Electronic supplementary material (ESM) J Mol Med Glucose promotes secretion-dependent renal cyst growth

Size: px
Start display at page:

Download "Electronic supplementary material (ESM) J Mol Med Glucose promotes secretion-dependent renal cyst growth"

Transcription

1 Electronic supplementary material (ESM) J Mol Med 15 Glucose promotes secretion-dependent renal cyst growth Andre Kraus 1, Gunnar Schley 1, Karl Kunzelmann, Rainer Schreiber, Dorien Peters 3, Ruth Stadler, Kai-Uwe Eckardt 1, Bjoern Buchholz 1 Corresponding author: Bjoern Buchholz, MD Department of Nephrology and Hypertension Friedrich-Alexander-University Erlangen-Nürnberg Ulmenweg 18 D 915 Erlangen, Germany Phone: Fax: Bjoern.Buchholz@uk-erlangen.de

2 Supplemental Table 1: Real-time PCR Primer Gene Species Primer sequence 5'-3' ANO1 Canine fw CTGCACGACGGAGACTACGA rev GTAGCTCGCCCACTCTTGGT ANO6 Canine fw AAGCAGCCCTTGGACCTTATC rev AGTGTAGTAGCCCAGCCAAGC PYR Canine fw ACAGGTGGGACAGAACTGACG rev TGTCCGCCTAGAATCCTCACT NKCC1 Canine fw GATGATTTGAGAGAAGGTGCAGCAT rev GACAAGTGTGTTTGGCTTCATACG CFTR Canine fw CGGAGACAACGAAGACAGTCTGT rev CTTCGGTGAATGCTCTGACCTT HPRT Canine fw CGGCTTGCTCGAGATGTGAT rev GAGCACACAGAGGGCTACGAT ANO1 Mouse fw TGAGGGTGACAACGTTGAGTTC rev CGTAACTTGCCCATTCCTCATAC ANO6 Mouse fw TGGCAACCTCAACTGGTTCA rev ACTCCTGCTCTGGCTTGATGA PYR Mouse fw GGGACGAACTGGGATACAAGTG rev ACACGGGCAACAGCACGTA NKCC1 Mouse fw GGTGGTGCAATTGGCTTGAT rev CGAATCCGACAACATACATAGCA CFTR Mouse fw CAGCTCAAACAACTGGAATCTGA rev GCTCGAAGTGTCCAGAGTCCTT PKD1 reference PKD1 deletion Mouse Mouse fw TTACGGGCTGCAGGAATTCGAT rev ATGCCCAAGATGAGGACAATGC fw TGCTCTTGGTAGCTGTAGCTGT rev AGCTGCTTGAGAGAAGCCACAT 18S Mouse fw TGATTAAGTCCCTGCCCTTTGTA rev CGATCCGAGGGCCTCACTA

3 Supplemental Figure 1 a b c I SC initial [µa/cm²] 1 I SC camp [µa/cm²] I SC UTP [µa/cm²] peak UTP 1µM plateau UTP 1µM Supplemental figure 1. Changes in transepithelial conductances by elevated glucose concentration is not referable to changes in medium osmolality. plmdck cells were grown as polarized monolayers on permeable supports and pre-incubated with either low (LG, 1 mg/dl), high glucose (, 5 mg/dl) or low glucose medium supplemented with mm mannitol (Ma) in order to increase osmolality to that of high glucose medium for 5 days. Then, cells were mounted into a perfused micro Ussing chamber and the luminal and basolateral surfaces of the epithelium were perfused continuously with ringer solution supplemented with either low glucose, high glucose, or mannitol. a Summary of the obtained initial short circuit currents (Isc) at the beginning of the experiment which was significantly elevated in cells but not in LG or Ma cells. b Summary of Isc upon perfusion of the cells with 1 µm 3-Isobutyl-1-methylxanthin (IBMX) together with 1 µm forskolin (Isc camp). c Summary of Isc upon application of 1 µm UTP (Isc UTP). P<.5, ANOVA. N=5-18.

4 Supplemental Figure a I SC [µa/cm²].. Flow stop Flow on b ΔI SC Flow on [µa/cm²].. Supplemental figure. The initial short circuit currents obtained in high glucose cells are not referable to changes in bath flow. plmdck cells were grown as polarized monolayers on permeable supports and pre-incubated with either low (LG, 1 mg/dl), high glucose (, 5 mg/dl) or low glucose medium supplemented with mm mannitol (Ma). Then, cells were mounted into a micro Ussing chamber and perfused continuously with ringer solution supplemented with either low glucose, high glucose, or mannitol. a Summary of the short circuit currents (Isc) obtained by stopping bath flow (Flow stop) and by switching on bath flow again (Flow on). b Summary of the change in Isc (ΔIsc) between switching bath flow off/on. N=6-8.

5 Supplemental Figure 3 a LG b c I SC UTP peak [%] min I SC UTP peak [%] min I SC UTP [µa/cm²] min peak UTP 1µM plateau UTP 1µM d 1µM UTP V te [mv] min Supplemental figure 3. The reduction of Isc UTP in high glucose treated cells may be refered to emptied calcium stores. plmdck cells were grown as polarized monolayers on permeable supports and pre-incubated with either low (LG, 1 mg/dl) or high glucose (, 5 mg/dl) medium. Then, cells were mounted into a micro Ussing chamber and perfused continuously with ringer solution supplemented with low glucose or high glucose. a Repetitive application of 1 µm UTP starting at time point, and repeated after 5 and 1 minutes led to a significant reduction of Isc UTP compared to the first application in (a) low glucose and (b) high glucose treated cells. Further application of 1 µm UTP in a 1 minute interval resulted in partial recovery of Isc UTP in (a) low glucose and (b) high glucose cells. c Application of UTP 3 minutes after the initial Isc obtained in high glucose cells resulted in much stronger Isc UTP compared to Isc UTP obtained after 5 minutes. d Original trace of the transepithelial potential (Vte) of high glucose () cells showing recovery of the negative deflection of Vte upon administration of UTP if applied 3 minutes after the initial deflection of Vte. *p<.5, paired t-test. N=5-1.

Glucose promotes secretion-dependent renal cyst growth

Glucose promotes secretion-dependent renal cyst growth J Mol Med (2016) 94:107 117 DOI 10.1007/s00109-015-1337-4 ORIGINAL ARTICLE Glucose promotes secretion-dependent renal cyst growth Andre Kraus 1 & Gunnar Schley 1 & Karl Kunzelmann 2 & Rainer Schreiber

More information

ONLINE SUPPLEMENT Title: CFTR dysfunction induces vascular endothelial growth factor synthesis in airway epithelium

ONLINE SUPPLEMENT Title: CFTR dysfunction induces vascular endothelial growth factor synthesis in airway epithelium ONLINE SUPPLEMENT Title: CFTR dysfunction induces vascular endothelial growth factor synthesis in airway epithelium Martin C, Coolen N, Wu YZ, Thévenot G, Touqui L, PrulièreEscabasse V, Papon JF, Coste

More information

Lumen. -60 mv, ph 7.3 Cl - (E Cl CFTR HCO mv, ph 7.3 HCO HCO. Channel or Other electrogenic HCO 3- up to a 80-mM concentration when [Cl - ] i

Lumen. -60 mv, ph 7.3 Cl - (E Cl CFTR HCO mv, ph 7.3 HCO HCO. Channel or Other electrogenic HCO 3- up to a 80-mM concentration when [Cl - ] i . Proximal Duct 1 Cl HCO 8 Cl 8 HCO Lumen CFTR AE 6 mv, ph 7. Cl (E Cl = 712 ) Cl 2 HCO 2 lood ph HCO. Distal Duct 2 Cl 128 HCO >14 HCO? 6 mv, ph 7. Cl (E Cl = 47 ) Cl HCO HCO 5 2 HCO HCO Channel or Other

More information

Bicarbonate Secretion in the Murine Gallbladder - Lessons for the Treatment of Cystic Fibrosis

Bicarbonate Secretion in the Murine Gallbladder - Lessons for the Treatment of Cystic Fibrosis Bicarbonate Secretion in the Murine Gallbladder Lessons for the Treatment of Cystic Fibrosis Alan W Cuthbert Department of Medicine, University of Cambridge, Addenbrooke's Hospital, Hill's Road. Cambridge,

More information

How does cellular volume regulation works: Contribution of anoctamins, LRRC8A and CFTR

How does cellular volume regulation works: Contribution of anoctamins, LRRC8A and CFTR S Februar 2017 Current projects How does cellular volume regulation works: Contribution of anoctamins, LRRC8A and CFTR Recent results from our lab indicate a central role of anoctamins such as ANO1, ANO6

More information

The Amiloride-inhibitable Na

The Amiloride-inhibitable Na The Amiloride-inhibitable Na Conductance Is Reduced by the Cystic Fibrosis Transmembrane Conductance Regulator in Normal But Not in Cystic Fibrosis Airways M. Mall, M. Bleich, R. Greger, R. Schreiber,

More information

Purinergic regulation of CFTR and Ca 2 -activated Cl channels and K channels in human pancreatic duct epithelium

Purinergic regulation of CFTR and Ca 2 -activated Cl channels and K channels in human pancreatic duct epithelium Am J Physiol Cell Physiol 304: C673 C684, 2013. First published January 30, 2013; doi:10.1152/ajpcell.00196.2012. Purinergic regulation of CFTR and Ca 2 -activated Cl channels and K channels in human pancreatic

More information

Luminal cholinergic signalling in airway lining fluid: a novel mechanism for activating chloride secretion via Ca 2+ -dependent Cl - and K + channels

Luminal cholinergic signalling in airway lining fluid: a novel mechanism for activating chloride secretion via Ca 2+ -dependent Cl - and K + channels 1388..1402 British Journal of Pharmacology DOI:10.1111/j.1476-5381.2012.01883.x www.brjpharmacol.org RESEARCH PAPERbph_1883 Luminal cholinergic signalling in airway lining fluid: a novel mechanism for

More information

Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC

Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC Supplementary information Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC Pathway in Pancreatic -Cells Authors: Hodaka Yamada 1,*, Masashi Yoshida 1,*, Kiyonori Ito 1, Katsuya

More information

Mechanisms of the inhibition of epithelial Na channels by CFTR and purinergic stimulation

Mechanisms of the inhibition of epithelial Na channels by CFTR and purinergic stimulation Kidney International, Vol. 60 (2001), pp. 455 461 Mechanisms of the inhibition of epithelial Na channels by CFTR and purinergic stimulation KARL KUNZELMANN, RAINER SCHREIBER, and ANISSA BOUCHEROT Department

More information

Selective Activation of Cystic Fibrosis Transmembrane Conductance Regulator Cl - and HCO 3 - Conductances

Selective Activation of Cystic Fibrosis Transmembrane Conductance Regulator Cl - and HCO 3 - Conductances JOP. J. Pancreas (Online) 2001; 2(4 Suppl):212218. Selective Activation of Cystic Fibrosis Transmembrane Conductance Regulator Cl and HCO 3 Conductances MallaReddy M Reddy 1, Paul M Quinton 1,2 1 Department

More information

Supplementary Figure 1 NMR spectra of hydroxy α and β-sanshool isomers. (Top) Hydroxy-α-sanshool (2E,6Z,8E,10E)-2'-

Supplementary Figure 1 NMR spectra of hydroxy α and β-sanshool isomers. (Top) Hydroxy-α-sanshool (2E,6Z,8E,10E)-2'- Supplementary Figure 1 NMR spectra of hydroxy α and β-sanshool isomers. (Top) Hydroxy-α-sanshool (2E,6Z,8E,10E)-2'- hydroxyl-n-isobutyl-2,6,8,10-dodeca-tetraenamide) and (bottom) hydroxy-β-sanshool (2E,6E,8E,10E)-2'-hydroxyl-N-isobutyl-

More information

Polarized Signaling via Purinoceptors in Normal and Cystic Fibrosis Airway Epithelia

Polarized Signaling via Purinoceptors in Normal and Cystic Fibrosis Airway Epithelia Polarized Signaling via Purinoceptors in Normal and Cystic Fibrosis Airway Epithelia Anthony M. Paradiso, Carla M.P. Ribeiro, and Richard C. Boucher From the Cystic Fibrosis/Pulmonary Research and Treatment

More information

SLC26A9 is a constitutively active, CFTR-regulated anion conductance in human bronchial epithelia

SLC26A9 is a constitutively active, CFTR-regulated anion conductance in human bronchial epithelia Published Online: 16 March, 2009 Supp Info: http://doi.org/10.1085/jgp.200810097 Downloaded from jgp.rupress.org on August 18, 2018 ARTICLE SLC26A9 is a constitutively active, CFTR-regulated anion conductance

More information

Electrical Potential Differences and Electromotive Forces in Epithelial Tissues

Electrical Potential Differences and Electromotive Forces in Epithelial Tissues LETTER TO THE EDITOR [Brief letters to the Editor that make specific scientific reference to papers published previously in THE JOURNAL OF GENERAL PHYSIOLOGY are invited. Receipt of such letters will be

More information

Sodium and chlorine transport

Sodium and chlorine transport Kidney physiology 2 Sodium and chlorine transport The kidneys help to maintain the body's extracellular fluid (ECF) volume by regulating the amount of Na+ in the urine. Sodium salts (predominantly NaCl)

More information

Bestrophin-2 mediates bicarbonate transport by goblet cells in mouse colon

Bestrophin-2 mediates bicarbonate transport by goblet cells in mouse colon Bestrophin-2 mediates bicarbonate transport by goblet cells in mouse colon Kuai Yu, Emory University Rafael Lujan, Universidad de Castilla-La Mancha Alan Marmorstein, University of Arizona Sherif Gabriel,

More information

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular

More information

HCO3 secretion is not impaired in inflamed mouse anterior proximal colon

HCO3 secretion is not impaired in inflamed mouse anterior proximal colon HCO3 secretion is not impaired in inflamed mouse anterior proximal colon David Lai AGButt Lab A thesis submitted in partial fulfilment of the requirements for the degree of Bachelor of Biomedical Science

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR

More information

Deleterious impact of Pseudomonas aeruginosa on cystic fibrosis transmembrane conductance regulator function and rescue in airway epithelial cells

Deleterious impact of Pseudomonas aeruginosa on cystic fibrosis transmembrane conductance regulator function and rescue in airway epithelial cells ORIGINAL ARTICLE CYSTIC FIBROSIS Deleterious impact of Pseudomonas aeruginosa on cystic fibrosis transmembrane conductance regulator function and rescue in airway epithelial cells Nguyen Thu Ngan Trinh,,5,

More information

150 mm HCO How Does the Pancreas Do It? Clues from Computer Modelling of the Duct Cell

150 mm HCO How Does the Pancreas Do It? Clues from Computer Modelling of the Duct Cell JOP. J. Pancreas (Online) 2001; 2(4 Suppl):198202. 150 mm How Does the Pancreas Do It? Clues from Computer Modelling of the Duct Cell Yoshiro Sohma 1, Michael A Gray 2, Yusuke Imai 1, Barry E Argent 2

More information

camp-activated Ca 2+ signaling is required for CFTR-mediated serous cell fluid secretion in porcine and human airways

camp-activated Ca 2+ signaling is required for CFTR-mediated serous cell fluid secretion in porcine and human airways Related Commentary, page 3093 Research article camp-activated Ca 2+ signaling is required for CFTR-mediated serous cell fluid secretion in porcine and human airways Robert J. Lee 1 and J. Kevin Foskett

More information

Neuroscience 201A Problem Set #1, 27 September 2016

Neuroscience 201A Problem Set #1, 27 September 2016 Neuroscience 201A Problem Set #1, 27 September 2016 1. The figure above was obtained from a paper on calcium channels expressed by dentate granule cells. The whole-cell Ca 2+ currents in (A) were measured

More information

Materials and methods

Materials and methods Pflfigers Arch-Eur J Physiol (1995) 430 : 705-712 9 Springer-Verlag 1995 R. B. Bajnath 9 K. Dekker 9 H. R. De Jongc J. A. Groot Chloride secretion induced by phorbol dibutyrate and forskolin in the human

More information

GLP-1 stimulates insulin secretion by PKC-dependent TRPM4 and TRPM5 activation

GLP-1 stimulates insulin secretion by PKC-dependent TRPM4 and TRPM5 activation GLP-1 stimulates insulin secretion by PKC-dependent TRPM4 and TRPM5 activation Makoto Shigeto, 1,2,3 Reshma Ramracheya, 1 Andrei I. Tarasov, 1,4 Chae Young Cha, 1,2 Margarita V. Chibalina, 1 Benoit Hastoy,

More information

Maintenance of coelomic fluid ph in sea urchins exposed to elevated CO 2 : the role of body cavity epithelia and stereom dissolution

Maintenance of coelomic fluid ph in sea urchins exposed to elevated CO 2 : the role of body cavity epithelia and stereom dissolution Marine Biology Supplementary Online Resource For: Maintenance of coelomic fluid ph in sea urchins exposed to elevated CO 2 : the role of body cavity epithelia and stereom dissolution Wiebke C. Holtmann

More information

Bioelectric effects of quinine on polarized airway epithelial cells

Bioelectric effects of quinine on polarized airway epithelial cells Journal of Cystic Fibrosis 6 (2007) 351 359 www.elsevier.com/locate/jcf Bioelectric effects of quinine on polarized airway epithelial cells Eleanor Bates d, Stacey Miller d, Mariah Alexander d, Marina

More information

As recognition of acute and chronic pain in dogs

As recognition of acute and chronic pain in dogs J Vet Intern Med 2014;28:793 798 The Effect of Tramadol and Indomethacin Coadministration on Gastric Barrier Function in Dogs T.L. Hill, B.D.X. Lascelles, J.M. Law, and A.T. Blikslager Background: Tramadol

More information

Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses

Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses Fig. S1. Immunohistochemical detection of iglur2 protein in single islet cells. A: α cells identified using glucagon-specific antibody express the iglur2 subtype of AMPA receptor. 24 out of 26 identified

More information

Intestinal epithelial cells secrete water and electrolytes

Intestinal epithelial cells secrete water and electrolytes GASTROENTEROLOGY 2002;122:1070 1087 Enteroinvasive Bacteria Alter Barrier and Transport Properties of Human Intestinal Epithelium: Role of inos and COX-2 SILVIA RESTA LENERT* and KIM E. BARRETT*, *Department

More information

EFFECT OF FOUR SETS OF DISTINCT MODULATORS ON NON-F508DEL MUTATIONS THAT CAUSE CYSTIC FIBROSIS

EFFECT OF FOUR SETS OF DISTINCT MODULATORS ON NON-F508DEL MUTATIONS THAT CAUSE CYSTIC FIBROSIS EFFECT OF FOUR SETS OF DISTINCT MODULATORS ON NON-F508DEL MUTATIONS THAT CAUSE CYSTIC FIBROSIS BHATT, PRIYANKA; BAILEY, VIOLAINE; DASGUPTA, AFIA; CHIN, JUSTIN; AN, WEILING; BRESILLA, CASTERA; KWOK, IRIS;

More information

Prostaglandins I 2 and E 2 Have a Synergistic Role in Rescuing Epithelial Barrier Function in Porcine Ileum

Prostaglandins I 2 and E 2 Have a Synergistic Role in Rescuing Epithelial Barrier Function in Porcine Ileum Prostaglandins I 2 and E 2 Have a Synergistic Role in Rescuing Epithelial Barrier Function in Porcine Ileum Anthony T. Blikslager,* Malcolm C. Roberts, J. Marc Rhoads, and Robert A. Argenzio* *Department

More information

Experience in Southeast Asia with cases of secretory

Experience in Southeast Asia with cases of secretory GASTROENTEROLOGY 1999;116:1342 1347 Characterization of the Inhibitory Effect of Boiled Rice on Intestinal Chloride Secretion in Guinea Pig Crypt Cells CERI J. MATHEWS,* R. JOHN MACLEOD,, SHU XIAN ZHENG,*

More information

The ocular surface, lined by corneal and conjunctival epithelia,

The ocular surface, lined by corneal and conjunctival epithelia, Potential Difference Measurements of Ocular Surface Na Absorption Analyzed Using an Electrokinetic Model Marc H. Levin, 1,2 Jung Kyung Kim, 1,3 Jie Hu, 1,3 and A. S. Verkman 1,2 PURPOSE. Corneal and conjunctival

More information

Supplementary Material and Methods

Supplementary Material and Methods Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided

More information

Cl - channel regulated by camp-dependent phosphorylation

Cl - channel regulated by camp-dependent phosphorylation Defective Fluid Transport by Cystic Fibrosis Airway pithelia Rapid Publication Jeffrey J. Smith, Philip H. Karp,* and Michael J. Welsh* Department ofpediatrics and *Howard Hughes Medical Institute, Departments

More information

Na absorption in the colon plays an important role

Na absorption in the colon plays an important role Japanese Journal of Physiology, 51, 435 444, 2001 The Effect of camp on Electrogenic Na Absorption in the Rat Distal Colon Yo TSUCHIYA and Yuichi SUZUKI Laboratory of Physiology, School of Food and Nutritional

More information

Role of transmembrane chloride transporters. in the fluid secretion of lacrimal gland duct cells

Role of transmembrane chloride transporters. in the fluid secretion of lacrimal gland duct cells Role of transmembrane chloride transporters in the fluid secretion of lacrimal gland duct cells Eszter Vizvári, M.D. Ph.D. Thesis Doctoral School of Clinical Medicine Supervisor: Edit Tóth-Molnár, M.D.,

More information

Cigarette Smoke Inhibition of Ion Transport

Cigarette Smoke Inhibition of Ion Transport Cigarette Smoke Inhibition of Ion Transport in Canine Tracheal Epithelium MICHAEL J. WELSH with the technical assistance of PHIL KARP, Pulmonary Division, Department of Internal Medicine, University of

More information

camp-stimulated Cl - secretion is increased by glucocorticoids and inhibited by bumetanide in semicircular canal duct epithelium

camp-stimulated Cl - secretion is increased by glucocorticoids and inhibited by bumetanide in semicircular canal duct epithelium Pondugula et al. BMC Physiology 213, 13:6 RESEARCH ARTICLE Open Access camp-stimulated Cl - secretion is increased by glucocorticoids and inhibited by bumetanide in semicircular canal duct epithelium Satyanarayana

More information

Chloride channels in the apical membrane of normal and cystic fibrosis airway and intestinal epithelia

Chloride channels in the apical membrane of normal and cystic fibrosis airway and intestinal epithelia Chloride channels in the apical membrane of normal and cystic fibrosis airway and intestinal epithelia MATTHEW P. ANDERSON, DAVID N. SHEPPARD, HERBERT A. BERGER, AND MICHAEL J. WELSH Howard Hughes Medical

More information

An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes

An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes An excessive increase in glutamate contributes to glucose-toxicity in β-cells via activation of pancreatic NMDA receptors in rodent diabetes Xiao-Ting Huang 1, Chen Li 1,3, Xiang-Ping Peng 1, Jia Guo 1,5,

More information

Two Decades of Evidenced-based Outcomes Research: The Erlangen Stroke Registry

Two Decades of Evidenced-based Outcomes Research: The Erlangen Stroke Registry Two Decades of Evidenced-based Outcomes Research: The Erlangen Stroke Registry 06.06.2017 Prof. Dr. Peter Kolominsky-Rabas, MD, PhD, MBA Interdisciplinary Center for Health Technology Assessment (HTA)

More information

Piloting Treatment with IGF-1 in Phelan-McDermid Syndrome

Piloting Treatment with IGF-1 in Phelan-McDermid Syndrome Piloting Treatment with IGF-1 in Phelan-McDermid Syndrome Seaver Autism Center for Research and Treatment at Mount Sinai Principal Investigator: Alex Kolevzon, MD One Gustave L. Levy Place, Box 1230 New

More information

monolayer In vivo "culture" of a transporting renal epithelial TECHNICAL NOTE

monolayer In vivo culture of a transporting renal epithelial TECHNICAL NOTE Kidney International, Vol. 19 (1981), pp. 465-470 TECHNICAL NOTE In vivo "culture" of a transporting renal epithelial monolayer YAACOV BAR-KHAYIM, ARTHUR H. COHEN, BARBARA HOUSTON, WALTER TRIZNA, and LEON

More information

Pflfigers Archiv European Journal of Physiology 9 Springer-Verlag 1985

Pflfigers Archiv European Journal of Physiology 9 Springer-Verlag 1985 Pflfigers Arch (1985) 403: 82-89 Pflfigers Archiv European Journal of Physiology 9 Springer-Verlag 1985 Passive cation permeability of turtle colon: Evidence for a negative interaction between intracellular

More information

HANS H. USSING, THOMAS U. L. BIBER, and NEAL S. BRICKER

HANS H. USSING, THOMAS U. L. BIBER, and NEAL S. BRICKER Exposure of the Isolated Frog Skin to High Potassium Concentrations at the Internal Surface II. Changes in epithelial cell volume, resistance, and response to antidiuretic hormone HANS H. USSING, THOMAS

More information

Shujun Fan*, Natalie Harfoot*, Ray C. Bartolo and A. Grant Butt

Shujun Fan*, Natalie Harfoot*, Ray C. Bartolo and A. Grant Butt 1218 The Journal of Experimental iology 21, 1218-123 212. Published by The ompany of iologists Ltd doi:1.1242/jeb.61176 RESERH RTILE FTR is restricted to a small population of high expresser cells that

More information

(Received 14 September 1987) (decrease) in current. magnitude of the osmotic steps and were reproducible and reversible if the

(Received 14 September 1987) (decrease) in current. magnitude of the osmotic steps and were reproducible and reversible if the Journal of Physiology (1988), 406, pp. 371-392 371 W'ith 15 te. -figures Printed int Great Britaini ELECTRICAL TRANSIENTS PRODUCED BY THE TOAD URINARY BLADDER IN RESPONSE TO ALTERED MEDIUM OSMOLALITY BY

More information

Cardiac muscle is different from other types of muscle in that cardiac muscle

Cardiac muscle is different from other types of muscle in that cardiac muscle 6 E X E R C I S E Cardiovascular Physiology O B J E C T I V E S 1. To define autorhythmicity, sinoatrial node, pacemaker cells, and vagus nerves 2. To understand the effects of the sympathetic and parasympathetic

More information

Supplemental Data. Deinlein et al. Plant Cell. (2012) /tpc

Supplemental Data. Deinlein et al. Plant Cell. (2012) /tpc µm Zn 2+ 15 µm Zn 2+ Growth (% of control) empty vector NS1 NS2 NS3 NS4 S. pombe zhfδ Supplemental Figure 1. Functional characterization of. halleri NS genes in Zn 2+ hypersensitive S. pombe Δzhf mutant

More information

Biopharmaceutics Classification System: Defining a Permeability Class

Biopharmaceutics Classification System: Defining a Permeability Class Biopharmaceutics Classification System: Defining a Permeability Class Blair Miezeiewski, M.S. Senior Scientist, In Vitro Permeability Lab Definition of Bioequivalence The United States Food and Drug Administration

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Localization of virus injections. (a) Schematic showing the approximate center of AAV-DIO-ChR2-YFP injection sites in the NAc of Dyn-cre mice (n=8 mice, 16 injections; caudate/putamen,

More information

Epithelial chloride transport by CFTR requires TMEM16A

Epithelial chloride transport by CFTR requires TMEM16A Washington University School of Medicine Digital Commons@Becker Open Access Publications 2017 Epithelial chloride transport by CFTR requires TMEM16A Roberta Benedetto University of Regensburg Jiraporn

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Preclinical in vitro Evaluation: Combination FDL169/FDL176 is Superior to Tezacaftor/Ivacaftor

Preclinical in vitro Evaluation: Combination FDL169/FDL176 is Superior to Tezacaftor/Ivacaftor Mike Zawistoski @ MZ Sports Shots Preclinical in vitro Evaluation: Combination /FDL176 is Superior to Tezacaftor/Ivacaftor Flatley Discovery Lab Preclinical in vitro Evaluation of CFTR Modulator Combinations

More information

Loss of Anion Transport without Increased Sodium Absorption Characterizes Newborn Porcine Cystic Fibrosis Airway Epithelia

Loss of Anion Transport without Increased Sodium Absorption Characterizes Newborn Porcine Cystic Fibrosis Airway Epithelia Loss of Anion Transport without Increased Sodium Absorption Characterizes Newborn Porcine Cystic Fibrosis Airway Epithelia Jeng-Haur Chen, 1,3 David A. Stoltz, 1 Philip H. Karp, 1,3 Sarah E. Ernst, 1 Alejandro

More information

Effect of apical hyperosmotic sodium challenge and amiloride on sodium transport in human bronchial epithelial cells from cystic fibrosis donors

Effect of apical hyperosmotic sodium challenge and amiloride on sodium transport in human bronchial epithelial cells from cystic fibrosis donors Am J Physiol Cell Physiol 305: C1114 C1122, 2013. First published August 28, 2013; doi:10.1152/ajpcell.00166.2013. Effect of apical hyperosmotic sodium challenge and amiloride on sodium transport in human

More information

Zhu et al, page 1. Supplementary Figures

Zhu et al, page 1. Supplementary Figures Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior

More information

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed

More information

Role of anion exchangers in Cl and HCO 3 secretion by the human airway epithelial cell line Calu-3

Role of anion exchangers in Cl and HCO 3 secretion by the human airway epithelial cell line Calu-3 Am J Physiol Cell Physiol 307: C208 C219, 2014. First published June 4, 2014; doi:10.1152/ajpcell.00083.2014. Role of anion exchangers in Cl and secretion by the human airway epithelial cell line Calu-3

More information

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer

More information

hydrolyzes ATP to exchange 3 Na + in for 2 K + out generate the transcellular Na + and K + gradients provides the electrochemical gradient

hydrolyzes ATP to exchange 3 Na + in for 2 K + out generate the transcellular Na + and K + gradients provides the electrochemical gradient Regulation of pancreatic excretory function by ion channels Viktoria Venglovecz 2015 Morphology of the pancreas Composition of pancreatic juice 1 2 liters of pancreatic juice per day acini secrete isotonic,

More information

Characterization of Ion and Fluid Transport in Human Bronchioles

Characterization of Ion and Fluid Transport in Human Bronchioles Characterization of Ion and Fluid Transport in Human Bronchioles Sabine Blouquit, Hugues Morel, Jocelyne Hinnrasky, Emmanuel Naline, Edith Puchelle, and Thierry Chinet Laboratoire de Biologie et Pharmacologie

More information

Regulation of chloride secretion across porcine endometrial epithelial cells by prostaglandin E2

Regulation of chloride secretion across porcine endometrial epithelial cells by prostaglandin E2 Keywords: Endometrium, Cystic fibrosis transmembrane conductance regulator, Chloride secretion 6777 Journal of Physiology (1998), 508.1, pp. 31 47 31 Regulation of chloride secretion across porcine endometrial

More information

Many epithelia have, as one of their physiological properties, the ability to utilize. subsequently determined. P.O. Box 913, Dunedin, New Zealand

Many epithelia have, as one of their physiological properties, the ability to utilize. subsequently determined. P.O. Box 913, Dunedin, New Zealand J. Phy8iol. (1 982), 333, pp. I 1 1-1 23 ill Printed in Great Britain IONS AND WATER IN THE EPITHELIAL CELLS OF RABBIT DESCENDING COLON BY ANTHONY D. C. MACKNIGHT, DRUSILLA R. MASON, RICHARD C. ROSEt AND

More information

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody. ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *

More information

Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice

Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Supplementary Information Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Gou Takahashi, Channabasavaiah B Gurumurthy,

More information

Chatsri Deachapunya, Melissa Palmer-Densmore, and Scott M. O Grady

Chatsri Deachapunya, Melissa Palmer-Densmore, and Scott M. O Grady Published Online: 27 September, 1999 Supp Info: http://doi.org/10.1085/jgp.114.4.561 Downloaded from jgp.rupress.org on January 16, 2019 Insulin Stimulates Transepithelial Sodium Transport by Activation

More information

The Cdc42 inhibitor secramine B prevents camp-induced K+ conductance in intestinal epithelial cells

The Cdc42 inhibitor secramine B prevents camp-induced K+ conductance in intestinal epithelial cells The Cdc42 inhibitor secramine B prevents camp-induced K+ conductance in intestinal epithelial cells The Harvard community has made this article openly available. Please share how this access benefits you.

More information

BAK FOONG PILLS STIMULATE ANION SECRETION ACROSS NORMAL AND CYSTIC FIBROSIS PANCREATIC DUCT EPITHELIA

BAK FOONG PILLS STIMULATE ANION SECRETION ACROSS NORMAL AND CYSTIC FIBROSIS PANCREATIC DUCT EPITHELIA Cell Biology International 2002, Vol. 26, No. 12, 1011 1018 doi:10.1006/cbir.2002.0960, available online at http://www.idealibrary.com on BAK FOONG PILLS STIMULATE ANION SECRETION ACROSS NORMAL AND CYSTIC

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

SESSION 1: Colonic physiology

SESSION 1: Colonic physiology SESSION 1: Colonic physiology Human Colonic Potassium Channel Expression and Function in Ulcerative Colitis Geoffrey I Sandle Leeds Institute of Molecular Medicine, St James s University Hospital, Leeds,

More information

Parenteral Nutrition. Outline. Potential Biomarkers for Use in Intestinal Adaptation. Jejunum is primary site of digestion and absorption

Parenteral Nutrition. Outline. Potential Biomarkers for Use in Intestinal Adaptation. Jejunum is primary site of digestion and absorption Outline Potential Biomarkers for Use in Intestinal Adaptation Kelly A. Tappenden, Ph.D., R.D. Professor of Nutrition and GI Physiology 1. Intestinal Adaptation potential regulators 2. Intestinal mucosal

More information

nachr α 4 β 2 CHO Cell Line

nachr α 4 β 2 CHO Cell Line B SYS GmbH nachr α 4 β 2 CHO Cell Line Cell Culture Conditions B SYS GmbH B SYS GmbH nachr α 4 β 2 CHO Page 2 TABLE OF CONTENTS 1 BACKGROUND...3 1.1 Human Nicotinic Acetylcholine Receptors...3 1.2 B SYS

More information

Aldosterone increases K Ca 1.1 (BK) channel-mediated colonic K + secretion

Aldosterone increases K Ca 1.1 (BK) channel-mediated colonic K + secretion J Physiol 586.17 (28) pp 4251 4264 4251 Aldosterone increases K Ca 1.1 (BK) channel-mediated colonic K + secretion Mads V. Sørensen 1, Joana E. Matos 1, Matthias Sausbier 2, Ulrike Sausbier 2,PeterRuth

More information

Alpha-1 Adrenergic Receptors on Rabbit Retinal Pigment Epithelium

Alpha-1 Adrenergic Receptors on Rabbit Retinal Pigment Epithelium Investigative Ophthalmology & Visual Science, Vol. 29, No. 5, May 1988 Copyright Association for Research in Vision and Ophthalmology Alpha-1 Adrenergic Receptors on Rabbit Retinal Pigment Epithelium Donald

More information

Supplementary information. The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit

Supplementary information. The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit Supplementary information The mitochondrial calcium uniporter is a multimer that can include a dominant-negative pore-forming subunit Anna Raffaello 1,4, Diego De Stefani 1,4, Davide Sabbadin 2, Enrico

More information

Signature Current of SO 2 -induced Bronchitis in Rabbit

Signature Current of SO 2 -induced Bronchitis in Rabbit Signature Current of SO 2 -induced Bronchitis in Rabbit Nobuhisa Iwase, Tsukasa Sasaki, Sanae Shimura, Toshiaki Fushimi, Hiroshi Okayama, Hiroki Hoshi, Toshiya Irokawa, Kan Sasamori, Koichi Takahashi,*

More information

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain. Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,

More information

Innate immune responses to soluble factors from Pseudomonas aeruginosa. Mark Aaron Grabiner. Doctor of Philosophy. Molecular and Cell Biology.

Innate immune responses to soluble factors from Pseudomonas aeruginosa. Mark Aaron Grabiner. Doctor of Philosophy. Molecular and Cell Biology. Innate immune responses to soluble factors from Pseudomonas aeruginosa by Mark Aaron Grabiner A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy

More information

Ion transport across CF and normal murine olfactory and ciliated epithelium

Ion transport across CF and normal murine olfactory and ciliated epithelium Am J Physiol Cell Physiol 296: C1301 C1309, 2009. First published March 25, 2009; doi:10.1152/ajpcell.00578.2008. Ion transport across CF and normal murine olfactory and ciliated epithelium B. R. Grubb,

More information

The cystic fibrosis transmembrane conductance regulator

The cystic fibrosis transmembrane conductance regulator CFTR and Bicarbonate Secretion to Epithelial Cells Martin J Hug, 1 Tsutomu Tamada, 2 and Robert J Bridges 2 1 Institute of Physiology, University of Münster, D-48149 Münster, Germany; and 2 Department

More information

College of Medicine, Newcastle-upon-Tyne.)

College of Medicine, Newcastle-upon-Tyne.) GLUCOSE ABSORPTION IN THE RENAL TUBULES OF THE FROG. BY G. A. CLARK. (From the Physiological Laboratory of the University of Durham College of Medicine, Newcastle-upon-Tyne.) OPINION is divided on the

More information

Role of Tyk-2 in Th9 and Th17 cells in allergic asthma

Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory

More information

Supplementary Material to Manuscript SREP A

Supplementary Material to Manuscript SREP A Supplementary Material to Manuscript SREP-15-29162A Monocyte-induced recovery of inflammation-associated hepatocellular dysfunction in a biochip-based human liver model Authors: Marko Gröger a,f,1, Knut

More information

Oroxcell Percutaneous and intestinal absorption

Oroxcell Percutaneous and intestinal absorption Percutaneous and intestinal absorption Table of contents Percutaneous and intestinal absorption 1. Intestinal absorption Permeability across in vitro epithelial monolayers Ussing chambers In situ intestinal

More information

A Model of Intestinal Anaphylaxis in Whey Sensitized Balb/c Mice

A Model of Intestinal Anaphylaxis in Whey Sensitized Balb/c Mice American Journal of Immunology 5(2): 56-60, 2009 ISSN 1553-619X 2009 Science Publications A Model of Intestinal Anaphylaxis in Whey Sensitized Balb/c Mice Negaoui Hanane, Kaddouri Hanane, Kheroua Omar

More information

Characteristics of Stimulation of H+ Transport

Characteristics of Stimulation of H+ Transport Characteristics of Stimulation of H+ Transport by Aldosterone in Turtle Urinary Bladder QAIS AL-AWQATI, LAURENCE H. NoRBY, ALLAN MUELLER, and PHILIP R. STEINMEIZ From the Department of Internal Medicine,

More information

Desacetyl bisacodyl-induced epithelial Cl secretion in rat colon and rectum

Desacetyl bisacodyl-induced epithelial Cl secretion in rat colon and rectum Biomedical Research (Tokyo) 37 (1) 13 20, 2016 Desacetyl bisacodyl-induced epithelial Cl secretion in rat colon and rectum Takuya FUJITA 1, 2, Shin-ichiro KARAKI 1, Takashi TATEOKA 2, and Atsukazu KUWAHARA

More information

Inhibition of a K q conductance by the phosphatase inhibitor calyculin A in rat distal colon

Inhibition of a K q conductance by the phosphatase inhibitor calyculin A in rat distal colon 0014-2999r98r$1900 1998 Elsevier Science BV All rights reserved European Journal of Pharmacology 349 1998 89 95 Inhibition of a K conductance by the phosphatase inhibitor calyculin A in rat distal colon

More information

The extracellular calcium-sensing receptor (CaSR; ref. 1) is an

The extracellular calcium-sensing receptor (CaSR; ref. 1) is an Calcium-sensing receptor abrogates secretagogueinduced increases in intestinal net fluid secretion by enhancing cyclic nucleotide destruction John Geibel*, Kumudesh Sritharan*, Rainer Geibel*, Peter Geibel*,

More information

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 16, PAGE

STEIN IN-TERM EXAM -- BIOLOGY FEBRUARY 16, PAGE STEIN IN-TERM EXAM -- BIOLOGY 3058 -- FEBRUARY 16, 2017 -- PAGE 1 of 9 There are 25 questions in this Biology 3058 exam. All questions are "A, B, C, D, E, F, G, H" questions worth one point each. There

More information

Briefing - The Kidney Project

Briefing - The Kidney Project Briefing - Goal 1 - Implantable Artificial Kidney Shuvo Roy, PhD Professor Department of Bioengineering and Therapeutic Sciences Department of Surgery Schools of Pharmacy and Medicine UC San Francisco

More information

Hydrogen sulfide decreases -adrenergic agonist-stimulated lung liquid clearance by inhibiting ENaC-mediated transepithelial sodium absorption

Hydrogen sulfide decreases -adrenergic agonist-stimulated lung liquid clearance by inhibiting ENaC-mediated transepithelial sodium absorption Am J Physiol Regul Integr Comp Physiol 308: R636 R649, 2015. First published January 28, 2015; doi:10.1152/ajpregu.00489.2014. Hydrogen sulfide decreases -adrenergic agonist-stimulated lung liquid clearance

More information

Ion Transport Mechanisms in Native Human Retinal Pigment Epithelium

Ion Transport Mechanisms in Native Human Retinal Pigment Epithelium Investigative Ophthalmology & Visual Science, Vol. 33, No. 13, December 1992 Copyright Association for Research in Vision and Ophthalmology Ion Transport Mechanisms in Native Human Retinal Pigment Epithelium

More information

SUPPLEMENTARY INFORMATION. The Calcium-activated Chloride Channel Anoctamin 1 acts as a Heat. Sensor in Nociceptive Neurons

SUPPLEMENTARY INFORMATION. The Calcium-activated Chloride Channel Anoctamin 1 acts as a Heat. Sensor in Nociceptive Neurons SUPPLEMENTARY INFORMATION The Calcium-activated Chloride Channel Anoctamin 1 acts as a Heat Sensor in Nociceptive Neurons Hawon Cho, Young Duk Yang, Jesun Lee, Byeongjoon Lee, Tahnbee Kim Yongwoo Jang,

More information