Sarcoglycanopathies: A Multiplex Molecular Analysis for the Most Common Mutations

Transcription

1 ORIGINAL ARTICLE Sarcoglycanopathies: A Multiplex Molecular Analysis for the Most Common Mutations Telma L.F. Gouveia, MS,* Julia F.O. Paim, MD, PhD,w Rita C. Pavanello, MD,* Mayana Zatz, PhD,* and Mariz Vainzof, PhD* Abstract: Sarcoglycanopathies (SGpathies) are highly frequent among severely affected limb-girdle muscular dystrophy patients. On the basis of the findings of 5 common mutations in the 4 sarcoglycan (SG) genes in the Brazilian population, we standardized a multiplex polymerase chain reaction-singlestrand conformation polymorphism methodology for their concomitant analysis in DNA samples. The test was able to confirm the diagnosis in about 63% of new patients with a suspected SGpathy and was particularly important in patients in advanced stages of the disease, when obtaining a muscle biopsy for analysis may be very difficult. As common mutations have been described in several countries, this multiplex analysis could be useful for the diagnosis of SGpathies if established according to the most prevalent mutations in each population. Besides, even though the disorder studied is rare, the technique could be broadly applicable to other genes and disorders. Key Words: sarcoglycanopathies, limb-girdle muscular dystrophies, DGC (Diagn Mol Pathol 2006;15:95 100) The limb-girdle muscular dystrophies (LGMD) include a heterogeneous group of progressive disorders mainly affecting the pelvic and shoulder girdle musculature, ranging from severe forms with onset in the first decade of life and rapid progression, to milder forms of later onset and slower progression. 1 3 Inheritance may be autosomal dominant (LGMD1) or recessive (LGMD2). During the last decade, 17 LGMD genes, 7 autosomal dominant (AD) and 10 autosomal recessive (AR), have been mapped. The AD forms are relatively rare and probably represent less than 5% of all LGMD. The 7 AD-LGMD forms are LGMD1A at 5q22, coding for the protein myotilin, 4 LGMD1B at 1q11, coding for lamin A/C, 5 LGMD1C at 3p25, coding for caveolin-3, 6,7 LGMD1D at 6q23, 8 LGMD1E at 7q, 9 LGMD1F at 5q31, 10 and LGMD1G at 4q21, recently mapped in a From the *Human Genome Research Center, Department of Biology, IBUSP, Sa o Paulo; and wrshal, Belo Horizonte, MG, Brazil. Supported by FAPESP-CEPID, PRONEX, and CNPq. Reprints: M. Vainzof, Centro de Estudos do Genoma Humano, Departamento de Biologia, IB, USP, Rua do Matão, 106, São Paulo, SP, Brazil ( mvainzof@usp.br). Copyright r 2006 by Lippincott Williams & Wilkins Brazilian family. 11 The protein products of the 10 AR forms have been identified. Among the clinically milder forms, LGMD2A, at 15q15.1, codes for calpain 3, LGMD2B, at 2p31, codes for dysferlin, and LGMD2G, at 17q11-12, codes for the sarcomeric telethonin. The fukutin-related protein gene, mapped at 19q13.3, was identified as the gene responsible for the LGMD2I form, as well as the severe form of congenital muscular dystrophy (MDC1C); the protein TRIM32 has been identified as the gene product of the LGMD2H form at 9q LGMD2J was described in the Finnish population as the result of AR mutations in the titin gene. 1 3 The more severe forms are caused by mutations in 4 genes mapped at 17q21, 4q12, 13q12, and 5q33, coding for a-sarcoglycan (a-sg), b-sg, g-sg, and d-sg, glycoproteins of the SG subcomplex of the dystrophinglycoprotein complex (DGC), respectively. 12,13 Mutations in these genes cause LGMD2D, 2E, 2C, and 2F, respectively, and constitute a distinct subgroup of LGMDs, the sarcoglycanopathies (SGpathies). 14 The DGC is a multifunctional protein complex, located at the muscle cell membrane, and is thought to provide a mechanical link between the cell cytoskeleton and the extracellular matrix. 15 The 4 SG proteins form a subcomplex of the DGC, and its components are interdependent to varying degrees. For this reason, mutations in any one of the genes encoding these 4 subunits result, in the majority of the patients, in the complete loss or marked decrease in the whole complex in muscle fibers. 1,2,16 18 Severe clinical Duchenne-like presentations tend to be more common among these patients, with onset in early childhood and confinement to a wheelchair before the age of 16 years; nevertheless, milder courses have also been described in LGMD 2C, 2D, and 2E patients. SGpathies account for about 32% of classified, Brazilian LGMD-affected patients and are responsible for 68% of the severe cases. This relative proportion, however, varies in different populations. 3,19 Many different mutations have already been identified in all the SG genes, including missense, splicing, nonsense, and small and large gene deletions (listed in Our group recently reported the spectrum of mutations in 35 Brazilian SGpathy families, and the most common ones were c.229c>t in exon 3 of a-sg gene, missense mutations in exons 3 and 4 of b-sg, c.521delt in exon 6 of g-sg, and c.656delc in exon 8 Diagn Mol Pathol Volume 15, Number 2, June

2 Gouveia et al Diagn Mol Pathol Volume 15, Number 2, June 2006 of d-sg gene, corresponding to 78%, 75%, 100%, and 80% of the disease alleles of the respective LGMD forms. 20 Screening for mutations in these 5 exons might therefore represent a good diagnostic test. Therefore, we standardized a methodology for the concomitant analysis of these most common mutations in the Brazilian population. To test the efficiency of this method, we tested a sample of patients classified as SGpathies, both through protein analysis in the muscle, or with a very severe clinical phenotype of LGMD. We were able to confirm the diagnosis at the molecular level in about 63% of the patients with a suspected SGpathy, which suggests that such a multiplex analysis may be useful if established according to the most prevalent mutations in different populations. MATERIALS AND METHODS Patients A total of 19 families ascertained in 2 independent centers were analyzed. The first group, ascertained in the Human Genome Research Center in Sa o Paulo, was composed of 12 patients with clinical and laboratorial findings, and/or a family history compatible with the diagnosis of LGMD2, according to Bushby and Beckmann. 21 Among them, 6 were diagnosed as having a primary SGpathy defect by immunohistochemical analysis showing a deficient pattern of these proteins in the muscle, and 6 patients were suspected only on the basis of clinical findings, because no muscle biopsy was available for SG analyses. The second group, composed of 9 patients, was selected as candidate for SGpathies on the basis of clinical studies and SG immunohistochemical analysis of muscle samples in the Sarah Kubitcheck Hospital, Belo Horizonte, Brazil. Among the 19 patients studied, 13 were diagnosed on the basis of SG protein analysis in muscle biopsy, and 6 were diagnosed only on the basis of clinical evidences. Clinically, the patients were classified as severe, intermediate, and mild, according to their walking ability, age of onset, and progression of disease. A patient was considered mild if he could still walk beyond the age of 16 years. Severe Duchenne-like MD or severe childhood autosomal recessive MD were diagnosed if symptoms began before the age of 10 years and patients were wheelchair bound before the age of 16 years. Protein Analysis in Muscle Biopsies Muscle samples were obtained through open biceps biopsies, under local anesthesia, frozen in liquid nitrogen immediately after removal, and stored at 701C until use. Muscle sections 5 to 6 mm thick were cut in a cryostat microtome and mounted in slides coated with polylysine. Slides were allowed to air dry at room temperature for 1 hour. The analysis of the presence and distribution of the 4 SG proteins was carried out through single or double immunofluorescence (IF) staining of frozen sections. 22 Antibodies against the 4 SGs were developed by Louise V.B. Anderson, from Newcastle (UK), and are commercially available in Novocastra (Newcastle, UK). Double labeling reactions were performed with mouse monoclonal anti-a-sg antibody Ad1/20A6 (kindly provided by Dr L.V.B. Anderson) and rabbit polyclonal antidystrophin antibody (kindly provided by Dr Jeff Chamberlain). Subsequent IF analysis for b-sg, g-sg, and d-sg was carried out, using the respective antibodies. IF pattern was classified from totally positive (++++), if all fibers were equally stained, up to totally negative ( ), if no staining was detected at all. Mutation Analysis Blood samples were obtained from patients and normal controls, and, when possible, from their parents and sibs. DNA was extracted according to Miller et al. 23 DNA samples from patients carrying mutations previously characterized were used as positive controls. Primer sequences used in the multiplex polymerase chain reaction (PCR) are available at Leiden Muscular Dystrophy Pages ( The following exons from the 4 SG genes were amplified concomitantly (Table 1). PCR Conditions DNA fragments were amplified through PCR, modified and adapted to amplify the 5 exons simultaneously in the same reaction. PCR was performed using 100 ng of genomic DNA, 30 mm of each primer of exon 3 of a-sg and 20 mm for the other primers, 2.5 mm deoxy-5 0 -nucleotide triphosphate (dntp), 20 mm Tris-HCl (ph 8.0), 0.1 mm KCl, and 2 mm/ml Taq DNA polymerase (Invitrogen), in a final reaction volume of 50 ml. To improve the efficiency of this method, we tested several concentrations of MgCl 2, using 1.5 to 2.0 mm, but the best concentration was 1.65 mm MgCl 2. TABLE 1. SG Genes Localization, Common Mutations, and Used Primers a-sg (LGMD2D) b-sg (LGMD2E) b-sg (LGMD2E) c-sg (LGMD2C) d-sg (LGMD2F) Locus 17q21 4q12 4q12 13q12 5q Mutation 229C>T (exon 3) Exon 3 Exon 4 521delT (exon 6) 656delC (exon 8) Product length 239 pb 312 pb 350 pb 198 pb 270 pb Primer F: gggctcctgctgactcga F: tggtgataatattttctacttgttttcc F: attgttcaggaattttgtttgcag tcttc F: ggtgtcacttattttacttctgc F: ccttgagcatgaacttccttttgta R: atggcccacccctgtgatttt R: gcccctctcctgtttgcatttctttc R: attctctcccattagtaaaacaaa gcc R: ctaacattattccagcacatacc R: tggcctgttgaagctgtagctct 96 r 2006 Lippincott Williams & Wilkins

3 Diagn Mol Pathol Volume 15, Number 2, June 2006 Sarcoglycanopathies: A Multiplex Molecular Analysis Different temperatures of annealing were also tested together with MgCl 2 concentrations, combining different temperatures (55 to 601C) and quantities of MgCl 2 to allow the amplification of the 5 fragments with good performance and high specificity. Amplification was carried out in a Perkin-Elmer thermocycler (Applied Biosystems) as follows: 941C for 5 minutes to initially denature the DNA strands, followed by 35 cycles of 941C for 1 minute, annealing of 581C for 1 minute, 721C for 1 minute and final extension for 7 minutes at 721C. Detection of Mutations Mutation detection was performed through singlestrand conformation polymorphism (SSCP) analysis 24 through electrophoresis on MDE 0.5 gel (FMC Bioproducts), with the addition of 2.5% of glycerol and Tris-EDTA Buffer (TBE) buffer diluted at 0.6. The running conditions were standardized using different tension and times and the final setting was carried out as follows: 15 W for 1 hour and 8 W for 16 hours at 181C. The gel was revealed with silver staining, according to Bassam et al. 25 In each experiment, and for the establishment of the methodology, DNA from at least 1 patient carrying the studied mutation was included as positive control. To confirm the altered pattern of bands, we used automated sequencing of both strands using the APBiotech DYEnamic ET Dye Terminator Cycle Sequencing kit on a MegaBACE 1000 automated DNA sequencer (G&E Health Care). In the patients in whom only one of the mutations was detected through the multiplex methodology, screening of the whole respective gene was carried out. RESULTS The methodology was efficiently standardized, and allowed us to identify simultaneously the 5 altered amplicons, one for each of the mutated exons (responsible for the 4 SGpathies), through a unique gel, using SSCP with MDE acrylamide electrophoresis gel (Fig. 1). The test has been highly reproducible after the standardization. About 5 repeated experiments have been performed for each mutation, with the same result and resolution. b-sg gene contains a large spectrum mutation, concentrated in exons 3 and 4 that are considered hot spots. We used patients with c.272g>c in exon 3 and c.465delag in exon 4, as positive controls for the presence of the mutation. The bands corresponding to these 2 exons were first positioned at the top of the gel, followed by 2 bands in the middle of the gel, corresponding to the amplicon of d-sg. Immediately below, a unique band for a-sg was observed, and, in the lowest part of the gel, 3 bands corresponding to the g-sg amplicon were identified. According to our results, each of the known mutations was visualized in the gel as a band with a different pattern of migration (Fig. 1). The most common FIGURE 1. SSCP-MDE electrophoresis gel for the simultaneous detection of 5 exons from 4 SG genes. Lanes 1, 2, 3, 4, and 9 are positive controls for each of the studied mutations, respectively: c.521del T (g-sg), c.465delag (b-sg, exon 4), c.229c>t (a-sg), c.272g>c (b-sg exon 3), and c.656delc (d-sg). The remaining lanes are examples of studied candidate patients and (N) normal controls. mutation in the a-sg gene was identified in the homozygous and heterozygous states through this multiplex PCR-SSCP. After the standardization of the methodology, altered bands were observed in 12 among the 19 patients studied (Table 2). Subsequently, the identification of mutations was confirmed through automated sequencing of the respective amplicons. Two patients were homozygous for the c.656delc mutation in a-sg and 4 were homozygous for c.521delt in the g-sg gene. In 6 patients, the c.229c>t mutation in the a-sg gene was identified, 3 were homozygotes and 3 were heterozygotes. In the 3 heterozygous patients, screening for mutations in the whole a-sg gene identified the mutation in the second allele: c.409g>a in patient 14 (exon 5), c.665g>a (exon 6) in patient 3, and c.73c>t (exon 2) in patient 16. These two last mutations, which were not previously described, were not found in 100 normal chromosomes, thus suggesting that they can be pathogenic. r 2006 Lippincott Williams & Wilkins 97

4 Gouveia et al Diagn Mol Pathol Volume 15, Number 2, June 2006 TABLE 2. Clinical and Molecular Data of the New Studied Patients Immunohistochemical Analysis No. Age Clinical Classification a b c d Dystrophin Gene Mutation 1 9 I +/ +/ +/ ++++ a-sg c.229c>t/c.229c>t 2 13 M Referred as deficient a-sg c.229c>t/c.229c>t 3 9 I a-sg c.229c>t/c.665g>a 4 12 I +/ + ++ g-sg c.521delt/c.521delt 5 10 S (wc) n.d. n.d. +++ g-sg c.521delt/c.521delt 6 29 I (wc) g-sg c.521delt/c.521delt 7 9 S (wc) ++++ g -SG c.521delt/c.521delt 8 42 M / ++++ d-sg c.656delc/c.656delc 9 12 I (wc) n.d. n.d. +++ d-sg c.656delc/c.656delc 10 6 S (wc) +/ n.d. +/ n.d. +/ Not detected S +/ n.d. +/ n.d Not detected 12 7 S n.d Not detected S (wc) Referred as deficient Not detected S (wc) No muscle for analysis a-sg c.229c>t/c.409g>a I (wc) a-sg c.229c>t/c.229c>t I a-sg c.229 C>T/c.73C>T I (wc) Not detected S (wc) Not detected I (wc) Not detected No mutations in exons 3 and 4 of the b-sg gene were found in any of the patients studied here. The results showed that the multiplex PCR-SSCP test allowed one to identify 9/13 (70%) patients with SG deficiency in muscle, and 3/6 (50%) patients with clinical diagnosis of SGpathy, but with no muscle available for analysis (Table 2). Protein analyses were performed in 13 patients. Two of them were referred to our center with the muscle protein s histopathological diagnosis already completed in other laboratories (patients 2 and 13), and detailed analysis could not be repeated. In 6 patients, muscle biopsy was available for studying the 4 SG proteins, whereas in the remaining 5, the muscle sample available allowed the analysis of 2 of the SG proteins. In 9 patients, the whole SG complex was highly deficient, whereas in 2 patients only 1 of the 4 SGs was deficient. Interestingly, in 1 LGMD2D patient (#3), a compound heterozygous for the c.229c>t/c.665g>a mutations in a-sg gene, showed total deficiency of all SG proteins associated to some neurogenic features, such as groups of small atrophic fibers, on the histopathological analysis of the muscle (Fig. 2). DISCUSSION The Multiplex Test Several attempts to improve the differential diagnosis of LGMDs have been made, which is not easy because of the great clinical and genetic heterogeneity of this disease. A multiplex system of Western blot analysis, in which many of the known MD associated proteins could be analyzed simultaneously has been developed. 26 However, in patients with all SG proteins deficient in the muscle, this methodology did not allow one to pinpoint the primary SG defect. In this respect, our multiplex PCR-SSCP test permits us to identify the causative mutation in candidate patients whose clinical course is compatible with SGpathy. Additionally, finding some prevalent mutations in the Brazilian population allowed us to achieve a significant improvement in the efficiency and cost of this type of DNA screening. In a study of 19 new patients, this methodology was able to confirm the diagnosis in 63% of candidate SGpathy patients, and was particularly important in patients with a severe phenotype when no muscle is available for analysis. The 4 subtypes of the SGpathies are well represented in Brazil. Probably, relative equilibrium/balance among the different forms in Brazil may be attributed to the high degree of miscegenation of our population. 20 In Europe and North America the great majority of patients who are deficient in SG proteins are affected by LGMD2D, and the majority carry the common c.229c>t in exon 3 of a-sg gene LGMD 2C corresponds to almost 100% of the SGpathies in Northern Africa, all patients with the same c.521delt mutation in exon 6 of g-sg gene. 30 LGMD 2E and 2F are more rare all over the world and additional studies in different countries are necessary to estimate the frequency and type of mutations in each population. 27,31,32 Our results here suggest that the multiplex analysis may be useful if established according to the most prevalent mutations in different populations. Identification of Heterozygous Individuals In addition to the homozygous mutations, the test was able to identify mutation in the heterozygote state. This was useful for selecting affected patients for analysis in the entire gene, searching for compound heterozygote individuals. In fact, in 3 identified heterozygote patients for the mutation c.229c>t in the a-sg gene, further analysis of the whole gene allowed one to find the second mutation. Two of them are being described for the first time. The c.665g>a mutation is located in exon 6, 98 r 2006 Lippincott Williams & Wilkins

5 Diagn Mol Pathol Volume 15, Number 2, June 2006 Sarcoglycanopathies: A Multiplex Molecular Analysis FIGURE 2. Histological (HE), histochemical (ATPase 4.3), and immunohistochemical analysis for dystrophin and the 4 SG proteins in patient 3, showing some neurogenic features such as a group of small atrophic fibers. Magnification 200. which is responsible for coding the extracellular domain of a-sg protein, and the mutation c.73c>t in exon 2 creates a premature stop codon, resulting in a truncated protein. Protein analysis was possible in only 1 of these patients and confirmed the total deficiency of a-sg, associated with the reduction of the whole complex in the muscle. Additionally, the finding of some neurogenic features, such as groups of small atrophic fibers in 1 of the patients, suggests that, as already observed in several forms of MDs, mainly lgmd2a, 33,34 in SGpathies the degeneration pattern can also be associated with some neurogenic involvement. Protein Analysis in Muscle Biopsies In the majority of patients with SGpathy, primary loss or deficiency of any of the 4 SGs in the muscle (b-sg and d-sg in particular) leads to a secondary deficiency of the whole subcomplex. 1,2,16 19 In fact, the majority of the patients analyzed here showed complementary deficiencies of 1 or more proteins of the SG complex, and primary SGpathy was confirmed through our DNA multiplex test. On the other hand, no mutations were identified in 4 among 13 patients with protein deficiency in the muscle. This suggests that these patients can be candidate for different mutations in any of the 4 SG genes. CONCLUSIONS About 70% of new patients with immunohistochemical diagnosis of severe LGMD were molecularly diagnosed with a unique and fast test. As obtaining a muscle biopsy in patients in advanced stages may be very difficult, the present multiplex DNA test for the concomitant screening for the most common mutation in 5 exons from the SG genes allows one to confirm the diagnosis in about 50% of patients with a clinical course compatible with SGpathy, but with no muscle available for analysis. As common mutations have been described in several countries, this multiplex analysis could be very useful for diagnosis if established according to the most prevalent mutations in each population. Besides, even though the disorder studied is rare, the technique could be broadly applicable to other genes and disorders. ACKNOWLEDGMENTS The collaboration of the following persons is gratefully acknowledged: Dr Maria Rita Passos-Bueno, Dr Eloisa S. Moreira, Dr Ivo Pavanello, Dr Acary S.B. Oliveira, Dr Edmar Zanotelli, Dr Helga Silva, Dr Lydia U. Yamamoto, Dra Andrea Bernardino, Dra Alessandra Splendore, Dra Alessandra Starling, Luciana Luchesi, Viviane P. Muniz, Bruno Lima, Cleber C. Costa, and Patricia Kossugue. We would also like to thank the following researchers, who kindly provided specific antibodies: L.V.B. Anderson, J. Chamberlain, L.M. Kunkel, C. Bonnemann, E.E McNally, V. Nigro, G. Faulkner, G. Valle, and K. Campbell. r 2006 Lippincott Williams & Wilkins 99

6 Gouveia et al Diagn Mol Pathol Volume 15, Number 2, June 2006 REFERENCES 1. Bushby KMD. The limb-girdle muscular dystrophies-multiple genes, multiple mechanisms. Hum Mol Gen. 1999;8: Zatz M, Vainzof M, Passos-Bueno MR. Limb-girdle muscular dystrophy: one gene with different phenotypes* one phenotype with different genes. Curr Opin Neurol. 2000;13: ; review. 3. Zatz M, de Paula F, Starling A, et al. The 10 autosomal recessive limb-girdle muscular dystrophies. Neuromuscul Disord. 2003;13: ; review. 4. Hauser MA, Horrigan SK, Salmikangas P, et al. A mutation in the Myotilin gene causes limb-girdle muscular dystrophy 1A. Hum Mol Gen. 2000;9: Van der Kooi A, Van Meegen M, Ledderhof TM, et al. Genetic localization of a newly recognized autosomal dominant limb-girdle muscular dystrophy with cardiac involvement (LGMD1B) to chromosome 1q Am J Hum Gen. 1997;60: Minetti C, Sotgia F, Bruno C, et al. Mutations in the caveolin-3 gene cause autosomal dominant limb-girdle muscular dystrophy. Nat Genet. 1998;18: McNally EM, de Sa Moreira E, Duggan DJ, et al. Caveolin-3 in muscular dystrophy. Hum Mol Gen. 1998;7: Messina DI, Speer MC, Pericak-Vance MA, et al. Linkage of familial dilated cardiomyopathy with conduction defect and muscular dystrophy to chromosome 6q23. Am J Hum Gen. 1997;61: Speer MC, Vance JM, Grubber JM, et al. Identification of a new autosomal dominant limb-girdle muscular dystrophy locus on chromosome 7. Am J Hum Gen. 1999;64: Feit H, Silbergleit A, Schneider LB, et al. Vocal cord and pharyngeal weakness with autosomal dominant distal myopathy: clinical description and gene localization to 5q31. Am J Hum Gen. 1998;63: Starling A, Kok F, Passos-Bueno MR, et al. A new form of autosomal dominant limb-girdle muscular dystrophy (LGMD1G) with progressive fingers and toes flexion limitation maps to chromosome 4p21. Eur J Hum Genet. 2004;12: Ervasti JM, Ohlendieck K, Kahl SD, et al. Deficiency of a glycoprotein component of the dystrophin complex in dystrophic muscle. Nature. 1990;345: Yoshida M, Ozawa E. Glycoprotein complex anchoring dystrophin to sarcolemma. J Biochem. 1990;108: Matsumura K, Tome FM, Collin H, et al. Deficiency of the 50 K dystrophin-associated glycoprotein in severe childhood autosomal recessive muscular dystrophy. Nature. 1992;359: Campbell KP, Kahl SD. Association of dystrophin and an integral membrane glycoprotein. Nature 1989;338: Vainzof M, Passos-Bueno MR, Canovas M, et al. The sarcoglycan complex in the six recessive limb-girdle muscular dystrophies. Hum Mol Gen. 1996;5: Bonnemann CG. Limb-girdle muscular dystrophies: an overview. J Child Neurol. 1999;14: Hack AA, Groh M, McNally E. Sarcoglycans in muscular dystrophy. Micr Res Tech. 2000;48: Vainzof M, Passos-Bueno MR, Pavanello RCM, et al. Sarcoglycanopathies are responsible for 68% of severe autossomal recessive limb-girdle muscular dystrophy in the Brazilian population. J Neurol Sci. 1999;164: Moreira ES, Vainzof M, Suzuki OT, et al. Genotype phenotype correlation in 35 Brazilian families with sarcoglycanopathies including the description of three novel mutations. J Med Gen. 2003;40:e Bushby KMD, Beckmann JS. Diagnostic criteria for the limb-girdle muscular dystrophies: report of the ENMC workshop on limb-girdle muscular dystrophies. Neuromusc Disord. 1995;5: Vainzof M, Zubrzycka-Gaan EE, Rapaport D, et al. Immunofluorescence dystrophin study in Duchenne dystrophy through the concomitant use of two antibodies directed against the carboxyterminal and the amino-terminal region of the protein. J Neurol Sci. 1991;101: Miller SA, Dykes DD, Polesky HF. A Yesple salting out procedure for extracting DNA from human cells. Nucleic Acids Res. 1988;16: Orita M, Iwahana H, Kanazawa H, et al. Detection of polymorphisms of human DNA by gel electrophoresis as a single-strand conformation polymorphisms. Proc Natl Acad Sci USA. 1989;86: Bassam BJ, Caetano-Anoles G, Gresshoff PM. Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal Biochem. 1991; 196: Anderson LVB, Davison K. Multiplex western blotting system for the analysis of muscular dystrophy proteins. Am J Pathol. 1999;154: Fanin M, Duggan DJ, Mostacciuolo ML, et al. Genetic epidemiology of muscular dystrophies resulting from sarcoglycan gene mutations. J Med Genet. 1997;34: Duggan DJ, Manchester D, Stears KP, et al. Mutations in the deltasarcoglycan gene are a rare cause of autosomal recessive limb-girdle muscular dystrophy (LGMD2). Neurogenetics. 1997;1: Angelini C, Fanin M, Freda MP, et al. The clinical spectrum of sarcoglycanopathies. Neurology. 1999;52: Othmane KB, Speer M, Stauffer J, et al. Evidence for linkage disequilibrium in chromosome 13-linked Duchenne-like muscular dystrophy (LGMD2C). Am J Hum Gen. 1995;57: Bueno MR, Moreira ES, Vainzof M, et al. A common missense mutation in the adhalin gene in three unrelated Brazilian families with a relatively mild form of autosomal recessive limb-girdle muscular dystrophy. Hum Mol Genet. 1995;4: Duggan DJ, Gorospe JR, Fanin M, et al. Mutations in the sarcoglycan genes in patients with myopathy. N Engl J Med. 1997; 336: Melki J. Spinal muscular atrophy: neuromuscular disorders. In: Alan EH, ed. Clinical and Molecular Genetics Emery. New York: John Wiley & Sons; 1998: Starling A, de Paula F, Silva H, et al. Calpainopathy. How broad is the spectrum of clinical variability? J Mol Neurosci. 2003;21: r 2006 Lippincott Williams & Wilkins