MGI3. Concerted circadian oscillations in transcript levels of nineteen Lha/b (cab) genes in L ycopersicon esculentum (tomato)

Transcription

1 Mol Gen Genet (1993) 237: MG3 Sprnger-Verlag 1993 Concerted crcadan oscllatons n transcrpt levels of nneteen Lha/b (cab) genes n L ycoperscon esculentum (tomato) Jan-Wolfhard Kellmann 1., Ncole Merforth 1, Mchael Wese 1, ran Pchersky 2 and Brgt Pechulla 1 1 nsttut ffr Bocheme der Pflanze, Untere Karspfle 2, W-34 G6ttngen, FRG z Unversty of Mchgan, Department of Bology, Ann Arbor, M 4819, USA Receved August 1, 1992 / Accepted September 28, 1992 Summary. Steady-state mrna levels of nneteen members of the Lha/b (cab) gene famly of Lycoperscon esculentum, encodng nne dfferent types of lght-harvestng complex (LHC) polypeptdes, were determned by prmer extenson analyss. ach Lha/b gene s expressed and ndvdual mrnas accumulate to dstnct levels. The relatve contrbuton of each Lha/b mrna to the total Lha/b mrna levels s very smlar n dfferent green organs (leaves, stems, fruts, sepals) and after lght treatment of etolated seedlngs. Detaled analyss of Lha/b mrna accumulaton n leaves under lght/dark condtons, contnuous darkness and contnuous lght revealed durnal and crcadan oscllatons of Lha/b mrnas for all genes. Only mnor nstances of dvergence from a general expresson pattern are apparent. Together these results ndcate a concerted expresson of all genes, suggestng that smlar or dentcal molecular mechansms and sgnal transducton chan control the expresson of all Lha/b genes. Key words: Tomato (Lycoperscon esculentum) - Lha/b gene expresson - Lght harvestng complex (LHC) protens - Gene famly - Crcadan rhythm ntroducton The group of evolutonary and structurally related genes known as cab or Lha/b (Green et al ; Jansson et al. 1992), encode the chlorophyll a/b-bndng polypeptdes of the lght harvestng systems n plant thylakods. n tomato, nneteen Lha/b genes have so far been characterzed (Green et al. 1991), codng for protens that belong to the lght harvestng complex LHC, assocated wth photosystem (PS), and the lght harvestng complexes of LHC, CP29, and CP24, all assocated wth PS. * Present address: Max-P1anck-nsttut ffr Zchtgungsforschung, Carl-von-Lnne-Weg 1, W-5 K61n, FRG Correspondence to: B. Pechulla At least nne dfferent types of Lha/b genes have been dentfed so far, whose products dsplay varatons resultng from sequence smlartes whch range from 4 to 85%. n tomato, about half of the dfferent types of LHC polypeptdes are encoded by more than one gene, and the genes are located n many unlnked loc on most of the tomato chromosomes, wth some clusterng of genes encodng the same type of polypeptde. The expresson of the Lha/b genes n hgher plant speces has been prevously nvestgated. ndogenous (organ and tssue specfcty, developmental program and crcadan clock, Kuhlemeer et al. 1987; Meyer et al. 1989, Kay and Mllar 1992) and exogenous (lght and temperature, Kuhlemeer et al. 1987; Pechulla and Resselmann 199) sgnals were shown to play mportant roles n determnng the accumulaton levels of Lha/b mrna n etolated seedlngs and also n adult plants. However n most of the prevous work, only one knd of gene probe, the Lhbl gene, was used and therefore the results represent prmarly the expresson pattern of the genes encodng the type LHC proten of photosystern. n addton, n only a few nvestgatons were gene-specfc probes used to dentfy ndvdual Lhbl transcrpts (Sheen and Bogorad 1986; Kellmann et al. 199; Mllar and Kay 1991) and to our knowledge only n three cases were Lha mrnas, whch encode LHC polypeptdes, dscrmnated from Lhb mrnas (Stayton et al. 1989; Tavladorak and Argyroud-Akoyunoglou 1989; Wehmeyer et al. 199). At ths tme t s not known to what extent each ndvdual Lha/b gene contrbutes to the total amount of the Lha/b mrna levels present at specfc tmes durng the day and n specfc organs or tssues of tomato or other plant speces. Snce dfferent Lha/b genes encode specfc types of LHC protens, whch may have dstnct functons or locatons wthn the thylakod membrane, t was of nterest to determne the ndvdual Lha/b mrna levels n varous green plant organs (leaves, stems, green fruts and sepals) and also n etolated seedlngs llumnated wth whte lght or red and far-red lght pulses.

2 44 However, the sequence smlarty between the Lha/b genes complcates the detecton of ndvdual expresson patterns n conventonal dot or Northern blot hybrdzaton experments. Cross-hybrdzaton n Northern blots s dffcult to avod and often dffcult to detect snce the lengths of the Lha/b gene transcrpts are very smlar. Therefore the prmer extenson technque was chosen to determne the steady-state mrna levels of ndvdual members of a gene famly (Dean et al. 1987; Stayton et al. 1989; Kellmann et al. 199). We appled ths method to detect ndvdual Lha/b mrnas of the well-characterzed tomato Lha/b gene famly. The ndvdual Lha/b mrnas are dentfed by ther specfc transcrpt length based on the bndng poston of the olgonucleotde (Pechulla et al. 1991). Furthermore, the defned expermental condtons allow precse quanttaton n fmol/mg total RNA of each ndvdual Lha/b mrna. Materals and methods Plant growth condtons and RNA solaton. Leaves were harvested from tomato plants at 38 days (Fgs. 4 and 5) and 42 days (Fg. 6) (Lycoperscon esculentum Mll. VFNT LA 1221). Plants were grown n a growth chamber on clay beads, watered wth tap water and kept under a 12 h lght/12 h dark regme (3 gmol/m 2 per s, Osram Unversal Wess, L 65 W/25) and at constant temperature (24 C). Leaves were harvested at the ndcated tme ponts. n addton, leaves were harvested at 1.3 p.m. from 5-day-old plants grown n the greenhouse at the Unversty of G6ttngen (Fg. 2). Stems,.e. all nternodal segments from the top down to the prmary leaves, were harvested from 56- and 69-day-old tomato plants. Green fruts cm n dameter (approxmately 1 days after pollnaton) were obtaned from 58- and 73-day-old plants. Sepals were harvested from flowerng 61- and 69-day-old tomato plants. Stems, green fruts and sepals were harvested at 12. p.m. from plants grown n the greenhouse under natural lght condtons. tolated tomato seedlngs grew n growth chambers at constant temperature (23 C) for 7 days and were llumnated wth whte lght (6. a.m. to 6. p.m., 29 gmol/m 2 per s, Osram Lumlux 58 W, colour 31; Fg. 3 and Table 2). For the phytochrome experment the tomato seedlngs were grown n darkness for 1 days (25 C) and treated wth red and far-red pulses as descrbed by Mohr et al. (1979); 1 ran red lght (2max= 658 rm, 3.8 gmol/m 2 per s), 1 ran far-red lght (2max = 73 nm, 18 gmol/m 2 per s) and 1 ran red lght followed by 1 ran far-red lght. solaton and purfcaton of the RNA from these tssues was performed as descrbed elsewhere (Kellmann et al. 199). Determnaton of steady-state Lha/b mrna levels. Prmer extenson wth specfc olgonucleotdes were carred out to determne the steady-state mrna levels expressed by ndvdual Lha/b genes (Table 1). Olgonucleotdes were labelled at the 5' end and a.1 pmol alquot of the prmer was spotted onto a nylon membrane to determne the specfc radoactvty (Cerenkov countng). Annealng of the olgonucleotde to the specfc Lha/b mrna was optmzed by varyng the potassum chlorde concentraton and the hybrdzaton temperature (Pechulla et al. 1991). The experments descrbed here were performed wth.3 pmol olgonucleotde coprecptated wth 5 gg of total RNA. The relatve levels Table 1. Olgonucleotde sequences complementary to Lha/b genes of Lycoperscon esculentum and resultng length of prmer-extended fragments Olgo- Gene specfcty Photo- Sequence Length of prmer nucleotde ~ system extenson fragment A/21 (-21) Lhb la (cab A) GATTTATATTAAGAGAAAAGT 7" 1B/21 (--21) Lhblb (cab 1B) TTGTGTTTATTTTAAC-ACrAAG 45" C/18 (--51) Lhblc (cab 1C) ~ATGGTAAACTTTTTGAA 37 a 1D/17 (--43) Lhbld (cab ]D) TGTTTGATGGTATGAGA 46 3A/18 (--37) Lhblf (cab 3A) AAAAGAAATGAATTGTGT 38 3B/21 (--21) Lhblg (cab 3B) TATGAACTCTTAGAATGTACA 37 a 3C/21 (-21) Lhblh (cab 3C) TATAGAAGTAGAATGAGAAAC 6 ~ 4/23 (+83) Lhb2a (cab 4) AATACGGCCTTCACCGAAGTTGC 163 b 5/17 (+92) Lhb2b (cab 5) GGTGACACGTCCACCTT /21 (--21) Lhb3 (cab 13) TTTCTTCAACTTCTCAAAATA 51 b/49 9/18 (+37) Lhb5 (cab 9) CTTGACCGGACTTCCGAG 135b/126/11 1B/22 (+ 19) Lhb6a/b (cab 1A/B) TCAAGCCATTCAGCACTGCAGT l16b/15//89b/81 6/21 (+37) Lhala/b (cab 6A/B) GAGGAAAGAGGGGCAAACAGC 119u//112 7/17 (--3) Lha2 (cab 7) TCACTCTTGTGTTTGTG 3 b 8/18 (+34) Lha3 (cab 8) TTCAGCTGAAGTGCTAAT 12 b 11/22 (--46) Lha4a (cab 11) GGTGATTATTGGGAGAAATGGC 47 b 12/2 (+24) Lha4b (cab 12) GGAGGGAAGACCGCGGCGGA 86 a Transcrpton start pont addtonally verfed by $1 nuclease dgeston experment b Transcrpton start pont addtonally verfed through cdna sequencng c Olgonucleotde assgnment ndcates: gene specfcty/length of olgo (bndng poston; A of ATG set as + 1, as n Pechulla et al. 1991)

3 441 A < Z.4.3 ~ ~'.2 t'( ~.1 B ~' 4' 2- o , 1-6 O[gonukteotde [nm] 4 RNA t [p.gl Fg. 1 A, B. Knetc studes of the prmer extenson reacton. A Determnaton of the olgonucleotde amount that results n a half-maxum sgnal from the prmer-extended fragment (ss DNA; KH); 4 lag total RNA (RNAt) was coprecptated wth ncreasng amounts of the olgonucleotde 1B/21 (e--o). The data are presented n a 'Hanes plot' and KH was determned to be 2 nm. nsert: Relatonshp between olgonucleotde concentraton (substrate) and level of prmer-extended fragment (product) n a prmer extenson assay. Specfc radoactvty of the prmer extended fragments (Ao) was normalzed to the day of the knase reacton. B Relatonshp of total RNA (substrate) to the prmer-extended fragment (product). Radoactvty of the ssdna was normalzed to that on the day of the knase reacton (Ao) of the ndvdual Lha/b mrnas were determned by solatng the respectve sngle-stranded DNA fragments from the gel and subjectng them to Cerenkov countng. Snce the prmers were 5' end-labelled, 1 mol extended prmer (ssdna fragment) equals 1 mol Lha/b mrna. The molar amounts of steady-state mrnas of ndvdual Lha/b genes (n fmol Lha/b mrna/mg total RNA) was calculated as follows. steady-state mrna level-- prmer (mol) x radoactvty of ssdna (Ao) (cpm) radoactvty prmer (Ao) x RNA total (mg) Where Ao s measured radoactvty normalzed to the day of the knase reacton. The expermental condtons of the prmer extenson analyss were optmzed as follows. Frstly, an optmal salt concentraton and annealng temperature was determned for each olgonucleotde/lha/b mrna combnaton (Pechulla et al. 1991). Secondly, the olgonucleotde was added n excess over the Lha/b mrna concentraton. The correct concentraton of the olgonucleotde was determned by ncreasng the amounts of the 5' endlabelled olgonucleotde (1-8 nm), coprecptatng t wth 4 gg total RNA, and measurng the amounts of radoactvely labelled prmer-extended ssdna fragments. The radoactvty of these ssdna fragments measured n the dfferent experments was normalzed to the day of the knase reacton (Ao). The radoactvty of prmer extenson product (Ao) was plotted versus the concentraton of olgonucleotde (nm) and a saturaton curve was obtaned (Fg. 1 A, nsert). The data were converted nto an Hanes plot and the amount of 2 nm olgonucleotde (Kn) was calculated to produce a half-maxmum sgnal (Fg. 1 A). At least tenfold excess of olgonucleotde over Kn was used n the prmer extenson experment (.e pmol end-labelled olgonucleotde n 1 lal annealng assay). The method assumes that the relatonshp between ncreasng amounts of total RNA (5-8 gg) and ncreasng amounts of prmer extenson product s lnear The lnear relatonshp of these two parameters s depcted n Fg. 1 B. The results of these control experments demonstrate that the prmer extenson analyss s a useful and relable technque for quanttaton of specfc Lha/b transcrpts. Results xpresson of nneteen Lha/b genes n varous plant organs Usng the prmer extenson analyss the Lha/b mrna levels were determned n leaves, stems, young green fruts and sepals (all samples were harvested at noon; Table 2A). The accumulaton levels are expressed as the percentage contrbuton of ndvdual Lha/b mrnas to the total amount of Lha/b mrna present n the partcular organ (Fg. 2). Hgh expresson levels are obtaned for Lhblb, f, lg, 2a (cab 1B, 3A, 3B, 4) and Lha2 (cab 7), whle the contrbuton of the other Lha/b

4 442 Table 2A. Determnaton of steady-state Lha/b mrna levels (fmol/mg RNAtota n dfferent organs and cotyledons of etolated seedlngs PS Lha/b cab Leaves Sepals Fruts Stems tolated WL tolated RL Lhb la A Lhb lb 1B Lhb 1c 1C Lhb ld 1D n.d. n.d. Lhb f 3A Lhb lg 3B Lhb lh 3C Lhb 2a Lhb 2b Lhb Lhb Lhb6a 1A Lhb 6b 1B Lha la 6A Lha lb 6B Lha Lha Lha 4a Lha 4b PS, photosystem Maxmum devaton s presented as error bars n Fg. 2 n.d., not detectable; WL, whte lght; RL, red lght Table 2B. Summary of total Lha/b mrna levels (fmol/mg RNAtot,) n dfferent organs and cotyledons of etolated seedlngs Tssue and lght condtons at 12. a.m. Leaves, daylght Sepals, daylght Fruts, daylght Stems, daylght tolated seedlngs, 6 h n whte lght a tolated seedlngs, 4 h n whte lght" h after red lght pulse a h after far-red lght pulse a 3. 4 h after red/far-red lght pulse * 44.7 Total Lha/b expresson level " RNA levels of fourteen Lha/b genes are summarzed (cab 1- cab 9) mrnas to the total amount of Lha/b mrna s very low. The comparsons of the levels of transcrpts show smlar Lha/b mrna accumulaton patterns n the dfferent plant organs (Fg. 2). n contrast to the smlarty of the Lha/b mrna accumulaton patterns, the total amount of Lha/b mrna per mg total RNA vares n the dfferent plant organs (Table 2B). Hghest levels of Lha/b transcrpts per mg total RNA were determned n leaves, followed by sepals (962.5 and fmol Lha/b mrna per mg total RNA, respectvely). Approxmately 5% of ths amount s pres- ent n young green tomato fruts and stems (respectvely, and fmol Lha/b mrna per mg total RNA). Together these results ndcate that the sum of Lha/b mrna levels per total amount of RNA s dfferent n the dfferent organs, suggestng that ths parameter s organ dependent, whle the dstrbuton or composton pattern of Lha/b mrnas s organ ndependent. Transcrpt accumulaton n whte, red and far-red llumnated, etolated seedlngs The expresson of the ndvdual Lha/b mrnas was determned n etolated seedlngs llumnated wth whte lght. The cotyledons of such seedlngs were harvested every 2 h. All Lha/b mrnas were measurable wth the prmer extenson technque 4 h after llumnaton, and most of the transcrpts were already present 2 h after the onset of lght (Fg. 3). The relatve dstrbuton pattern of the Lha/b transcrpts examned s very smlar to that observed n adult leaves, sepals, green fruts and stems (Fg. 2). Besdes the smlarty of the quanttatve dstrbuton of Lha/b mrnas the features of durnal varaton n Lha/b transcrpts were nvestgated n llumnated seedlngs (Fg. 3). ncreasng levels of the Lha/b mrnas were obtaned after the transton from darkness to lght, reachng a maxmum about 6 h after the onset of llumnaton, and decreasng levels were measured thereafter. At mdnght, the transcrpt levels were below the detecton level, wth the excepton of Lha2, 3 and Lhb5 (cab 7, 8 and 9).

5 443 5 Z n,- L,O,-, 3 cl c" J "6 ~- 2 o :D.o L- "N -e 1 cab Lhalb 1A 1B 1C 1D 3A 3B 3C 4 a b c d f g h Lhb 1 PHOTOSYS a b Lhb 2 TM Lhb3 Lhb5 Fg. 2. Dstrbuton patterns of steady-state mrna levels of ndvdual Lha/b genes from Lycoperson esculentum. Transcrpt levels were determned n leaves, stems, sepals and young green fruts (columns 1-4; left to rght) harvested around noon. Calculaton of relatve dstrbuton was based on mrna levels of nneteen Lha/b genes (cabl-13). Cotyledons of etotated seedlngs were harvested 6 h after the onset of whte lght and 4 h after a 1 ran 1A 1B 6A 6B J a b a b J a b Lhb 6 Lha 1 Lha 21 Lha 3 Lha 4 PHOTOSYSTM red lght pulse (columns 5 and 6). Calculaton of relatve dstrbuton was based on mrna levels of fourteen Lha/b genes (cable). The levels of the ndvdual Lha/b mrnas were determned by prmer extenson and the relatve porton of the total Lha/b mrna was calculated. rror bars represent maxmum devaton calculated from two or three experments The role of phytochrome n the expresson of the ndvdual Lha/b genes was examned by exposng etolated seedlngs to 1 ran red lght, far-red lght or red/ far-red lght, respectvely. The cotyledons were harvested 2, 4, 9, 16 and 24 h after the applcaton of the lght pulses. The mrna of each Lha/b gene was already detectable 2 h after the red lght pulse. The mrna levels ncreased to hgh levels 4 h after the lght pulse and decreased thereafter, ndcatng durnal expresson (data not shown). A smlar pattern, but wth reduced ampltudes, appeared n far-red and red/far-red llumnated cotyledons of etolated seedlngs. The level of total Lha/b mrna after far-red llumnaton reached 56% compared to the level n red lght-treated seedlngs, whle the far-red pulse gven mmedately after the red lght pulse reduced the total Lha/b mrna level only to 84% (Table 2B). The dstrbuton pattern of the ndvdual Lha/b mrnas 4 h after the red lght pulse s smlar to the pattern observed after whte lght llumnaton or n adult leaves (Fg. 2). The characterstc durnal expresson patterns found for each ndvdual Lha/b gene after dfferent lght treatments suggest that all Lha/b genes are most probably controlled by the same mechansm whch s already operatve n young plant materal. Despte the smlarty n dstrbuton patterns of the ndvdual Lha/b mrnas dfferences were observed wth respect to the total amounts of Lha/b mrna found n etolated seedlngs treated wth dfferent lght regmes (Table 2B). tolated seedlngs llumnated wth whte lght for 4 h reach fmol per mg total RNA and 6 h n whte lght nduces a level of fmol per mg total RNA (based on fourteen genes, cab 1-9). Pulses of 1 mn red, far-red or red/far-red lght resulted n total Lha/b mrna levels between 3 and 53 fmol per mg total RNA 4 h after the treatment (based on fourteen genes, cab 1-9). Together these results ndcate that Lha/ b mrna expresson n etolated seedlngs s dependent on lght ntensty and lght qualty. Crcadan expresson patterns of Lha/b transcrpts Prevous studes have shown that total Lha/b mrna levels oscllate n a durnal and crcadan fashon; however, ndvdual genes were not examned. The results of our prmer extenson analyss of tomato Lha/b genes durng the course of 72 h are presented n Fgs. 4 and 5. Under normal lght/dark condtons the mrna from each Lha/b gene exhbts a typcal durnal expresson pattern wth ncreasng transcrpt levels after the transton from darkness to lght, reachng a maxmum around noon and decreasng thereafter. t should be noted that ncreasng mrna levels from Lha2 (cab 7), Lhbla, ld, 2a and 3 (cab 1A, 1D, 4, 13) are already detectable pror to the dark/lght transton. Ths may be due to the abundant expresson of these genes. A quanttatve presenta-

6 444 12: 12: 12: 12: 12: 12: Lhb 1 2- (cobla) /, 1 - [; "\ U ",.,\+= 15- ~ (coblb) 1 - /'~'x. 5- /+; \, \ - 1 & -, (cable) ]%. "- ~ -" T - ' Lhb 2 3 " (cob z, ) F \. 1- ''N /,, X O _? ~ ~._. - t/!. 5 -.'N (cab 5) C =+" 1 f " Lho 8- (cob 6A) 7 b 46 b 4Sb 37 b ~-Lhblo {cob 1A] Lhb ld (cab 1D) "*'Lhb lb (cob 1B} Lhb lc (cob 1C) "" Lhb lh (cab 3CJ < Z n- O1 O 14= _-.... ~-.,! 3O 1 (cob3b) 2 1 : T T : 3 - (cab3c) ;,~-.\ [cob3a) _ / \ _/ \ ' \> T -, T : 6 - (cab6b) 4 2 :.~" -, Lho ' " (cab 7) 2- f"-, 1./.J. & /~ ~ ~ ~ 21 Lho 3 /,!"" _~ \ (cob8) 8-.~ 4 / \_. ' _.T/, o 4 ~ 1'2 1'6 o Lhb 5 l (cab9) 8-4- / ~.. j,+,% 119b 112b 37b 3b 135 b 126 b 12 b Lhb f (cab 3A) <- Lhol olb 4" [cab 6) Lhb lg {cab 3B) "-- Lha 2 (cab 7) Lhb 2a (cab 4 } 4-Lhb2b (cab 51.~ Lhb 5 <-'(cob 9} ~- Lho 3 (cab 8) 4'" HOURS o.";/, t,,, RNA t hours Fg. 3. Durnal rhythms of steady-state transcrpt levels for ndvdual Lha/b genes n llumnated, etolated seedlngs of L. esculentum. Seven-day-old seedlngs were llumnated for 12 h wth whte lght. Steady-state mrna levels of fourteen ndvdual Lha/b genes (cab-9) were calculated based on the prmer extenson analyss. The amount of ndvdual Lha/b mrna s gven n fmol/mg total RNA; the tme axs presents the 'Zetgeber' tme. The lght/dark regme s presented as open and flled bars, respectvely. Genes encodng one type of lght harvestng complex (LHC) proten are grouped together n sectons Fg. 4. Autoradograms of the prmer extenson analyss of ndvdual Lha/b genes of L. esculentum. The steady-state mrna levels of fourteen Lha/b genes were determned at several tme ponts n lght/dark and contnuous dark condtons. At each tme pont 5 gg of total RNA solated from leaves of adult plants was coprecptated wth.3 pmol 5' end-labelled olgonucleotde. Prmers wth smlar optmal hybrdzaton condtons and that reveal prmer extended products of dfferent lengths were assayed smultandusly n a sngle reacton. The lengths (n b) of the prmerextended fragments are ndcated as well as the partcular gene product. Zetgeber tme s presented together wth the perods of lght/dark transton: the tme pont of the frst dark/lght transton was set as zero. Lower panel: total RNA was extracted from leaves, separated on a denaturng agarose gel (7.5 gg per lane) and staned wth ethdum bromde

7 445 6F 12:, 12: 12: 12: 12: 12: 12: 12: o Lhb (cab 1A) - ~7 "~ "? ~?, ~, =T = 7--? (cab 1 B) 11 ] 1 looff 61 Jl r/,\ \ [ 2ol-/, - /, Lhb 2 "b' \ ~ r T.4-?, 8[- [ r cob 5). /* 2O 1 t 6 ~ t /* ~ -t 2 [ < Z O -T T 3 {cob 1C) ;\/t 2 '" 1 2 l- {o~ (cob 1D} \,, :,, /1 ' ' 15 ~ 1 ] // '\ ", sk/ t / r'l", le/ \ / ~ " o / ",. \/2" -~ 8 t /* /* ~o[ 3 1/.~ 4,!\,, n l - T - T--'( ~[ /',\ 2[/,, ~ (cob 3A) :T "-? (cab 3B) - - _~,,,~. _ -T - - T (cob 3C) ] ] ] d 7'2 8' 8' ;/*-11v /* 32 Z~ 28 5~6 6/* 42 8~ 8'8 96 1/* lo - Lho 1 6 F 2 r /o/e~o\ -T T 6[- ~ (cob 6B) /* ' 2 L/ t " ~ -v 8 ~ 16 f "' 2/* 32 ' - ~ "-4~8=5%=L 7'2 8' 8~8--'7 96 1/*, -" , 12 r- "" tr fl "" T?. 8 s /* /*a ~'6-& 12 ' &,..'.\ Lho 2 (cab 7) 96 1/* Lho 3 (cob 8) :T"J'/-'~" /* 32 /* /*8 56 6/* /* F Lhb 5 1p/.\ / * r./~., ~ :- :~'~'-" 8 1 2/* 32 &To & 56 6/* "~2 8~ 8~8 96 1/* r r'~,,j~ Fg. 5. Crcadan rhythms of ndvdual Lha/b genes of L. escuenturn n contnous darkness. RNA was extracted from leaves of 38-day-old tomato plants. Steady-state mrna levels of the ndvdual Lha/b genes were calculated based on the prmer extenson analyss. The amount of ndvdual Lha/b mrna s gven n hours fmol/mg total RNA. Genes encodng one type of LHC proten are shown together n sectons. Dark and lght phases are represented by flled and open bars, respectvely. Zetgeber tme s presented and the tme pont of the frst dark/lght transton was set as zero

8 446 < z x o 1=,,. 12: 12: Lhb 6~. (c bla) ~- [,, 2oZ r -/ / \,1 ll '~'~Jllt >?- '~, 3[-. (cablb) 1oo:t,, \ o;,/ "" 7.-._. )- l., (cable) ' - 2_/. 5- ]. l (oablo) '- tl ~ 1 'l \~ ~lt. "~-'-~ /+ 32 A A8 12 (cab3a) gl, [ 8- / ~ t e < / - gl r _/, el ~ 4 (cob3b) ~o 3-. ~ 2 / ;.',.j ' ' o: L, - (cab3c) ~ t 2. ~ f..,'/1,.f. :.'~ : Lhb 2 ". F (cob 4) :\, 3o:!,, / ~ / 3 (cobs) _ M _ Lho 1!! 3 /t / t~ 1 /', "-. j / rk._" 37 (cebgb) 1! -" '2 L Lho 2 ~ ~ cob v) 2-lk ~-,~ /. / l -7 -o r [~*-*/ ~ o g 16 :7~ 32 ~o s 4- Lho 3,. (cab8) 2o \. eoxol ~ ~, o z:8 4- Lhb 5 (cobg)./,) /, - /o~e~ 2o / ~ /, \ e ~ d ~.-." ~ p Z 48 hours Fg. 6. Crcadan rhythms of ndvdual Lha/b genes of L. esculentum n contnuous lght. RNA was extracted from 42-day-old tomato plants. Steady-state mrna levels of the ndvdual Lha/b genes were calculated based on the prmer extenson anayss. The amount of ndvdual Lha/b mrna s gven n fmol/mg total RNA. Genes encodng one type of LHC proten are shown together n sectons. Dark and lght phases are represented by flled and open bars, respectvely. Zetgeber tme s presented and the tme pont of the frst dark/lght transton was set as zero ton of ths experment s shown n Fg. 5. Ampltudes of at least 5 fmol Lha/b mrna per mg total RNA are reached by the genes Lhbb, f, lg, 2a (cab 1B, 3A, 3B, 4) and Lha2 (cab 7). These fve genes comprse between 6 and 7% of the total Lha/b mrna transcrpts. The mrna accumulaton patterns of each ndvdual Lha/b gene were also followed n contnuous darkness (Fgs. 4 and 5) and contnuous llumnaton (Fg. 6). Under these condtons all nneteen Lha/b mrna levels contnue to oscllate. The perod lengths are approxmately 24 h n contnuous darkness and vary between 16 and 2 h n contnuous lght, ndcatng that all Lha/b genes examned are under the control of a crcadan clock. The crcadan expresson patterns of all Lha/b genes examned, showed only mnor dfferences n the ampltudes of the transcrpt levels. We note that the ampltudes of Lhbla-ld (cab 1A-1D) are hgh for the frst day n darkness, whle the ampltudes of Lhblf-lh (cab 3 A-3 C) are sgnfcantly reduced compared to the oscllaton under lght/dark condtons. The reverse result was observed n contnuous llumnaton, where the ampltudes of Lhbla-ld (cab 1 A-1 D) are more reduced than the ampltudes of Lhblflh (cab3a-3c). Another dfference s that n contnuous darkness Lha/b mrna levels decrease to almost undetectable levels durng the subjectve nght phase, whle elevated levels reman present durng the subjectve nght phase durng contnuous llumnaton. Besdes these fne dscrepances, dfferent accumulaton patterns are detected after 3 days n darkness followed by one dark/lght transton; Lhbld, f (cabld, 3A) and Lhala, 4 (cab6a, 11) mrna levels accumulate to detectable levels, whle the resdual Lha/b gene mrnas are almost undetectable. Dscusson n ths study the transcrpts of the ndvdual Lha/b genes of L. esculentum were analysed. The mrnas of all nneteen Lha/b genes are expressed n the dfferent green plant organs, ndcatng that a full complement of the mrnas and ther respectve gene products are necessary for a functonal photosynthetc apparatus. The accumulaton of the ndvdual Lha/b mrnas and the contrbuton to the total Lha/b transcrpt level are dfferent, namely Lha2 (cab7) and Lhblb, f, lg, 2a (cablb, 3A, 3B, 4) are hghly expressed, whle the RNA products of the other twelve genes accumulate to low levels. The quanttatve dfferences between the Lha/b genes that are expressed n hgh and low amounts are promnent and ths general pattern s present n all the dfferent organs (Fg. 2). xact quanttaton of transcrpts partcularly of genes of a huge gene famly as studed here s very dffcult but the 'prmer extenson' method turned out to be qute a useful technque. However, t s worth mentonng that n a few cases the expermental error can be as much as 3% and devatons beyond the error bars cted n prevously publshed data sometmes occurred, e.g. Lhblf (cab3a) 8 versus 12% (prevously) or Lhblg (cab3b) 1 versus 3% (prevously)

9 447 (Pechulla et al. 1991). Our present stage of knowledge s documented n Fg. 2 and the dscrepances observed are most probably addtve effects of the lmts of reproducblty of the method and varatons n the plant materal and RNA preparatons. n ths context t s worth mentonng that olgonucleotdes that bnd to dfferent postons n the mrnas can result n dfferent amounts of prmer extended fragment (Pechulla et al. 1991). Ths effect s explaned by ncomplete bndng due to structural hndrance. These and other methodologcal nadequaces may be the reason for the standard devaton of 2% obtaned when a PCR technque was appled to quanttate Lha/b mrna levels n Psum satvum (Whte et al. 1992). Besdes the fact that the steady-state mrna levels at noon vary sgnfcantly between the ndvdual Lha/b mrnas, a general dstrbuton pattern was observed wthn the dfferent organs or after llumnaton wth dfferent lght ntenstes and lght qualtes (Fg. 2). n addton, very smlar durnal and crcadan expresson patterns are observed for all Lha/b genes (Fgs. 4, 5 and 6). Based on these smlartes, these data ndcate a concerted expresson of the Lha/b genes. Only subtle dfferences prmarly n the ampltude, were found between the mrna accumulaton patterns of dfferent tomato Lha/b genes, but no sgnfcant varatons n the perod lengths are apparent. n Arabdopss thalana, however, one Lhbl gene (cabl) of the three genes nvestgated exhbted lttle or no cyclng of the mrna level (Mllar and Kay 1991). An nterestng feature of crcadan oscllatons s the tme pont of Lha/b mrna accumulaton. Whle n petuna the transcrpts of all fve genes examned start to ncrease about 6 h and reach 2-8% of the maxmum level pror to the dark/lght transton (Stayton et al. 1989), only two Lha/b genes (Lhbl a and 2a) n tomato show smlar expresson patterns (Fgs. 4 and 5). These nterspecfc dfferences may be explaned by dfferent mechansms regulatng the transcrpton of the respectve Lha/b genes. We conclude that the Lha/b genes from tomato and most probably also from other hgher plants are under the control of a 'bologcal clock'. The durnal and crcadan Lha/b mrna oscllatons are most probably due to changes n transcrptonal actvty as demonstrated by Gulano et al. (1988), Taylor (1989) and Meyer and Pechulla (unpublshed results), but dfferental alteratons n RNA stablty may also play a role n some cases (Mllar and Kay 1991; Meyer and Pechulla, unpublshed results). Snce the mrnas of the Lha/b genes exhbt crcadan oscllatons, t may be lkely that a common cs- and/or trans-regulatng factor s nvolved n expresson of all these genes. A 'clock-responsve element' of 268 bp length has only been defned n the 5' flankng regon of the wheat Lhbl (cab l) gene (Fejes et al. 199), but no smlarty to ths fragment was detectable n any of seventeen analysed 5' flankng sequences of the tomato Lha/b genes. n addton, the sequence comparson study of the tomato 5'-upstream sequences revealed no DNA motf present n all upstream regons (accept for the TATA- and CCAAT-box), whch can be targeted by the same trans-actng factor leadng to smlar expresson patterns (Pechulla et al. 1991). At present nothng s known about any trans-regulatng factors that functon at the Y-upstream regon of any Lha/b gene from tomato. However, n other plant speces, for example n tobacco, several protens that bnd to dstnct 5'-upstream sequences of the Lhbl (cab ) gene have been solated and characterzed (Schndler and Cashmore 199). Nevertheless the specfc functons of these DNA-bndng protens n vvo are presently unknown. Smlarly, but even more complex, appear Pa results of n vtro proten-promoter DNA nteractons analysed for the rbcs gene famly of tomato (Manzara et al. 1991). t s worthwhle mentonng that the fve genes of the rbcs gene famly are, for example, dfferentally expressed n dfferent organs (Sugta and Grussem 1987) and therefore dfferent DNA-motfs and DNA-bndng protens are expected. n contrast, based on the smlarty of the expresson patterns of the Lha/b genes from tomato (present study) we ether expect smlar cs- and trans-regulatng elements and sgnal transducton chans for each Lha/b gene or, alternatvely, dfferent protenpromoter nteractons and sgnal transducton chans lead to the same expresson patterns. t s expected that a comprehensve and detaled analyss of the cs- and trans-regulatng elements of all tomato Lha/b genes wll gve nsght nto the mechansm(s) co-ordnatng the concerted expresson of the Lha/b gene famly of tomato. Acknowledgement. The authors thank Mrs. S. Hourtcolon and Mr. B. Raufesen for ther preparaton of the photographs and fgures and Mrs. S. Voeckel and Mr. KH. Lange for cultvatng the tomato plants. We thank Professor. Sch/fer for allowng us to llumnate etolated seedlngs under defned lght qualtes and for helpful dscussons. Ths work was supported by a grant of the DFG to B.P. (P 153/2-4) and a fellowshp of the Graduertenf6rderung of the Unversty of G6ttngen to J.W.K. References Dean C, Favreau M, Dunsmur P, Bedbrook J (1987) Confrmaton of the relatve expresson levels of the Petuna (Mtchell) rbcs genes. Nuclec Acds Res 15 : Fejes, Pay A, Kanevsky, Szell M, Adam, Kay SA, Nagy F (199) A 268 bp upstream sequence medates the crcadan clock-regulated transcrpton of the wheat cab-1 gene n transgenc plants. Plant Mol Bol 15 : Gulano G, Pchersky, Malk VS, Tmko MP, Scolnk PA, Cashmore AR (1988) Lght-entraned crcadan clock controls transcrpton of several plant genes. Proc Natl Acad Sc USA 85: Green BR, Pchersky, Kloppstech K (1991) Chlorophyll a/bbndng protens: an extended famly. Trends Bol Sc 16: Jansson S, Pchersky, Bass R, Green BR, keuch M, Mels A, Smpson D J, Spangfort M, Staeheln LA, Thornber JP (1992) A nomenclature for the genes encodng the chlorophyll a/b-bndng protens of hgher plants. Plant Mol Bol Rep, 1 : Kay SA, Mllar AJ (1992) Crcadan regulated cab gene expresson n hgher plants. n: Young M (ed) The molecular bology of crcadan rhythms. Marcel Dekker, New York Kellmann JW, Pchersky, Pechulla B (199) Analyss of the durnal expresson patterns of the tomato chlorophyll a/b-bndng proten genes. nfluence of lght and characterzaton of the gene famly. Photochem Photobol 52:35 41

10 448 Kuhlemeer C, Green PJ, Chua NH (1987) Regulaton of gene expresson n hgher plants. Annu Rev Plant Physol 38: Manzara T, Carrasco P, Grussem W (1991) Developmental and organ-specfc changes n promoter DNA-proten nteractons n the tomato rbcs gene famly. Plant Cell 3: Meyer H, Thenel U, Pechulla B (1989) Molecular characterzaton of the durnal/crcadan expresson of the chlorophyll a/b-bndng protens n leaves of tomato and other dcotyledonous and monocotyledonous plant speces. Planta 18:5-15 Mllar AJ, Kay SA (1991) Crcadan control of cab gene transcrpton and mrna accumulaton n Arabdopss. Plant Cell 3 : Mohr H, Drumm H, Schmdt R, Stentz B (1979) The effect of lght pretreatments on phytochrome-medated nducton of anthocyann and of phenylalanne ammona-lyase. Planta 146: Pechulla B, Resselmann S (199) ffect of temperature alteratons on the durnal expresson pattern of the chlorophyll a/b bndng protens n tomato seedlngs. Plant Physol 94: Pechulla B, Kellmann JW, Pchersky, Schwartz, F6rster HH (1991) Determnaton of steady-state mrna levels of ndvdual chlorophyl1 a/b bndng proten genes of the tomato cab gene famly. Mol Gen Genet 23: Schndler U, Cashmore AR (199) Photoregulated gene expresson may nvolve ubqutous DNA bndng protens. MBO J 9: Sheen JY, Bogorad L (1986) Dfferental expresson of sx lghtharvestng chlorophyll a/b bndng proten genes n maze leaf cell types. Proc Natl Acad Sc USA 83 : Stayton MM, Broso P, Dunsmur P (1989) Photosynthetc genes of Petuna (Mtchell) are dfferentally expressed durng the durnal cycle. Plant Physol 89 : Sugta M, Grussem W (1987) Developmental, organ-specfc, and lght-dependent expresson of the tomato rbulose-l,5-bsphosphate carboxylase small subunt gene famly. Proc Natl Acad Sc USA 84: Tavladorak P, Argyroud-Akoyunoglou J (1989) Crcadan rhythm and photochrome control of LHC- gene transcrpton. FBS Lett 255 : Taylor WC (1989) Regulatory nteractons between nuclear and plastd genomes. Annu Rev Plant Physol Plant Mol Bol 4 : Wehmeyer B, Cashmore AR, Sch~fer (199) Photocontrol of the expresson of genes encodng chlorophyll a/b bndng protens and small subunt of rbulose-l,5-bsphosphate carboxylase n etolated seedlngs of Lycoperscon esculentum (L.) and Ncotana tabacum (L.). Plant Physol 93: Whte M J, Frstensky BW, Falconet D, Chlds LC, Watson JC, Alexander L, Roe BA, Thompson WF (1992) xpresson of the chlorophyll a/b-proten multgene famly n pea (Psum sat# rum L.). Planta 188: Communcated by J. Schell