Electronic supplementary material (ESM) J Mol Med Glucose promotes secretion-dependent renal cyst growth
|
|
- Rosamund Sims
- 6 years ago
- Views:
Transcription
1 Electronic supplementary material (ESM) J Mol Med 15 Glucose promotes secretion-dependent renal cyst growth Andre Kraus 1, Gunnar Schley 1, Karl Kunzelmann, Rainer Schreiber, Dorien Peters 3, Ruth Stadler, Kai-Uwe Eckardt 1, Bjoern Buchholz 1 Corresponding author: Bjoern Buchholz, MD Department of Nephrology and Hypertension Friedrich-Alexander-University Erlangen-Nürnberg Ulmenweg 18 D 915 Erlangen, Germany Phone: Fax: Bjoern.Buchholz@uk-erlangen.de
2 Supplemental Table 1: Real-time PCR Primer Gene Species Primer sequence 5'-3' ANO1 Canine fw CTGCACGACGGAGACTACGA rev GTAGCTCGCCCACTCTTGGT ANO6 Canine fw AAGCAGCCCTTGGACCTTATC rev AGTGTAGTAGCCCAGCCAAGC PYR Canine fw ACAGGTGGGACAGAACTGACG rev TGTCCGCCTAGAATCCTCACT NKCC1 Canine fw GATGATTTGAGAGAAGGTGCAGCAT rev GACAAGTGTGTTTGGCTTCATACG CFTR Canine fw CGGAGACAACGAAGACAGTCTGT rev CTTCGGTGAATGCTCTGACCTT HPRT Canine fw CGGCTTGCTCGAGATGTGAT rev GAGCACACAGAGGGCTACGAT ANO1 Mouse fw TGAGGGTGACAACGTTGAGTTC rev CGTAACTTGCCCATTCCTCATAC ANO6 Mouse fw TGGCAACCTCAACTGGTTCA rev ACTCCTGCTCTGGCTTGATGA PYR Mouse fw GGGACGAACTGGGATACAAGTG rev ACACGGGCAACAGCACGTA NKCC1 Mouse fw GGTGGTGCAATTGGCTTGAT rev CGAATCCGACAACATACATAGCA CFTR Mouse fw CAGCTCAAACAACTGGAATCTGA rev GCTCGAAGTGTCCAGAGTCCTT PKD1 reference PKD1 deletion Mouse Mouse fw TTACGGGCTGCAGGAATTCGAT rev ATGCCCAAGATGAGGACAATGC fw TGCTCTTGGTAGCTGTAGCTGT rev AGCTGCTTGAGAGAAGCCACAT 18S Mouse fw TGATTAAGTCCCTGCCCTTTGTA rev CGATCCGAGGGCCTCACTA
3 Supplemental Figure 1 a b c I SC initial [µa/cm²] 1 I SC camp [µa/cm²] I SC UTP [µa/cm²] peak UTP 1µM plateau UTP 1µM Supplemental figure 1. Changes in transepithelial conductances by elevated glucose concentration is not referable to changes in medium osmolality. plmdck cells were grown as polarized monolayers on permeable supports and pre-incubated with either low (LG, 1 mg/dl), high glucose (, 5 mg/dl) or low glucose medium supplemented with mm mannitol (Ma) in order to increase osmolality to that of high glucose medium for 5 days. Then, cells were mounted into a perfused micro Ussing chamber and the luminal and basolateral surfaces of the epithelium were perfused continuously with ringer solution supplemented with either low glucose, high glucose, or mannitol. a Summary of the obtained initial short circuit currents (Isc) at the beginning of the experiment which was significantly elevated in cells but not in LG or Ma cells. b Summary of Isc upon perfusion of the cells with 1 µm 3-Isobutyl-1-methylxanthin (IBMX) together with 1 µm forskolin (Isc camp). c Summary of Isc upon application of 1 µm UTP (Isc UTP). P<.5, ANOVA. N=5-18.
4 Supplemental Figure a I SC [µa/cm²].. Flow stop Flow on b ΔI SC Flow on [µa/cm²].. Supplemental figure. The initial short circuit currents obtained in high glucose cells are not referable to changes in bath flow. plmdck cells were grown as polarized monolayers on permeable supports and pre-incubated with either low (LG, 1 mg/dl), high glucose (, 5 mg/dl) or low glucose medium supplemented with mm mannitol (Ma). Then, cells were mounted into a micro Ussing chamber and perfused continuously with ringer solution supplemented with either low glucose, high glucose, or mannitol. a Summary of the short circuit currents (Isc) obtained by stopping bath flow (Flow stop) and by switching on bath flow again (Flow on). b Summary of the change in Isc (ΔIsc) between switching bath flow off/on. N=6-8.
5 Supplemental Figure 3 a LG b c I SC UTP peak [%] min I SC UTP peak [%] min I SC UTP [µa/cm²] min peak UTP 1µM plateau UTP 1µM d 1µM UTP V te [mv] min Supplemental figure 3. The reduction of Isc UTP in high glucose treated cells may be refered to emptied calcium stores. plmdck cells were grown as polarized monolayers on permeable supports and pre-incubated with either low (LG, 1 mg/dl) or high glucose (, 5 mg/dl) medium. Then, cells were mounted into a micro Ussing chamber and perfused continuously with ringer solution supplemented with low glucose or high glucose. a Repetitive application of 1 µm UTP starting at time point, and repeated after 5 and 1 minutes led to a significant reduction of Isc UTP compared to the first application in (a) low glucose and (b) high glucose treated cells. Further application of 1 µm UTP in a 1 minute interval resulted in partial recovery of Isc UTP in (a) low glucose and (b) high glucose cells. c Application of UTP 3 minutes after the initial Isc obtained in high glucose cells resulted in much stronger Isc UTP compared to Isc UTP obtained after 5 minutes. d Original trace of the transepithelial potential (Vte) of high glucose () cells showing recovery of the negative deflection of Vte upon administration of UTP if applied 3 minutes after the initial deflection of Vte. *p<.5, paired t-test. N=5-1.
Glucose promotes secretion-dependent renal cyst growth
J Mol Med (2016) 94:107 117 DOI 10.1007/s00109-015-1337-4 ORIGINAL ARTICLE Glucose promotes secretion-dependent renal cyst growth Andre Kraus 1 & Gunnar Schley 1 & Karl Kunzelmann 2 & Rainer Schreiber
More informationONLINE SUPPLEMENT Title: CFTR dysfunction induces vascular endothelial growth factor synthesis in airway epithelium
ONLINE SUPPLEMENT Title: CFTR dysfunction induces vascular endothelial growth factor synthesis in airway epithelium Martin C, Coolen N, Wu YZ, Thévenot G, Touqui L, PrulièreEscabasse V, Papon JF, Coste
More informationLumen. -60 mv, ph 7.3 Cl - (E Cl CFTR HCO mv, ph 7.3 HCO HCO. Channel or Other electrogenic HCO 3- up to a 80-mM concentration when [Cl - ] i
. Proximal Duct 1 Cl HCO 8 Cl 8 HCO Lumen CFTR AE 6 mv, ph 7. Cl (E Cl = 712 ) Cl 2 HCO 2 lood ph HCO. Distal Duct 2 Cl 128 HCO >14 HCO? 6 mv, ph 7. Cl (E Cl = 47 ) Cl HCO HCO 5 2 HCO HCO Channel or Other
More informationBicarbonate Secretion in the Murine Gallbladder - Lessons for the Treatment of Cystic Fibrosis
Bicarbonate Secretion in the Murine Gallbladder Lessons for the Treatment of Cystic Fibrosis Alan W Cuthbert Department of Medicine, University of Cambridge, Addenbrooke's Hospital, Hill's Road. Cambridge,
More informationHow does cellular volume regulation works: Contribution of anoctamins, LRRC8A and CFTR
S Februar 2017 Current projects How does cellular volume regulation works: Contribution of anoctamins, LRRC8A and CFTR Recent results from our lab indicate a central role of anoctamins such as ANO1, ANO6
More informationThe Amiloride-inhibitable Na
The Amiloride-inhibitable Na Conductance Is Reduced by the Cystic Fibrosis Transmembrane Conductance Regulator in Normal But Not in Cystic Fibrosis Airways M. Mall, M. Bleich, R. Greger, R. Schreiber,
More informationPurinergic regulation of CFTR and Ca 2 -activated Cl channels and K channels in human pancreatic duct epithelium
Am J Physiol Cell Physiol 304: C673 C684, 2013. First published January 30, 2013; doi:10.1152/ajpcell.00196.2012. Purinergic regulation of CFTR and Ca 2 -activated Cl channels and K channels in human pancreatic
More informationLuminal cholinergic signalling in airway lining fluid: a novel mechanism for activating chloride secretion via Ca 2+ -dependent Cl - and K + channels
1388..1402 British Journal of Pharmacology DOI:10.1111/j.1476-5381.2012.01883.x www.brjpharmacol.org RESEARCH PAPERbph_1883 Luminal cholinergic signalling in airway lining fluid: a novel mechanism for
More informationPotentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC
Supplementary information Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC Pathway in Pancreatic -Cells Authors: Hodaka Yamada 1,*, Masashi Yoshida 1,*, Kiyonori Ito 1, Katsuya
More informationMechanisms of the inhibition of epithelial Na channels by CFTR and purinergic stimulation
Kidney International, Vol. 60 (2001), pp. 455 461 Mechanisms of the inhibition of epithelial Na channels by CFTR and purinergic stimulation KARL KUNZELMANN, RAINER SCHREIBER, and ANISSA BOUCHEROT Department
More informationSelective Activation of Cystic Fibrosis Transmembrane Conductance Regulator Cl - and HCO 3 - Conductances
JOP. J. Pancreas (Online) 2001; 2(4 Suppl):212218. Selective Activation of Cystic Fibrosis Transmembrane Conductance Regulator Cl and HCO 3 Conductances MallaReddy M Reddy 1, Paul M Quinton 1,2 1 Department
More informationSupplementary Figure 1 NMR spectra of hydroxy α and β-sanshool isomers. (Top) Hydroxy-α-sanshool (2E,6Z,8E,10E)-2'-
Supplementary Figure 1 NMR spectra of hydroxy α and β-sanshool isomers. (Top) Hydroxy-α-sanshool (2E,6Z,8E,10E)-2'- hydroxyl-n-isobutyl-2,6,8,10-dodeca-tetraenamide) and (bottom) hydroxy-β-sanshool (2E,6E,8E,10E)-2'-hydroxyl-N-isobutyl-
More informationPolarized Signaling via Purinoceptors in Normal and Cystic Fibrosis Airway Epithelia
Polarized Signaling via Purinoceptors in Normal and Cystic Fibrosis Airway Epithelia Anthony M. Paradiso, Carla M.P. Ribeiro, and Richard C. Boucher From the Cystic Fibrosis/Pulmonary Research and Treatment
More informationSLC26A9 is a constitutively active, CFTR-regulated anion conductance in human bronchial epithelia
Published Online: 16 March, 2009 Supp Info: http://doi.org/10.1085/jgp.200810097 Downloaded from jgp.rupress.org on August 18, 2018 ARTICLE SLC26A9 is a constitutively active, CFTR-regulated anion conductance
More informationElectrical Potential Differences and Electromotive Forces in Epithelial Tissues
LETTER TO THE EDITOR [Brief letters to the Editor that make specific scientific reference to papers published previously in THE JOURNAL OF GENERAL PHYSIOLOGY are invited. Receipt of such letters will be
More informationSodium and chlorine transport
Kidney physiology 2 Sodium and chlorine transport The kidneys help to maintain the body's extracellular fluid (ECF) volume by regulating the amount of Na+ in the urine. Sodium salts (predominantly NaCl)
More informationBestrophin-2 mediates bicarbonate transport by goblet cells in mouse colon
Bestrophin-2 mediates bicarbonate transport by goblet cells in mouse colon Kuai Yu, Emory University Rafael Lujan, Universidad de Castilla-La Mancha Alan Marmorstein, University of Arizona Sherif Gabriel,
More informationSupplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
More informationHCO3 secretion is not impaired in inflamed mouse anterior proximal colon
HCO3 secretion is not impaired in inflamed mouse anterior proximal colon David Lai AGButt Lab A thesis submitted in partial fulfilment of the requirements for the degree of Bachelor of Biomedical Science
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name
Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR
More informationDeleterious impact of Pseudomonas aeruginosa on cystic fibrosis transmembrane conductance regulator function and rescue in airway epithelial cells
ORIGINAL ARTICLE CYSTIC FIBROSIS Deleterious impact of Pseudomonas aeruginosa on cystic fibrosis transmembrane conductance regulator function and rescue in airway epithelial cells Nguyen Thu Ngan Trinh,,5,
More information150 mm HCO How Does the Pancreas Do It? Clues from Computer Modelling of the Duct Cell
JOP. J. Pancreas (Online) 2001; 2(4 Suppl):198202. 150 mm How Does the Pancreas Do It? Clues from Computer Modelling of the Duct Cell Yoshiro Sohma 1, Michael A Gray 2, Yusuke Imai 1, Barry E Argent 2
More informationcamp-activated Ca 2+ signaling is required for CFTR-mediated serous cell fluid secretion in porcine and human airways
Related Commentary, page 3093 Research article camp-activated Ca 2+ signaling is required for CFTR-mediated serous cell fluid secretion in porcine and human airways Robert J. Lee 1 and J. Kevin Foskett
More informationNeuroscience 201A Problem Set #1, 27 September 2016
Neuroscience 201A Problem Set #1, 27 September 2016 1. The figure above was obtained from a paper on calcium channels expressed by dentate granule cells. The whole-cell Ca 2+ currents in (A) were measured
More informationMaterials and methods
Pflfigers Arch-Eur J Physiol (1995) 430 : 705-712 9 Springer-Verlag 1995 R. B. Bajnath 9 K. Dekker 9 H. R. De Jongc J. A. Groot Chloride secretion induced by phorbol dibutyrate and forskolin in the human
More informationGLP-1 stimulates insulin secretion by PKC-dependent TRPM4 and TRPM5 activation
GLP-1 stimulates insulin secretion by PKC-dependent TRPM4 and TRPM5 activation Makoto Shigeto, 1,2,3 Reshma Ramracheya, 1 Andrei I. Tarasov, 1,4 Chae Young Cha, 1,2 Margarita V. Chibalina, 1 Benoit Hastoy,
More informationMaintenance of coelomic fluid ph in sea urchins exposed to elevated CO 2 : the role of body cavity epithelia and stereom dissolution
Marine Biology Supplementary Online Resource For: Maintenance of coelomic fluid ph in sea urchins exposed to elevated CO 2 : the role of body cavity epithelia and stereom dissolution Wiebke C. Holtmann
More informationBioelectric effects of quinine on polarized airway epithelial cells
Journal of Cystic Fibrosis 6 (2007) 351 359 www.elsevier.com/locate/jcf Bioelectric effects of quinine on polarized airway epithelial cells Eleanor Bates d, Stacey Miller d, Mariah Alexander d, Marina
More informationAs recognition of acute and chronic pain in dogs
J Vet Intern Med 2014;28:793 798 The Effect of Tramadol and Indomethacin Coadministration on Gastric Barrier Function in Dogs T.L. Hill, B.D.X. Lascelles, J.M. Law, and A.T. Blikslager Background: Tramadol
More informationFig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses
Fig. S1. Immunohistochemical detection of iglur2 protein in single islet cells. A: α cells identified using glucagon-specific antibody express the iglur2 subtype of AMPA receptor. 24 out of 26 identified
More informationIntestinal epithelial cells secrete water and electrolytes
GASTROENTEROLOGY 2002;122:1070 1087 Enteroinvasive Bacteria Alter Barrier and Transport Properties of Human Intestinal Epithelium: Role of inos and COX-2 SILVIA RESTA LENERT* and KIM E. BARRETT*, *Department
More informationEFFECT OF FOUR SETS OF DISTINCT MODULATORS ON NON-F508DEL MUTATIONS THAT CAUSE CYSTIC FIBROSIS
EFFECT OF FOUR SETS OF DISTINCT MODULATORS ON NON-F508DEL MUTATIONS THAT CAUSE CYSTIC FIBROSIS BHATT, PRIYANKA; BAILEY, VIOLAINE; DASGUPTA, AFIA; CHIN, JUSTIN; AN, WEILING; BRESILLA, CASTERA; KWOK, IRIS;
More informationProstaglandins I 2 and E 2 Have a Synergistic Role in Rescuing Epithelial Barrier Function in Porcine Ileum
Prostaglandins I 2 and E 2 Have a Synergistic Role in Rescuing Epithelial Barrier Function in Porcine Ileum Anthony T. Blikslager,* Malcolm C. Roberts, J. Marc Rhoads, and Robert A. Argenzio* *Department
More informationExperience in Southeast Asia with cases of secretory
GASTROENTEROLOGY 1999;116:1342 1347 Characterization of the Inhibitory Effect of Boiled Rice on Intestinal Chloride Secretion in Guinea Pig Crypt Cells CERI J. MATHEWS,* R. JOHN MACLEOD,, SHU XIAN ZHENG,*
More informationThe ocular surface, lined by corneal and conjunctival epithelia,
Potential Difference Measurements of Ocular Surface Na Absorption Analyzed Using an Electrokinetic Model Marc H. Levin, 1,2 Jung Kyung Kim, 1,3 Jie Hu, 1,3 and A. S. Verkman 1,2 PURPOSE. Corneal and conjunctival
More informationSupplementary Material and Methods
Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided
More informationCl - channel regulated by camp-dependent phosphorylation
Defective Fluid Transport by Cystic Fibrosis Airway pithelia Rapid Publication Jeffrey J. Smith, Philip H. Karp,* and Michael J. Welsh* Department ofpediatrics and *Howard Hughes Medical Institute, Departments
More informationNa absorption in the colon plays an important role
Japanese Journal of Physiology, 51, 435 444, 2001 The Effect of camp on Electrogenic Na Absorption in the Rat Distal Colon Yo TSUCHIYA and Yuichi SUZUKI Laboratory of Physiology, School of Food and Nutritional
More informationRole of transmembrane chloride transporters. in the fluid secretion of lacrimal gland duct cells
Role of transmembrane chloride transporters in the fluid secretion of lacrimal gland duct cells Eszter Vizvári, M.D. Ph.D. Thesis Doctoral School of Clinical Medicine Supervisor: Edit Tóth-Molnár, M.D.,
More informationCigarette Smoke Inhibition of Ion Transport
Cigarette Smoke Inhibition of Ion Transport in Canine Tracheal Epithelium MICHAEL J. WELSH with the technical assistance of PHIL KARP, Pulmonary Division, Department of Internal Medicine, University of
More informationcamp-stimulated Cl - secretion is increased by glucocorticoids and inhibited by bumetanide in semicircular canal duct epithelium
Pondugula et al. BMC Physiology 213, 13:6 RESEARCH ARTICLE Open Access camp-stimulated Cl - secretion is increased by glucocorticoids and inhibited by bumetanide in semicircular canal duct epithelium Satyanarayana
More informationChloride channels in the apical membrane of normal and cystic fibrosis airway and intestinal epithelia
Chloride channels in the apical membrane of normal and cystic fibrosis airway and intestinal epithelia MATTHEW P. ANDERSON, DAVID N. SHEPPARD, HERBERT A. BERGER, AND MICHAEL J. WELSH Howard Hughes Medical
More informationAn excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes
An excessive increase in glutamate contributes to glucose-toxicity in β-cells via activation of pancreatic NMDA receptors in rodent diabetes Xiao-Ting Huang 1, Chen Li 1,3, Xiang-Ping Peng 1, Jia Guo 1,5,
More informationTwo Decades of Evidenced-based Outcomes Research: The Erlangen Stroke Registry
Two Decades of Evidenced-based Outcomes Research: The Erlangen Stroke Registry 06.06.2017 Prof. Dr. Peter Kolominsky-Rabas, MD, PhD, MBA Interdisciplinary Center for Health Technology Assessment (HTA)
More informationPiloting Treatment with IGF-1 in Phelan-McDermid Syndrome
Piloting Treatment with IGF-1 in Phelan-McDermid Syndrome Seaver Autism Center for Research and Treatment at Mount Sinai Principal Investigator: Alex Kolevzon, MD One Gustave L. Levy Place, Box 1230 New
More informationmonolayer In vivo "culture" of a transporting renal epithelial TECHNICAL NOTE
Kidney International, Vol. 19 (1981), pp. 465-470 TECHNICAL NOTE In vivo "culture" of a transporting renal epithelial monolayer YAACOV BAR-KHAYIM, ARTHUR H. COHEN, BARBARA HOUSTON, WALTER TRIZNA, and LEON
More informationPflfigers Archiv European Journal of Physiology 9 Springer-Verlag 1985
Pflfigers Arch (1985) 403: 82-89 Pflfigers Archiv European Journal of Physiology 9 Springer-Verlag 1985 Passive cation permeability of turtle colon: Evidence for a negative interaction between intracellular
More informationHANS H. USSING, THOMAS U. L. BIBER, and NEAL S. BRICKER
Exposure of the Isolated Frog Skin to High Potassium Concentrations at the Internal Surface II. Changes in epithelial cell volume, resistance, and response to antidiuretic hormone HANS H. USSING, THOMAS
More informationShujun Fan*, Natalie Harfoot*, Ray C. Bartolo and A. Grant Butt
1218 The Journal of Experimental iology 21, 1218-123 212. Published by The ompany of iologists Ltd doi:1.1242/jeb.61176 RESERH RTILE FTR is restricted to a small population of high expresser cells that
More information(Received 14 September 1987) (decrease) in current. magnitude of the osmotic steps and were reproducible and reversible if the
Journal of Physiology (1988), 406, pp. 371-392 371 W'ith 15 te. -figures Printed int Great Britaini ELECTRICAL TRANSIENTS PRODUCED BY THE TOAD URINARY BLADDER IN RESPONSE TO ALTERED MEDIUM OSMOLALITY BY
More informationCardiac muscle is different from other types of muscle in that cardiac muscle
6 E X E R C I S E Cardiovascular Physiology O B J E C T I V E S 1. To define autorhythmicity, sinoatrial node, pacemaker cells, and vagus nerves 2. To understand the effects of the sympathetic and parasympathetic
More informationSupplemental Data. Deinlein et al. Plant Cell. (2012) /tpc
µm Zn 2+ 15 µm Zn 2+ Growth (% of control) empty vector NS1 NS2 NS3 NS4 S. pombe zhfδ Supplemental Figure 1. Functional characterization of. halleri NS genes in Zn 2+ hypersensitive S. pombe Δzhf mutant
More informationBiopharmaceutics Classification System: Defining a Permeability Class
Biopharmaceutics Classification System: Defining a Permeability Class Blair Miezeiewski, M.S. Senior Scientist, In Vitro Permeability Lab Definition of Bioequivalence The United States Food and Drug Administration
More informationSupplementary Figure 1
Supplementary Figure 1 Localization of virus injections. (a) Schematic showing the approximate center of AAV-DIO-ChR2-YFP injection sites in the NAc of Dyn-cre mice (n=8 mice, 16 injections; caudate/putamen,
More informationEpithelial chloride transport by CFTR requires TMEM16A
Washington University School of Medicine Digital Commons@Becker Open Access Publications 2017 Epithelial chloride transport by CFTR requires TMEM16A Roberta Benedetto University of Regensburg Jiraporn
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationPreclinical in vitro Evaluation: Combination FDL169/FDL176 is Superior to Tezacaftor/Ivacaftor
Mike Zawistoski @ MZ Sports Shots Preclinical in vitro Evaluation: Combination /FDL176 is Superior to Tezacaftor/Ivacaftor Flatley Discovery Lab Preclinical in vitro Evaluation of CFTR Modulator Combinations
More informationLoss of Anion Transport without Increased Sodium Absorption Characterizes Newborn Porcine Cystic Fibrosis Airway Epithelia
Loss of Anion Transport without Increased Sodium Absorption Characterizes Newborn Porcine Cystic Fibrosis Airway Epithelia Jeng-Haur Chen, 1,3 David A. Stoltz, 1 Philip H. Karp, 1,3 Sarah E. Ernst, 1 Alejandro
More informationEffect of apical hyperosmotic sodium challenge and amiloride on sodium transport in human bronchial epithelial cells from cystic fibrosis donors
Am J Physiol Cell Physiol 305: C1114 C1122, 2013. First published August 28, 2013; doi:10.1152/ajpcell.00166.2013. Effect of apical hyperosmotic sodium challenge and amiloride on sodium transport in human
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More informationSupplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
More informationRole of anion exchangers in Cl and HCO 3 secretion by the human airway epithelial cell line Calu-3
Am J Physiol Cell Physiol 307: C208 C219, 2014. First published June 4, 2014; doi:10.1152/ajpcell.00083.2014. Role of anion exchangers in Cl and secretion by the human airway epithelial cell line Calu-3
More informationPKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
More informationhydrolyzes ATP to exchange 3 Na + in for 2 K + out generate the transcellular Na + and K + gradients provides the electrochemical gradient
Regulation of pancreatic excretory function by ion channels Viktoria Venglovecz 2015 Morphology of the pancreas Composition of pancreatic juice 1 2 liters of pancreatic juice per day acini secrete isotonic,
More informationCharacterization of Ion and Fluid Transport in Human Bronchioles
Characterization of Ion and Fluid Transport in Human Bronchioles Sabine Blouquit, Hugues Morel, Jocelyne Hinnrasky, Emmanuel Naline, Edith Puchelle, and Thierry Chinet Laboratoire de Biologie et Pharmacologie
More informationRegulation of chloride secretion across porcine endometrial epithelial cells by prostaglandin E2
Keywords: Endometrium, Cystic fibrosis transmembrane conductance regulator, Chloride secretion 6777 Journal of Physiology (1998), 508.1, pp. 31 47 31 Regulation of chloride secretion across porcine endometrial
More informationMany epithelia have, as one of their physiological properties, the ability to utilize. subsequently determined. P.O. Box 913, Dunedin, New Zealand
J. Phy8iol. (1 982), 333, pp. I 1 1-1 23 ill Printed in Great Britain IONS AND WATER IN THE EPITHELIAL CELLS OF RABBIT DESCENDING COLON BY ANTHONY D. C. MACKNIGHT, DRUSILLA R. MASON, RICHARD C. ROSEt AND
More informationSupplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
More informationGenome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice
Supplementary Information Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Gou Takahashi, Channabasavaiah B Gurumurthy,
More informationChatsri Deachapunya, Melissa Palmer-Densmore, and Scott M. O Grady
Published Online: 27 September, 1999 Supp Info: http://doi.org/10.1085/jgp.114.4.561 Downloaded from jgp.rupress.org on January 16, 2019 Insulin Stimulates Transepithelial Sodium Transport by Activation
More informationThe Cdc42 inhibitor secramine B prevents camp-induced K+ conductance in intestinal epithelial cells
The Cdc42 inhibitor secramine B prevents camp-induced K+ conductance in intestinal epithelial cells The Harvard community has made this article openly available. Please share how this access benefits you.
More informationBAK FOONG PILLS STIMULATE ANION SECRETION ACROSS NORMAL AND CYSTIC FIBROSIS PANCREATIC DUCT EPITHELIA
Cell Biology International 2002, Vol. 26, No. 12, 1011 1018 doi:10.1006/cbir.2002.0960, available online at http://www.idealibrary.com on BAK FOONG PILLS STIMULATE ANION SECRETION ACROSS NORMAL AND CYSTIC
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSESSION 1: Colonic physiology
SESSION 1: Colonic physiology Human Colonic Potassium Channel Expression and Function in Ulcerative Colitis Geoffrey I Sandle Leeds Institute of Molecular Medicine, St James s University Hospital, Leeds,
More informationParenteral Nutrition. Outline. Potential Biomarkers for Use in Intestinal Adaptation. Jejunum is primary site of digestion and absorption
Outline Potential Biomarkers for Use in Intestinal Adaptation Kelly A. Tappenden, Ph.D., R.D. Professor of Nutrition and GI Physiology 1. Intestinal Adaptation potential regulators 2. Intestinal mucosal
More informationnachr α 4 β 2 CHO Cell Line
B SYS GmbH nachr α 4 β 2 CHO Cell Line Cell Culture Conditions B SYS GmbH B SYS GmbH nachr α 4 β 2 CHO Page 2 TABLE OF CONTENTS 1 BACKGROUND...3 1.1 Human Nicotinic Acetylcholine Receptors...3 1.2 B SYS
More informationAldosterone increases K Ca 1.1 (BK) channel-mediated colonic K + secretion
J Physiol 586.17 (28) pp 4251 4264 4251 Aldosterone increases K Ca 1.1 (BK) channel-mediated colonic K + secretion Mads V. Sørensen 1, Joana E. Matos 1, Matthias Sausbier 2, Ulrike Sausbier 2,PeterRuth
More informationAlpha-1 Adrenergic Receptors on Rabbit Retinal Pigment Epithelium
Investigative Ophthalmology & Visual Science, Vol. 29, No. 5, May 1988 Copyright Association for Research in Vision and Ophthalmology Alpha-1 Adrenergic Receptors on Rabbit Retinal Pigment Epithelium Donald
More informationSupplementary information. The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit
Supplementary information The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit Anna Raffaello 1,4, Diego De Stefani 1,4, Davide Sabbadin 2, Enrico
More informationSignature Current of SO 2 -induced Bronchitis in Rabbit
Signature Current of SO 2 -induced Bronchitis in Rabbit Nobuhisa Iwase, Tsukasa Sasaki, Sanae Shimura, Toshiaki Fushimi, Hiroshi Okayama, Hiroki Hoshi, Toshiya Irokawa, Kan Sasamori, Koichi Takahashi,*
More informationSupplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.
Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,
More informationInnate immune responses to soluble factors from Pseudomonas aeruginosa. Mark Aaron Grabiner. Doctor of Philosophy. Molecular and Cell Biology.
Innate immune responses to soluble factors from Pseudomonas aeruginosa by Mark Aaron Grabiner A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy
More informationIon transport across CF and normal murine olfactory and ciliated epithelium
Am J Physiol Cell Physiol 296: C1301 C1309, 2009. First published March 25, 2009; doi:10.1152/ajpcell.00578.2008. Ion transport across CF and normal murine olfactory and ciliated epithelium B. R. Grubb,
More informationThe cystic fibrosis transmembrane conductance regulator
CFTR and Bicarbonate Secretion to Epithelial Cells Martin J Hug, 1 Tsutomu Tamada, 2 and Robert J Bridges 2 1 Institute of Physiology, University of Münster, D-48149 Münster, Germany; and 2 Department
More informationCollege of Medicine, Newcastle-upon-Tyne.)
GLUCOSE ABSORPTION IN THE RENAL TUBULES OF THE FROG. BY G. A. CLARK. (From the Physiological Laboratory of the University of Durham College of Medicine, Newcastle-upon-Tyne.) OPINION is divided on the
More informationRole of Tyk-2 in Th9 and Th17 cells in allergic asthma
Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory
More informationSupplementary Material to Manuscript SREP A
Supplementary Material to Manuscript SREP-15-29162A Monocyte-induced recovery of inflammation-associated hepatocellular dysfunction in a biochip-based human liver model Authors: Marko Gröger a,f,1, Knut
More informationOroxcell Percutaneous and intestinal absorption
Percutaneous and intestinal absorption Table of contents Percutaneous and intestinal absorption 1. Intestinal absorption Permeability across in vitro epithelial monolayers Ussing chambers In situ intestinal
More informationA Model of Intestinal Anaphylaxis in Whey Sensitized Balb/c Mice
American Journal of Immunology 5(2): 56-60, 2009 ISSN 1553-619X 2009 Science Publications A Model of Intestinal Anaphylaxis in Whey Sensitized Balb/c Mice Negaoui Hanane, Kaddouri Hanane, Kheroua Omar
More informationCharacteristics of Stimulation of H+ Transport
Characteristics of Stimulation of H+ Transport by Aldosterone in Turtle Urinary Bladder QAIS AL-AWQATI, LAURENCE H. NoRBY, ALLAN MUELLER, and PHILIP R. STEINMEIZ From the Department of Internal Medicine,
More informationDesacetyl bisacodyl-induced epithelial Cl secretion in rat colon and rectum
Biomedical Research (Tokyo) 37 (1) 13 20, 2016 Desacetyl bisacodyl-induced epithelial Cl secretion in rat colon and rectum Takuya FUJITA 1, 2, Shin-ichiro KARAKI 1, Takashi TATEOKA 2, and Atsukazu KUWAHARA
More informationInhibition of a K q conductance by the phosphatase inhibitor calyculin A in rat distal colon
0014-2999r98r$1900 1998 Elsevier Science BV All rights reserved European Journal of Pharmacology 349 1998 89 95 Inhibition of a K conductance by the phosphatase inhibitor calyculin A in rat distal colon
More informationThe extracellular calcium-sensing receptor (CaSR; ref. 1) is an
Calcium-sensing receptor abrogates secretagogueinduced increases in intestinal net fluid secretion by enhancing cyclic nucleotide destruction John Geibel*, Kumudesh Sritharan*, Rainer Geibel*, Peter Geibel*,
More informationSTEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 16, PAGE
STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 16, 2017 -- PAGE 1 of 9 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There
More informationBriefing - The Kidney Project
Briefing - Goal 1 - Implantable Artificial Kidney Shuvo Roy, PhD Professor Department of Bioengineering and Therapeutic Sciences Department of Surgery Schools of Pharmacy and Medicine UC San Francisco
More informationHydrogen sulfide decreases -adrenergic agonist-stimulated lung liquid clearance by inhibiting ENaC-mediated transepithelial sodium absorption
Am J Physiol Regul Integr Comp Physiol 308: R636 R649, 2015. First published January 28, 2015; doi:10.1152/ajpregu.00489.2014. Hydrogen sulfide decreases -adrenergic agonist-stimulated lung liquid clearance
More informationIon Transport Mechanisms in Native Human Retinal Pigment Epithelium
Investigative Ophthalmology & Visual Science, Vol. 33, No. 13, December 1992 Copyright Association for Research in Vision and Ophthalmology Ion Transport Mechanisms in Native Human Retinal Pigment Epithelium
More informationSUPPLEMENTARY INFORMATION. The Calcium-activated Chloride Channel Anoctamin 1 acts as a Heat. Sensor in Nociceptive Neurons
SUPPLEMENTARY INFORMATION The Calcium-activated Chloride Channel Anoctamin 1 acts as a Heat Sensor in Nociceptive Neurons Hawon Cho, Young Duk Yang, Jesun Lee, Byeongjoon Lee, Tahnbee Kim Yongwoo Jang,
More information