Global and Regional Situation of Zoonotic Influenza in Humans, and Pandemic Preparedness

Size: px
Start display at page:

Download "Global and Regional Situation of Zoonotic Influenza in Humans, and Pandemic Preparedness"

Transcription

1 Global and Regional Situation of Zoonotic Influenza in Humans, and Pandemic Preparedness Takato Odagiri Director WHO Collaborating Center on Influenza, Tokyo and Influenza Virus Research Center, National Institute of Infectious Diseases, Japan

2 Influenza A Viruses All influenza A virus subtypes are detected in aquatic birds H1 - H16 N1 - N9 Aquatic birds Poultry Humans Pigs Horses Aquatic mammals Pandemic potential routes Cats Dogs

3 Zoonotic Influenza A viruses currently detected in Animals and Humans in the World (since Sept 2016) Avian viruses H5Nx : H5N1 (poultry, wild birds, human(6))(860) H5N2 (poultry, wild birds) H5N5 (wild birds) H5N6 (poultry, wild birds, human (16)) H5N8 (poultry, wild birds) H7N9 : (poultry, human(758), environment) (1564) H7N2 : (poultry) H9N2 : (environment, human(4)) Swine viruses H1N1v (pig) H1N2v (human(2), pig) H3N2v (human(31), pig) Since 2003, Since 2013,

4 Zoonotic Influenza A viruses currently detected in Animals and Humans in the World (since Sept 2016) Avian viruses H5Nx : H5N1 (poultry, wild birds, human(6))(860) H5N2 (poultry, wild birds) H5N5 (wild birds) H5N6 (poultry, wild birds, human (16)) H5N8 (poultry, wild birds) H7N9 : (poultry, human(758), environment) (1564) H7N2 : (poultry) H9N2 : (environment, human(4)) Swine viruses H1N1v (pig) H1N2v (human(2), pig) H3N2v (human(31), pig) Since 2003, Since 2013,

5 Evolution of A(H5) HA genes China, China HK SAR, Vietnam, Laos, Korea H5N6 H5N8 H5N2 Bangladesh, India Cambodia, China, Vietnam, Cote d Ivoire, Ghana, Nigeria a c b a Egypt and b a

6 Global distribution of H5Nx virus clades A(H5) activity birds c Non GS/GD a c c Mar Apr May Jun Jul Aug Sep WHO VCM for 2018 Southern H, Sept 28 Melbourne

7 A(H5) activity - birds since 27 September a c c WHO VCM for Northern H, Mar 2 Geneva

8

9 Recent human infection cases with A(H5Nx) viruses Sept. 2016~Feb new reported cases, China Egypt Sept Oct Nov Dec Jan Feb Mar. ~Sept new A(H5N1) cases Egypt 860 A(H5N1) cases/453 fatal 16 A(H5N6) cases/11 fatal Indonesia Mar Apr May Jun Jul Aug Sept WHO VCM for Northern H, Fen Mar 2 Geneva WHO VCM for 2018 Southern H, Sept 28 Melbourne

10 Zoonotic Influenza A viruses currently detected in Animals and Humans in the World (since Sept 2016) Avian viruses H5Nx : H5N1 (poultry, wild birds, human(9))(859) H5N2 (poultry, wild birds) H5N5 (wild birds) H5N6 (poultry, wild birds, human (4)) H5N8 (poultry, wild birds) H7N9 : (poultry, human(758), environment) (1564) H7N2 : (poultry) H9N2 : (environment, human(9)) Swine viruses H1N1v (pig) H1N2v (human(5), pig) H3N2v (human(18), pig) Since 2003, Since 2013,

11 Data provided by China CDC

12 Recent human cases infected with LPAI and HPAIV A(H7N9) viruses A(H7N9) activity birds

13 Data provided by China CDC Pandemic potential with H7N9 viruses is not low Sustained H-to-H transmission is limited so far

14 Phylogenetic relationships of H7N9 virus HA genes Other Region 13 Genotypes Pearl River Delta 33 Genotypes Yangtze River Delta 36 Genotypes JS537 AnH1 JS18828 JX9530 JS1 SH7 AnH1887 GD2 GD1 GD8423 DG397 GX8970 Data provided by China CDC

15 Import cases of A(H7N9) infection in Canada, Malaysia and Taiwan Wang DY et al, J Virol, 2016

16 Summary of A(H7N9) human cases reported to WHO since 27 September human cases of A(H7N9) virus infection (288 fatal) in 5th W Total cases since 2013 = 1564 with 610 deaths Chinese Taipei, Hong Kong Special Administrative Region and Macau Special Administrative Region reported travelassociated cases CFR in reported cases = 39% 68% exposed to live poultry or contaminated environments 40 clusters confirmed, but not sustained human-to-human transmission The majority of A(H7N9) viruses detected in poultry and in humans are low pathogenic Since 2016 high pathogenic A(H7N9) viruses were detected in poultry and in human (28 cases) Most of H7N9 viruses recovered from patients were susceptible to antivirals of NA inhibitors

17 Candidate vaccine viruses (CVVs) for zoonotic influenza

18 Process of CVV selection and update for Zoonotic influenza WHO Vaccine Composition Meetings (VCM) held twice in a year (Northern and Southern Hemispheres) CCs (6)/ERLs (4) NICs (144 Labs) H5 Reference Labs (13) (seasonal influenza) Sharing information OIE / OFFLU (zoonotic)

19 Available H5Nx CVVs provided by WHO CCs/ERLs

20 Available H7N9 CVVs provided by WHO CCs/ERLs Yangtze river delta-lineage viruses (predominant-lineage) High-path virus Low-path virus

21 Available CVVs of A(H1)v and A(H3N2)v provided by WHO CCs/ERLs

22 Pandemic influenza preparedness framework (PIP-FW) in WHO

23

24 WHO PIP-Framework is for; Virus sharing Equally access to vaccines and other benefits To get PIP-CVVs and reference viruses, members and stakeholders need to contract with WHO by S MTA2 ( Under the S MTA2, members and stakeholders are required to response partnership contribution Partnership contribution is used for equal access of pandemic vaccine and for strengthen of pandemic preparedness (

25 Novel virus detection system for pandemic preparedness at alert phase by Japanese government (MOHLW and HIID)

26 Rapid preparation of novel virus detection system by PCR at all local PHLs and quarantine labs in alert phase Government project supported by MOHLW and NIID Systematic collection of zoonotic influenza viruses as a library in NIID (supported by zoonotic sectors, e.i., NIAH, Hokkaido U, Kagoshima U, Kyoto S.U.) PCR-positive control prep from library viruses and rapid distribution to local PHLs and quarantine labs for immediate setup of PCR-detection system

27 Primers/Probes distributed to local PHLs and quarantine Labs for discrimination of novel virus Primers and probes Type/subtype Gene Primer Sequence fragment Influenza type A Matrix MP-39-67For CCMAGGTCGAAACGTAYGTTCTCTCTATC (M) MP Rev TGACAGRATYGGTCTTGTCTTTAGCCAYTCCA MP-96-75ProbeAs 5'-(FAM)-ATYTCGGCTTTGAGGGGGCCTG-(MGB)-3' Influenza A HA NIID-swH1 TMPrimer-F1 AGAAAAGAATGTAACAGTAACACACTCTGT H1N1 pandemic NIID-swH1 TMPrimer-R1 TGTTTCCACAATGTARGACCAT virus NIID-swH1 Probe2 5 -(FAM)-CAGCCAGCAATRTTRCATTTACC-(MGB)-3' Former seasonal HA NIID-H1 TMPrimer-F1 CCCAGGGYATTTCGCYGACTATGAG A(H1N1) NIID-H1 TMPrimer-R1 CATGATGCTGAYACTCCGGTTACG NIID-H1 Probe1 5'-(FAM)-TCTCAAAYGAAGATACTGAACT- (MGB)-3' A(H3N2) viruses HA NIID-H3 TMPrimer-F1 CTATTGGACAATAGTAAAACCGGGRGA NIID-H3 TMPrimer-R1 GTCATTGGGRATGCTTCCATTTGG NIID-H3 Probe1 5'-(FAM)-AAGTAACCCCKAGGAGCAATTAG-(MGB)-3' A(H5N1) viruses HA H5HA v2-For CGATCTAGAYGGGGTGAARCCTC (Clade 1, 2, 3) H5HA v2-Rev CCTTCTCCACTATGTANGACCATTC H5HA For(2010) 1 CGATCTAAATGGAGTGAAGCCTC H5HA Rev(2010) 1 CCTTCTCTACTATGTAAGACCATTC H5-Probe-239-RVa 2 5'-(FAM)-AGCCAYCCAGCTACRCTACA-(MGB)-3' H5-Probe-239-RVb 2 5'-(FAM)-AGCCATCCCGCAACACTACA-(MGB)-3' Influenza type B NS NIID-TypeB TMPrimer-F1 GGAGCAACCAATGCCAC NIID-TypeB TMPrimer-R1 GTKTAGGCGGTCTTGACCAG NIID-TypeB Probe1 5'-(FAM)-ATAAACTTTGAAGCAGGAAT-(MGB)-3' Procedure

28 New CVV of A/H5N6 (cl ) from zoonotic virus library in NIID is available for distribution WHO-new CVV

29 Thank you Mt. Fuji from Murayama-campus, NIID, Tokyo

インフルエンザの疫学について 国 感染研インフルエンザウイルス研究センター WHOインフルエンザ協 センターセンター 切孝

インフルエンザの疫学について 国 感染研インフルエンザウイルス研究センター WHOインフルエンザ協 センターセンター 切孝 インフルエンザの疫学について 国 感染研インフルエンザウイルス研究センター WHOインフルエンザ協 センターセンター 切孝 1 Influenza A Viruses All influenza A virus subtypes are detected in aquatic birds H1 - H16 N1 - N9 Aquatic birds Poultry Humans Pigs Horses

More information

Avian Influenza Viruses with Pandemic Potential

Avian Influenza Viruses with Pandemic Potential Avian Influenza Viruses with Pandemic Potential Takato Odagiri Director WHO Collaborating Center on Influenza, Tokyo and Influenza Virus Research Center, National Institute of Infectious Diseases, Japan

More information

GLOBAL AND REGIONAL SITUATION OF AVIAN INFLUENZA

GLOBAL AND REGIONAL SITUATION OF AVIAN INFLUENZA GLOBAL AND REGIONAL SITUATION OF AVIAN INFLUENZA Dr Gounalan Pavade OIE Regional Expert Group Meeting for the Control of Avian Influenza in Asia Sapporo, Japan 3-5 October 2017 1 Avian influenza Outbreaks

More information

Emergence and Changes in swine and avian influenza viruses of Pandemic Potential

Emergence and Changes in swine and avian influenza viruses of Pandemic Potential Emergence and Changes in swine and avian influenza viruses of Pandemic Potential Fourth Annual SARInet Meeting May 23-26, 2017 Punta Cana, Dominican Republic Stephen Lindstrom, Ph.D. Diagnostics Development

More information

H5N1 avian influenza: timeline

H5N1 avian influenza: timeline H5N1 avian influenza: timeline 28 October 2005 Previous events in Asia 1996 Highly pathogenic H5N1 virus is isolated from a farmed goose in Guangdong Province, China. 1997 Outbreaks of highly pathogenic

More information

OIE Situation Report for Highly Pathogenic Avian Influenza

OIE Situation Report for Highly Pathogenic Avian Influenza OIE Situation Report for Highly Pathogenic Avian Influenza Latest update: 28/02/2018 The epidemiology of avian influenza is complex. The virus constantly evolves and the behavior of each new subtype (and

More information

OIE Situation Report for Avian Influenza

OIE Situation Report for Avian Influenza OIE Situation Report for Avian Influenza Latest update: 24/04/2017 This report presents an overview of current disease events reported to the OIE by its Members. The objective is to describe what is happening

More information

OIE Situation Report for Avian Influenza

OIE Situation Report for Avian Influenza OIE Situation Report for Avian Influenza Latest update: 25/01/2018 The epidemiology of avian influenza is complex. The virus constantly evolves and the behavior of each new subtype (and strains within

More information

Pandemic H1N Dr. Maria Neira Global Influenza Programme WHO, Geneva

Pandemic H1N Dr. Maria Neira Global Influenza Programme WHO, Geneva Pandemic H1N1 2010 Dr. Maria Neira Global Influenza Programme WHO, Geneva WHO Role during pandemic (H1N1) 2009 Under the International Health Regulations (2005) Detect event (notification by Member States

More information

Contribution of avian influenza data through OFFLU network

Contribution of avian influenza data through OFFLU network Dr Gounalan Pavade Chargé de Mission, OIE Headquarters Contribution of avian influenza data through OFFLU network Asia-Pacific Workshop on surveillance, prevention and control of zoonotic influenza Paro,

More information

Global updates on avian influenza and tools to assess pandemic potential. Julia Fitnzer Global Influenza Programme WHO Geneva

Global updates on avian influenza and tools to assess pandemic potential. Julia Fitnzer Global Influenza Programme WHO Geneva Global updates on avian influenza and tools to assess pandemic potential Julia Fitnzer Global Influenza Programme WHO Geneva Pandemic Influenza Risk Management Advance planning and preparedness are critical

More information

Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness

Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness February 2014 The development of representative candidate influenza

More information

OIE Situation Report for Avian Influenza

OIE Situation Report for Avian Influenza OIE Situation Report for Avian Influenza Latest update: 18/09/2017 This report presents an overview of current disease events reported to the OIE by its Members. The objective is to describe what is happening

More information

Avian influenza viruses from the global perspective

Avian influenza viruses from the global perspective Avian influenza viruses from the global perspective Wenqing Zhang SARI Surveillance in the Americas (SARInet) Meeting 28-30 April 2015 Cancun, Mexico Complex modern world Increasingly crowded Growth in

More information

Influenza. Paul K. S. Chan Department of Microbiology The Chinese University of Hong Kong

Influenza. Paul K. S. Chan Department of Microbiology The Chinese University of Hong Kong Influenza Paul K. S. Chan Department of Microbiology The Chinese University of Hong Kong Influenza Virus Nomenclature Influenza virus A, B & C Influenza A : Haemagglutinin (H), neuraminidase (N) A H3N2,

More information

MI Flu Focus. Influenza Surveillance Updates Bureaus of Epidemiology and Laboratories

MI Flu Focus. Influenza Surveillance Updates Bureaus of Epidemiology and Laboratories MI Flu Focus Influenza Surveillance Updates Bureaus of Epidemiology and Laboratories Editor: Susan Peters, DVM PetersS1@michigan.gov January 3, 2013 Surveillance and Infectious Disease Epidemiology Vol.

More information

OIE Situation Report for Avian Influenza

OIE Situation Report for Avian Influenza OIE Situation Report for Avian Influenza Latest update: 08/05/2017 This report presents an overview of current disease events reported to the OIE by its Members. The objective is to describe what is happening

More information

OIE s initiative on HPAI control

OIE s initiative on HPAI control Current global situation on HPAI and OIE s initiative on HPAI control The 5 th OIE Regional Meeting on Strengthening e g Animal Health Information Networking for HPAI control and prevention in Asia Hanoi,

More information

USAID s approach to the control of avian and pandemic influenza

USAID s approach to the control of avian and pandemic influenza USAID s approach to the control of avian and pandemic influenza Murray Trostle, Dr. PH Deputy Director Avian and Pandemic Influenza Unit USAID December 19, 2006 USAID goals Prevent an influenza pandemic

More information

OFFLU AVIAN INFLUENZA REPORT

OFFLU AVIAN INFLUENZA REPORT OFFLU AVIAN INFLUENZA REPORT Avian Influenza Events in Animals for the period February to September 2017 Scope In this document we present a summary of H5, H7, and H9 avian influenza events that occurred

More information

Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness

Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness September 2014 The development of representative candidate influenza

More information

OIE Situation Report for Avian Influenza

OIE Situation Report for Avian Influenza OIE Situation Report for Avian Influenza Latest update: 10/07/2017 This report presents an overview of current disease events reported to the OIE by its Members. The objective is to describe what is happening

More information

Global Challenges of Pandemic and Avian Influenza. 19 December 2006 Keiji Fukuda Global influenza Programme

Global Challenges of Pandemic and Avian Influenza. 19 December 2006 Keiji Fukuda Global influenza Programme Global Challenges of Pandemic and Avian Influenza 19 December 2006 Keiji Fukuda Global influenza Programme Summary of Current H5N1 Situation 1997 First known outbreak infecting humans 18 people hospitalized

More information

Global Health Security: Preparedness and Response: can we do better and stay safe?

Global Health Security: Preparedness and Response: can we do better and stay safe? Global Health Security: Preparedness and Response: can we do better and stay safe? John Watson Health Protection Directorate, Public Health England Formerly Deputy Chief Medical Officer, Department of

More information

AAHL s Regional One-Health Activities

AAHL s Regional One-Health Activities International partnerships Disease reservoirs Unique capability AAHL s Regional One-Health Activities Dr. Kurt Zuelke Director, Health & Biosecurity and AAHL 30 October 2015 6 th Asia Pacific Workshop

More information

Questions and Answers

Questions and Answers Questions and Answers Recommended composition of influenza virus vaccines for use in the southern hemisphere 2016 influenza season and development of candidate vaccine viruses for pandemic preparedness

More information

Middle East respiratory syndrome coronavirus (MERS-CoV) and Avian Influenza A (H7N9) update

Middle East respiratory syndrome coronavirus (MERS-CoV) and Avian Influenza A (H7N9) update 30 August 2013 Middle East respiratory syndrome coronavirus (MERS-CoV) and Avian Influenza A (H7N9) update Alert and Response Operations International Health Regulations, Alert and Response and Epidemic

More information

Wolfgang Preiser. H5N1 in human beings and other influenza viruses of this season. Wolfgang Preiser. H5N1 avian influenza: Timeline of major events

Wolfgang Preiser. H5N1 in human beings and other influenza viruses of this season. Wolfgang Preiser. H5N1 avian influenza: Timeline of major events H5N1 avian influenza: Timeline of major events "One Health" Avian Influenza Lunchtime Seminar Friday 19 August 2011 H5N1 in human beings and other influenza viruses of this season Wolfgang Preiser Division

More information

AI surveillance of domestic birds in Vietnam. Under the OIE/Japan Trust Fund Project (JTF) for Strengthening HPAI Control in Asia,

AI surveillance of domestic birds in Vietnam. Under the OIE/Japan Trust Fund Project (JTF) for Strengthening HPAI Control in Asia, AI surveillance of domestic birds in Vietnam Under the OIE/Japan Trust Fund Project (JTF) for Strengthening HPAI Control in Asia, 2008-2012 Kenji Sakurai, OIE Asia-Pacific Tokyo, 13-14 December 2012 Contents

More information

Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness

Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness 4 Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness September 2018 The development of influenza candidate vaccine

More information

Regional Overview of the implementation of National Control Strategies for Avian Influenza. Summary review of questionnaire OIE RRAP

Regional Overview of the implementation of National Control Strategies for Avian Influenza. Summary review of questionnaire OIE RRAP Regional Overview of the implementation of National Control Strategies for Avian Influenza Summary review of questionnaire OIE RRAP The OIE Questionnaire on Influenza A surveillance in animals in the Asia

More information

OFFLU AVIAN INFLUENZA POST VCM REPORT

OFFLU AVIAN INFLUENZA POST VCM REPORT OFFLU AVIAN INFLUENZA POST VCM REPORT Avian Influenza Events for the period September 2017 to February 2018 Scope In this document we present a summary of H5, H7, and H9 avian influenza events that occurred

More information

Promoting Public Health Security Addressing Avian Influenza A Viruses and Other Emerging Diseases

Promoting Public Health Security Addressing Avian Influenza A Viruses and Other Emerging Diseases Promoting Public Health Security Addressing Avian Influenza A Viruses and Other Emerging Diseases Masaya Kato, WHO Viet Nam OIE Regional Workshop on Enhancing Influenza A viruses National Surveillance

More information

Influenza and other Respiratory Viruses Update

Influenza and other Respiratory Viruses Update Influenza and other Respiratory Viruses Update-- 2017 Pete Shult, PhD CDD Director & Emergency Laboratory Response and Erik Reisdorf, MPH, M(ASCP) CM Surveillance and Virology Lab-Team Lead WISCONSIN STATE

More information

Avian Influenza/Newcastle Disease Virus Subcommittee

Avian Influenza/Newcastle Disease Virus Subcommittee Avian Influenza/Newcastle Disease Virus Subcommittee David L. Suarez D.V.M., Ph.D. Patti Miller D.V.M., Ph.D. Claudio Afonso Ph.D. Southeast Poultry Research Laboratory United States National Poultry Research

More information

OIE tools and global overview on Avian Influenza Dr Jocelyn Mérot OIE Sub Regional Representation for North Africa Tunis, Tunisia

OIE tools and global overview on Avian Influenza Dr Jocelyn Mérot OIE Sub Regional Representation for North Africa Tunis, Tunisia 10 th JPC REMESA - Heraklion, Greece (16-17 March 2015) OIE tools and global overview on Avian Influenza Dr Jocelyn Mérot OIE Sub Regional Representation for North Africa Tunis, Tunisia 1 Global management

More information

Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness

Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness 4 Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness September 2015 The development of candidate influenza vaccine

More information

Influenza at the human-animal interface

Influenza at the human-animal interface Influenza at the human-animal interface Summary and assessment, 17 January to 14 February 2017 New infections 1 : Since the previous update, new human infections with influenza A(H7N9) and A(H1N1)v viruses

More information

OIE Situation Report for Highly Pathogenic Avian Influenza

OIE Situation Report for Highly Pathogenic Avian Influenza OIE Situation Report for Highly Pathogenic Avian Influenza Latest update: 31/05/2018 The epidemiology of avian influenza (AI) is complex. The AI virus constantly evolves by mutation and re-assortment with

More information

Challenges for the control of avian influenza and preparedness for future pandemics in humans

Challenges for the control of avian influenza and preparedness for future pandemics in humans 6th Asia-Pacific Workshop on Multi-Sectoral Collaboration for the Prevention and Control of Zoonoses 28-30 October 2015, Hokkaido University, Sapporo, Japan Session 2 Situation update on Zoonoses Challenges

More information

Global and Regional Strategies for HPAI and CSF

Global and Regional Strategies for HPAI and CSF Global and Regional Strategies for HPAI and CSF 2 Key Strategic Approach Strengthening of Veterinary Services and related national capacity, including compliance with OIE standards and guidelines on quality

More information

HPAI. Update of H7N9 in china:the epidemiological and virological features LPAI. H7N9 avian influenza viruses (before 2013)

HPAI. Update of H7N9 in china:the epidemiological and virological features LPAI. H7N9 avian influenza viruses (before 2013) Update of H7N9 in china:the epidemiological and virological features Yuelong Shu WHO Collaborating Center for Reference and Research on Influenza Chinese National Influenza Center National Institute for

More information

Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness

Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness 4 Antigenic and genetic characteristics of zoonotic influenza viruses and development of candidate vaccine viruses for pandemic preparedness September 2017 The development of candidate influenza vaccine

More information

Current Situation on Avian Influenza and the pandemic threat

Current Situation on Avian Influenza and the pandemic threat Vaccine-preventable diseases and Immunization, Communicable Diseases Surveillance and Response Current Situation on Avian Influenza and the pandemic threat IVth Joint EC/ECDC/WHO Workshop on Pandemic Influenza

More information

Influenza Surveillance Animal and Public Health Partnership. Jennifer Koeman Director, Producer and Public Health National Pork Board

Influenza Surveillance Animal and Public Health Partnership. Jennifer Koeman Director, Producer and Public Health National Pork Board Influenza Surveillance Animal and Public Health Partnership Jennifer Koeman Director, Producer and Public Health National Pork Board Outline Background on influenza surveillance in swine Case example animal

More information

Surveillance Overview

Surveillance Overview Number of Positive Specimens Percent Positive Number of Positive Specimens National Center for Immunization & Respiratory Diseases 2016-17 Surveillance Overview Lynnette Brammer, MPH Epidemiologist, Influenza

More information

Overview of human cases of AI H5N1 since 1997

Overview of human cases of AI H5N1 since 1997 Overview of human cases of AI H5N1 since 1997 Dr Sylvie Briand WHO Global Influenza Programme 7 October 2008 1 FAO-OIE- WHO Joint Technical Consultation on AI at the Human-Animal Interface Review of the

More information

INFLUENZA SURVEILLANCE

INFLUENZA SURVEILLANCE Cough, Cough, Sneeze, Wheeze: Update on Respiratory Disease Lisa McHugh, MPH Infectious and Zoonotic Disease Program Communicable Disease Service New Jersey Department of Health INFLUENZA SURVEILLANCE

More information

Cough, Cough, Sneeze, Wheeze: Update on Respiratory Disease

Cough, Cough, Sneeze, Wheeze: Update on Respiratory Disease Cough, Cough, Sneeze, Wheeze: Update on Respiratory Disease Lisa McHugh, MPH Infectious and Zoonotic Disease Program Communicable Disease Service New Jersey Department of Health INFLUENZA SURVEILLANCE

More information

Alberta Health. Seasonal Influenza in Alberta. 2016/2017 Season. Analytics and Performance Reporting Branch

Alberta Health. Seasonal Influenza in Alberta. 2016/2017 Season. Analytics and Performance Reporting Branch Alberta Health Seasonal Influenza in Alberta 2016/2017 Season Analytics and Performance Reporting Branch September 2017 For more information contact: Analytics and Performance Reporting Branch Health Standards,

More information

ph1n1 H3N2: A Novel Influenza Virus Reassortment

ph1n1 H3N2: A Novel Influenza Virus Reassortment ph1n1 H3N2: A Novel Influenza Virus Reassortment Jonathan Gubbay Medical Microbiologist Public Health Laboratory Public Health Ontario June 16, 2011 ph1n1 H3N2 Reassortment: Talk Overview Explain strain

More information

Humanitarian Initiative to Prepare for a Pandemic Influenza Emergency (HIPPIE) Ron Waldman, MD Avian and Pandemic Influenza Unit USAID/Washington

Humanitarian Initiative to Prepare for a Pandemic Influenza Emergency (HIPPIE) Ron Waldman, MD Avian and Pandemic Influenza Unit USAID/Washington Humanitarian Initiative to Prepare for a Pandemic Influenza Emergency (HIPPIE) Ron Waldman, MD Avian and Pandemic Influenza Unit USAID/Washington Objectives of Presentation Review current status of avian

More information

Review of Avian Influenza A(H5N1) for WHO SAGE

Review of Avian Influenza A(H5N1) for WHO SAGE Review of Avian Influenza A(H5N1) for WHO SAGE SAGE Geneva November 2013 Joseph Bresee, MD Epidemiology and Prevention Branch Influenza Division National Center for Immunization and Respiratory Diseases

More information

Bi-weekly Influenza Situation Update

Bi-weekly Influenza Situation Update Bi-weekly Influenza Situation Update 2 January 2019 Virological Surveillance Summary The total number of specimens and number of positive specimens reported to FluNet by Western Pacific Region countries

More information

Recent surveillance of influenza in animals and joint risk assessments

Recent surveillance of influenza in animals and joint risk assessments Recent surveillance of influenza in animals and joint risk assessments FAO ECTAD TEAM LAOS, MYANMAR, VIETNAM, RAP, HQ OIE Regional Expert Group Meeting for the Control of Avian Influenza in Asia Sapporo,

More information

Influenza A(H5N1) activity from 27 September 2010 to 15 February 2011

Influenza A(H5N1) activity from 27 September 2010 to 15 February 2011 Antigenic and genetic characteristics of influenza A(H5N1) and influenza A(H9N2) viruses for the development of candidate vaccine viruses for pandemic preparedness February 2011 The development of representative

More information

INFLUENZA-2 Avian Influenza

INFLUENZA-2 Avian Influenza INFLUENZA-2 Avian Influenza VL 7 Dec. 9 th 2013 Mohammed El-Khateeb Overview 1. Background Information 2. Origin/History 3. Brief overview of genome structure 4. Geographical Distribution 5. Pandemic Nature

More information

OIE Situation Report for Highly Pathogenic Avian Influenza

OIE Situation Report for Highly Pathogenic Avian Influenza OIE Situation Report for Highly Pathogenic Avian Influenza Latest update: 30/06/2018 The epidemiology of avian influenza (AI) is complex. The AI virus constantly evolves by mutation and re-assortment with

More information

Influenza and the Poultry Link

Influenza and the Poultry Link Influenza and the Poultry Link Hemagglutinin Neuraminidase Type A Influenza Surface Antigens Subtype Surface Antigens Hemagglutinin 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 human equine swine Neuraminidase

More information

Influenza Updates. The newsletter of the WHO Collaborating Centre for Reference and Research on Influenza in Melbourne

Influenza Updates. The newsletter of the WHO Collaborating Centre for Reference and Research on Influenza in Melbourne Influenza Updates The newsletter of the WHO Collaborating Centre for Reference and Research on Influenza in Melbourne Volume 5, Issue 1, April 016 Preparation for the Southern Hemisphere influenza season

More information

Emerging Infectious Disease Categories (NIAID) 1 of 3

Emerging Infectious Disease Categories (NIAID) 1 of 3 Emerging Diseases Emerging Infectious Disease Categories (NIAID) 1 of 3 Category A Priority Pathogens Category A pathogens are those organisms/biological agents that pose the highest risk to national security

More information

Development of an Influenza Risk Assessment Tool

Development of an Influenza Risk Assessment Tool Development of an Influenza Risk Assessment Tool Susan C. Trock, DVM, MPH, Dip. ACVPM (Epi) Influenza Division, NCIRD, CDC OFFLU Technical Meeting, April 5, 2012 National Center for Immunization & Respiratory

More information

Flu Watch. MMWR Week 4: January 21 to January 27, and Deaths. Virologic Surveillance. Influenza-Like Illness Surveillance

Flu Watch. MMWR Week 4: January 21 to January 27, and Deaths. Virologic Surveillance. Influenza-Like Illness Surveillance Flu Watch MMWR Week 4: January 21 to January 27, 218 All data are provisional and subject to change as more reports are received. Geographic Spread South Carolina reported widespread activity this week.

More information

Recommended composition of influenza virus vaccines for use in the influenza season

Recommended composition of influenza virus vaccines for use in the influenza season Recommended composition of influenza virus vaccines for use in the 2006 2007 influenza season This recommendation relates to the composition of vaccines for the forthcoming influenza season in the northern

More information

Country Analyst. Asia: Swine Flu and the 2003 SARS Experience

Country Analyst. Asia: Swine Flu and the 2003 SARS Experience Suan Teck Kin, CFA Suan.TeckKin@uobgroup.com Jimmy Koh Jimmy.KohCT@uobgroup.com UOB Economic-Treasury Research Company Reg No. 193500026Z Asia: Swine Flu and the 2003 SARS Experience The current outbreak

More information

For the control of avian influenza

For the control of avian influenza OIE Regional Expert Group Meeting for the Control of Avian influenza in Asia Sapporo, 3-5 October 2017 For the control of avian influenza Hiroshi Kida Hokkaido University Research Center for Zoonosis Control

More information

Highly Pathogenic Avian Influenza Virus Research

Highly Pathogenic Avian Influenza Virus Research Highly Pathogenic Avian Influenza Virus Research Robert G. Webster, PhD Division of Virology Department of Infectious Diseases St. Jude Children s Research Hospital Memphis, TN Influenza A Viruses 15 HA

More information

in Vietnam Under the OIE/Japan Trust Fund Project (JTF) for Strengthening HPAI Control Hanoi, 2-3 October 2012

in Vietnam Under the OIE/Japan Trust Fund Project (JTF) for Strengthening HPAI Control Hanoi, 2-3 October 2012 Influenza A virus Prevalence Studies in Poultry in Vietnam Under the OIE/Japan Trust Fund Project (JTF) for Strengthening HPAI Control in Asia, 2008-2012 Kenji Sakurai OIE Asia Pacific Kenji Sakurai, OIE

More information

OFFLU Technical Meeting Coordinating world-wide surveillance for influenza in swine OIE Paris, 6-7 April 2011

OFFLU Technical Meeting Coordinating world-wide surveillance for influenza in swine OIE Paris, 6-7 April 2011 OFFLU Technical Meeting Coordinating world-wide surveillance for influenza in swine OIE Paris, 6-7 April 2011 Frank Wong CSIRO Australian Animal Health Laboratory, Geelong, Australia OIE Reference Laboratory

More information

Wild Poliovirus*, 03 Aug 2004 to 02 Aug 2005

Wild Poliovirus*, 03 Aug 2004 to 02 Aug 2005 Wild Poliovirus*, 03 Aug 2004 to 02 Aug 2005 Wild virus type 1 Wild virus type 3 Wild virus type 1 & 3 Endemic countries Re-established transmission countries Case or outbreak following importation *Excludes

More information

Avian Influenza A(H7N9) Overview

Avian Influenza A(H7N9) Overview Avian Influenza A(H7N9) Overview Side event organized by China and WHO 21 May 2013 1 Avian Influenza A(H7N9) Novel Coronavirus (ncov) World experiencing emergence of 2 exceptional new virus infections

More information

Recommended composition of influenza virus vaccines for use in the 2007 influenza season

Recommended composition of influenza virus vaccines for use in the 2007 influenza season Recommended composition of influenza virus vaccines for use in the 2007 influenza season September 2006 This recommendation relates to the composition of vaccines for the forthcoming winter in the southern

More information

Agricultural Outlook Forum Presented: February 16, 2006 THE CURRENT STATE OF SCIENCE ON AVIAN INFLUENZA

Agricultural Outlook Forum Presented: February 16, 2006 THE CURRENT STATE OF SCIENCE ON AVIAN INFLUENZA Agricultural Outlook Forum Presented: February 16, 2006 THE CURRENT STATE OF SCIENCE ON AVIAN INFLUENZA David L. Suarez Southeast Poultry Research Laboratory, Exotic and Emerging Avian Viral Diseases Research

More information

Seasonality of influenza activity in Hong Kong and its association with meteorological variations

Seasonality of influenza activity in Hong Kong and its association with meteorological variations Seasonality of influenza activity in Hong Kong and its association with meteorological variations Prof. Paul Chan Department of Microbiology The Chinese University of Hong Kong Mr. HY Mok Senior Scientific

More information

Avian Influenza (Bird Flu) Fact Sheet

Avian Influenza (Bird Flu) Fact Sheet What is an avian influenza A (H5N1) virus? Influenza A (H5N1) virus also called H5N1 virus is an influenza A virus subtype that occurs mainly in birds. It was first isolated from birds (terns) in South

More information

Rapid and Accuracy Diagnosis of Highly Pathogenic Avian Influenza (H5N8) Virus used for the Control of the Outbreak in the Republic of Korea

Rapid and Accuracy Diagnosis of Highly Pathogenic Avian Influenza (H5N8) Virus used for the Control of the Outbreak in the Republic of Korea Rapid and Accuracy Diagnosis of Highly Pathogenic Avian Influenza (H5N8) Virus used for the Control of the Outbreak in the Republic of Korea Third Global Conference of OIE Reference Centres Incheon(Seoul),

More information

Influenza Updates. The newsletter of the WHO Collaborating Centre for Reference and Research on Influenza in Melbourne

Influenza Updates. The newsletter of the WHO Collaborating Centre for Reference and Research on Influenza in Melbourne Influenza Updates The newsletter of the WHO Collaborating Centre for Reference and Research on Influenza in Melbourne Volume 5, Issue, October 16 WHO Recommendations for the Southern Hemisphere 17 influenza

More information

M E E T I N G R E P O R T. Expert Group Meeting on Swine Influenza in Asia Pacific Region

M E E T I N G R E P O R T. Expert Group Meeting on Swine Influenza in Asia Pacific Region Summary M E E T I N G R E P O R T Expert Group Meeting on Swine Influenza in Asia Pacific Region Tokyo, Japan, 23 April 2013 Reported by the Regional Representation for Asia and the Pacific The captioned

More information

OFFLU contribution to the WHO vaccine selection meeting

OFFLU contribution to the WHO vaccine selection meeting OFFLU contribution to the WHO vaccine selection meeting WHO Consultation on the Composition of Influenza Vaccines for the Southern Hemisphere 0 (0- Feb 0, Geneva) Giovanni Cattoli OFFLU Annual technical

More information

Where Health Care Meets Policy. with Dr. Mike Magee

Where Health Care Meets Policy. with Dr. Mike Magee Where Health Care Meets Policy with Dr. Mike Magee The Threat of Bird Flu Understanding Bird Flu and the Influenza Virus 3 types of the influenza virus: A, B and C reflect differences in the M protein

More information

Influenza Situation Update

Influenza Situation Update Influenza surveillance summary This influenza surveillance summary includes countries where routine surveillance is conducted and information is available. Countries in the temperate zone of the Northern

More information

Influenza & Other Respiratory Viruses Update

Influenza & Other Respiratory Viruses Update Influenza & Other Respiratory Viruses Update 2013-2014 Pete Shult, PhD. Director, Communicable Disease Division and Emergency Response Erik Reisdorf, MPH M (ASCP) CM Team Lead, Virology Laboratory WCLN

More information

EU Market Situation for Poultry. Committee for the Common Organisation of the Agricultural Markets 20 April 2017

EU Market Situation for Poultry. Committee for the Common Organisation of the Agricultural Markets 20 April 2017 EU Market Situation for Poultry Committee for the Common Organisation of the Agricultural Markets 2 April 217 -9.% -11.% -5.% -.1% -.7% -2.2% 3.% 1.7% 1.2%.8%.6%.%.%.% 7.9% 7.% 6.4% 6.2% 6.% 5.5% 5.3%

More information

Pandemic Influenza and Vaccine Preparedness. GIP - Global Influenza Programme WHO2017

Pandemic Influenza and Vaccine Preparedness. GIP - Global Influenza Programme WHO2017 Pandemic Influenza and Vaccine Preparedness 1 Influenza viruses 18 HA subtypes and 11 NA subtypes known In humans Influenza A H1N1 and H3N2 Influenza B Minor changes in virus surface protein - epidemics

More information

Global Influenza Virus Surveillance and WHO Influenza Vaccine Virus Recommendations for the Northern Hemisphere Influenza Season

Global Influenza Virus Surveillance and WHO Influenza Vaccine Virus Recommendations for the Northern Hemisphere Influenza Season Global Influenza Virus Surveillance and WHO Influenza Vaccine Virus Recommendations for the Northern Hemisphere 2015-16 Influenza Season Jacqueline Katz, Ph. D. Deputy Director (acting), Influenza Division

More information

Alberta Health. Seasonal Influenza in Alberta Season. Analytics and Performance Reporting Branch

Alberta Health. Seasonal Influenza in Alberta Season. Analytics and Performance Reporting Branch Alberta Health Seasonal Influenza in Alberta 2015-2016 Season Analytics and Performance Reporting Branch August 2016 For more information contact: Analytics and Performance Reporting Branch Health Standards,

More information

Bi-weekly Influenza Situation Update

Bi-weekly Influenza Situation Update Bi-weekly Influenza Situation Update 15 August 2018 Virological Surveillance Summary The total number of specimens and number of positive specimens reported to FluNet by Western Pacific Region countries

More information

AVIAN INFLUENZA (A/H5N1) SITUATION IN VIETNAM, National Institute of Hygiene and Epidemiology

AVIAN INFLUENZA (A/H5N1) SITUATION IN VIETNAM, National Institute of Hygiene and Epidemiology AVIAN INFLUENZA (A/H5N1) SITUATION IN VIETNAM, 2003-2005 National Institute of Hygiene and Epidemiology General Information Area: 332,600 km2 Provinces: 64 Districts: 668 Communes/wards: 10,732 Population:

More information

Egypt Success Story In Combating Avian Influenza

Egypt Success Story In Combating Avian Influenza Egypt Success Story In Combating Avian Influenza Wild bird situation Approximately 4 millions migratory birds pass over Egypt. About 500,000 migratory birds spend a period of time in 35 Wetland Areas Highly

More information

Avian influenza. Why the concern?

Avian influenza. Why the concern? bulletin Europeen sur les maladies transmissibles = European communicable disease bulletin 21. 5. Kenyon, T.A. et al. (1996) Transmission of multidrug-resistant Mycobacterium tuberculosis during a long

More information

Title. Author(s)Kida, Hiroshi. Issue Date Doc URL. Type. File Information. example. Prevention of Infectious Diseases. 2 November 2009.

Title. Author(s)Kida, Hiroshi. Issue Date Doc URL. Type. File Information. example. Prevention of Infectious Diseases. 2 November 2009. Title Global Surveillance is the Key for the Control of Zo example Author(s)Kida, Hiroshi Sustainability Weeks 2009 Opening Symposium "Interna CitationRecommendations for Tackling the 5 Challenges of Glo

More information

Pandemic Influenza: Hype or Reality?

Pandemic Influenza: Hype or Reality? Pandemic Influenza: Hype or Reality? Leta Finch Executive Director, Higher Education Practice 2003 Arthur J. Gallagher & Co. Objectives Review key characteristics of influenza, including differences between

More information

Flu Watch. MMWR Week 3: January 14 to January 20, and Deaths. Virologic Surveillance. Influenza-Like Illness Surveillance

Flu Watch. MMWR Week 3: January 14 to January 20, and Deaths. Virologic Surveillance. Influenza-Like Illness Surveillance Flu Watch MMWR Week 3: January 14 to January 2, 218 All data are provisional and subject to change as more reports are received. Geographic Spread South Carolina reported widespread activity this week.

More information

Pandemic Influenza: A Zoonotic Infection. Kathleen M. Neuzil, MD, MPH PATH University of Washington School of Medicine April 28, 2008

Pandemic Influenza: A Zoonotic Infection. Kathleen M. Neuzil, MD, MPH PATH University of Washington School of Medicine April 28, 2008 Pandemic Influenza: A Zoonotic Infection Kathleen M. Neuzil, MD, MPH PATH University of Washington School of Medicine April 28, 2008 Questions What is the epidemiology of human influenza? What is the role

More information

Brief history of the development of the Framework on Sharing influenza viruses and access to vaccines and other benefits

Brief history of the development of the Framework on Sharing influenza viruses and access to vaccines and other benefits Brief history of the development of the Framework on Sharing influenza viruses and access to vaccines and other benefits The Intergovernmental (IGM) Process Since the late 1940's, WHO has coordinated a

More information

National Strategies for Controlling Avian Influenza Viruses

National Strategies for Controlling Avian Influenza Viruses National Strategies for Controlling Avian Influenza Viruses Viet Nam Background information Animal population Major animal diseases of concerns Population of Livestock in Viet Nam Year Buffalo Cattle Pigs

More information

Trends of Pandemics in the 21 st Century

Trends of Pandemics in the 21 st Century Trends of Pandemics in the 21 st Century 1 H5N1 influenza, Hong Kong, 1997: 18 human infections/6 deaths 500 450 400 350 300 250 200 150 100 50 0 #H5N1 #sampled Parks Live domesticated foul markets Source:

More information

Table 1: Summary of Texas Influenza (Flu) and Influenza-like Illness (ILI) Activity for the Current Week Texas Surveillance Component

Table 1: Summary of Texas Influenza (Flu) and Influenza-like Illness (ILI) Activity for the Current Week Texas Surveillance Component Texas Surveillance Report 2017 2018 Season/2018 MMWR Week 03 (Jan. 14, 2018 Jan. 20, 2018) Report produced on 1/27/2018 Summary activity remains high across the state of Texas. Compared to the previous

More information

AVIAN INFLUENZA & NEWCASTLE ACTIVITIES

AVIAN INFLUENZA & NEWCASTLE ACTIVITIES AVIAN INFLUENZA & NEWCASTLE ACTIVITIES MIA KIM TORCHETTI, DVM MS PHD SECTION HEAD AVIAN, DIAGNOSTIC VIROLOGY LABORATORY U.S. DEPARTMENT OF AGRICULTURE ANIMAL AND PLANT HEALTH INSPECTION SERVICE VETERINARY

More information

Research Issues in Animal Surveillance and Pandemic Planning

Research Issues in Animal Surveillance and Pandemic Planning Research Issues in Animal Surveillance and Pandemic Planning Robert G. Webster, PhD Division of Virology Department of Infectious Diseases St. Jude Children s Research Hospital SURVEILLANCE Spread of H5N1

More information