value proposition of genetic testing as an insurance offering ABOUT GENEPLANET More than 10 YEARS on the market. More than 20 NATIONALITIES, over 50 employees. Present in more than 30 COUNTRIES
More informationTowards Integrated Syndromic Surveillance in Europe?
Towards Integrated Syndromic Surveillance in Europe? Duncan Cooper - Born in Bradford Research Study, UK Triple-S partners including Anette Hulth, Alexandra Ziemann, Jean-Babtiste Perrin, Mark Kanieff,
More informationGENETIC TESTING: WHAT DOES IT REALLY TELL YOU? Shawnia Ryan, MS, LCGC Senior Genetic Counselor University of New Mexico Cancer Center
GENETIC TESTING: WHAT DOES IT REALLY TELL YOU? Shawnia Ryan, MS, LCGC Senior Genetic Counselor University of New Mexico Cancer Center What is genetic counseling? communication process address individual
More informationPersonalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection
Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis, Inc. 1350 Willow Road, Suite 202, Menlo Park, California 94025
More informationNewborn bloodspot results: predictive value of screen positive test for thalassaemia major
Original Article Newborn bloodspot results: predictive value of screen positive test for thalassaemia major J Med Screen 20(4) 183 187! The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalspermissions.nav
More informationAlpha_Zero_Thalas_07:1 24/4/07 11:14 Page 1. Alpha Zero
Alpha_Zero_Thalas_07:1 24/4/07 11:14 Page 1 Information for people who carry Alpha Zero Thalassaemia Alpha_Zero_Thalas_07:1 24/4/07 11:14 Page 2 People who carry alpha are said to hae alpha trait. This
More informationThalassaemia. Ayes ha Syed 10C
Thalassaemia Ayes ha Syed 10C 2 Syed Genetic Clinic Dr Ayesha Syed 123 DNA Avenue, Chromosome Nucleus, Animal Cell 3458 (123) 456-7890 Thalassaemia 25 October, 2017. Dear Mr and Mrs Mitochondria, Here
More informationHuman Genes. The Human Genome Project
Human Genes The Human Genome Project 1. To understand what a genome is and its importance 2. To trace the history of the Human Genome Project and understand the driving forces behind its establishment
More informationClinical, haematological, and genetic studies of type 2
Journal of Medical Genetics 1988, 25, 195-199 Clinical, haematological, and genetic studies of type 2 normal Hb A2 thalassaemia ANNA METAXOTOU-MAVROMATI, CHRISTOS KATTAMIS, LILIAN MATATHIA, MARIA TZETIS,
More informationFactor XIII deficiency
Factor XIII deficiency Information for families Great Ormond Street Hospital for Children NHS Foundation Trust 2 Factor XIII deficiency is a type of clotting disorder. A specific protein is missing from
More information