The New England Journal of Medicine MUTATIONS IN THE SARCOGLYCAN GENES IN PATIENTS WITH MYOPATHY

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "The New England Journal of Medicine MUTATIONS IN THE SARCOGLYCAN GENES IN PATIENTS WITH MYOPATHY"

Transcription

1 MUTATIONS IN THE SARCOGLYCAN GENES IN PATIENTS WITH MYOPATHY DAVID J. DUGGAN, B.S., J. RAFAEL GOROSPE, M.D., PH.D., MARINA FANIN, M.S., ERIC P. HOFFMAN, PH.D., A CORRADO ANGELINI, M.D. ABSTRACT Background Some patients with autosomal recessive limb-girdle muscular dystrophy have mutations in the genes coding for the sarcoglycan proteins (a-, b-, g-, and d-sarcoglycan). To determine the frequency of sarcoglycan-gene mutations and the relation between the clinical features and genotype, we studied several hundred patients with myopathy. Methods Antibody against a-sarcoglycan was used to stain muscle-biopsy specimens from 556 patients with myopathy and normal dystrophin genes (the gene frequently deleted in X-linked muscular dystrophy). Patients whose biopsy specimens showed a deficiency of a-sarcoglycan on immunostaining were studied for mutations of the a-, b-, and g-sarcoglycan genes with reverse transcription of muscle RNA, analysis involving single-strand conformation polymorphisms, and sequencing. Results Levels of a-sarcoglycan were found to be decreased on immunostaining of muscle-biopsy specimens from 54 of the 556 patients (10 percent); in 25 of these patients no a-sarcoglycan was detected. Screening for sarcoglycan-gene mutations in 50 of the 54 patients revealed mutations in 29 patients (58 percent): 17 (34 percent) had mutations in the a-sarcoglycan gene, 8 (16 percent) in the b-sarcoglycan gene, and 4 (8 percent) in the g-sarcoglycan gene. No mutations were found in 21 patients (42 percent). The prevalence of sarcoglycan-gene mutations was highest among patients with severe (Duchenne-like) muscular dystrophy that began in childhood (18 of 83 patients, or 22 percent); the prevalence among patients with proximal (limb-girdle) muscular dystrophy with a later onset was 6 percent (11 of 180 patients). Conclusions Defects in the genes coding for the sarcoglycan proteins are limited to patients with Duchenne-like and limb-girdle muscular dystrophy with normal dystrophin and occur in 11 percent of such patients. (N Engl J Med 1997;336: ) 1997, Massachusetts Medical Society. MUSCLE diseases (myopathies) are most often caused by inborn errors resulting in the degeneration of muscle fibers (muscular dystrophies). The muscular dystrophies are a clinically and genetically heterogeneous group of disorders. Clinically, many of the muscular dystrophies present with proximallimb muscle weakness or wasting and elevated serum creatine kinase concentrations. Genetically, the pattern of inheritance can be X-linked recessive (as in Duchenne s or Becker s muscular dystrophy), autosomal dominant (as in limb-girdle muscular dystrophy type 1), or autosomal recessive (as in limbgirdle muscular dystrophy type 2). Recently, many of these phenotypically similar, yet genetically distinct, disorders have been shown to be caused by abnormalities of the plasma membrane of muscle fibers. This membrane contains an extensive cytoskeleton that stabilizes the myofibrillar membrane during contraction. Part of this cytoskeleton appears to be responsible for attaching intracellular actin to the extracellular basal lamina by means of dystrophin (Fig. 1). 1-3 Abnormalities of dystrophin are a common cause of muscular dystrophy, 4,5 and testing for the dystrophin gene or protein has become part of the routine diagnostic evaluation of patients who present with progressive proximal muscle weakness, high serum creatine kinase concentrations, and histopathological evidence of a dystrophic process. Patients who have no dystrophin abnormalities are assumed to have an autosomal recessive muscular dystrophy; most cases are isolated, and large families with multiple affected patients are uncommon. In addition to dystrophin, other proteins, often referred to as dystrophin-associated proteins, contribute to the membrane cytoskeleton of myofibers. These proteins are divided into the dystroglycan, sarcoglycan, and syntrophin subcomplexes (Fig. 1). 3,6 Recently, genetic defects of the sarcoglycan complex (sarcoglycanopathies) were found in some patients with autosomal recessive muscular dystrophy The genes and proteins corresponding to these genetic From the Departments of Human Genetics, Molecular Genetics and Biochemistry, Pediatrics, and Neurology, University of Pittsburgh, Pittsburgh (D.J.D., J.R.G., E.P.H.); and the Regional Neuromuscular Center, Department of Neurology, University of Padua, Padua, Italy (M.F., C.A.). Address reprint requests to Dr. Hoffman at Biomedical Science Tower W1211, Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, Pittsburgh, PA Other authors were E. Pegoraro (University of Pittsburgh, Pittsburgh), S. Noguchi and E. Ozawa (National Center of Neurology and Psychiatry, Tokyo, Japan), W. Pendlebury (University of Vermont, Burlington), A.J. Waclawik (University of Wisconsin Madison Medical School, Madison), D.A. Duenas (Miami Children s Hospital, Miami), I. Hausmanowa- Petrusewicz and A. Fidzianska (Polish Academy of Sciences, Warsaw, Poland), S.C. Bean (Medical Center of Delaware, Newark), J.S. Haller (Albany Medical Center, Albany, N.Y.), J. Bodensteiner (Robert C. Byrd Health Sciences Center, Morgantown, W.V.), C.M. Greco (California Pacific Medical Center, San Francisco), A. Pestronk (Washington University, St. Louis), A. Berardinelli (Neurological Institute C.M. Mondino, Pavia, Italy), D.F. Gelinas (California Pacific Medical Center, San Francisco), H. Abram (Nemours Children s Clinic, Jacksonville, Fla.), and R.W. Kuncl (Johns Hopkins University, Baltimore). 618 February 27, 1997

2 MUTATIONS IN THE SARCOGLYCAN GENES IN PATIENTS WITH MYOPATHY Extracellular Merosin Sarcoglycans a b g d a b Dystroglycans Plasma membrane Dystrophin Intracellular Syntrophin Actin Figure 1. Organization of the Plasma-Membrane Dystrophin Cytoskeleton of Myofibers. Dystrophin is part of a large oligomeric complex tightly associated with several other protein complexes. The dystroglycan complex consists of a-dystroglycan, which associates with the basal-lamina protein merosin, and b-dystroglycan, which binds a-dystroglycan and dystrophin. Syntrophin binds to the distal C-terminal region of dystrophin. The sarcoglycan complex consists of four transmembrane proteins: a-, b-, g-, and d-sarcoglycan. The function of the sarcoglycan complex and the nature of the interactions within the complex and between it and the other complexes are not clear. The sarcoglycan complex is formed only in striated muscle, and its subunits preferentially associate with each other, suggesting that the complex may function as a single unit. defects are a-sarcoglycan, 7 b-sarcoglycan, 9,10 g-sarcoglycan, 8 and d-sarcoglycan. 20 Each of these sarcoglycans is a relatively small transmembrane protein expressed either only (a, g, and d) or predominantly (b) in striated muscle (skeletal and cardiac). 7-10,20-23 No patients with primary defects of the other dystrophin-associated proteins (dystroglycans and syntrophins) have been identified; however, the expression of these proteins is not limited to striated muscle. 24,25 Studies with antibodies directed against a-, b-, g-, and d-sarcoglycan have revealed deficiencies of all components of the sarcoglycan complex in musclebiopsy specimens from patients with mutations in any of the sarcoglycan genes. 8-10,17,20 Apparently, mutations in a single sarcoglycan gene lead to destabilization of the entire complex and secondary deficiency of the other sarcoglycan proteins. Thus, a genetic defect of any component of the protein complex should be detectable with antibody against any of the sarcoglycan proteins. 26 Because biopsy specimens from patients with dystrophin-gene abnormalities reveal secondary deficiencies of the sarcoglycans, 27,28 testing for sarcoglycan proteins is informative only if dystrophin is normal. Thus, testing of biopsy specimens from patients with normal dystrophin with antibody directed against a-sarcoglycan should identify most or all patients with mutations of the a-, b-, g-, and d-sarcoglycan genes. We used both biochemical and molecular approaches to screen for abnormalities and genetic defects in the sarcoglycan proteins in patients with myopathy. Selection of Patients METHODS We selected muscle-biopsy specimens for a-sarcoglycan immunostaining from patients with myopathy whose records and biopsy specimens were available at the University of Padua (322 patients) and University of Pittsburgh (234 patients) and who had normal dystrophin on the basis of immunofluorescence or immunoblot analysis and histopathological evidence of myopathy. The Italian patients were from northeastern Italy and were examined in Padua by a single team. The patients whose biopsy specimens were studied in Pittsburgh were examined in neuromuscular clinics throughout the United States with a standard clinical-assessment protocol (manual muscle testing and muscle biopsy). The Italian patients (or their parents) provided written informed consent. The studies done in Pittsburgh were approved by the institutional review Volume 336 Number 9 619

3 TABLE 1. CLINICAL DIAGNOSIS, RESULTS OF IMMUNOSTAINING FOR a-sarcoglycan, A FREQUENCY OF SARCOGLYCAN-GENE MUTATIONS IN 556 PATIENTS WITH MYOPATHY. CLINICAL DIAGNOSIS IMMUNOSTAINING RESULTS TYPE OF SARCOGLYCAN-GENE MUTATION NO. OF PATIENTS COMPLETE DEFICIENCY PARTIAL DEFICIENCY a b g NONE NOT TESTED no. of patients (%) Congenital muscular dystrophy Dystrophinopathy-like disorder Duchenne-like muscular dystrophy Limb-girdle muscular dystrophy *Other neuromuscular disorders included inflammatory myopathy (9 patients), metabolic myopathy (9), congenital structural myopathy (10), myoglobinuria (14), distal myopathy (2), congenital hypotonia (2), familial myopathy with high serum creatine kinase concentrations (5), isolated high serum creatine kinase concentrations (23), isolated myopathy with high serum creatine kinase concentrations or cramps (40), and other muscular dystrophies (78). In the case of 32 patients, inadequate clinical information was available for precise classification of the disorder (10) 9 (5) 8 (10) 2 (2) 2 (1) 11 (13) 9 (5) Other neuromuscular disorders* 224 Total board, but did not require informed consent because the biopsy specimens were preexisting pathological specimens obtained for diagnostic purposes (to rule out a dystrophin abnormality). The patients were divided into three groups on the basis of a clinical examination (Padua) or clinical summaries (Pittsburgh): those with congenital muscular dystrophy, those with a dystrophinopathy-like disorder, and those with other neuromuscular disorders (Table 1). Congenital muscular dystrophy was defined as the presence of weakness or hypotonia at birth, contractures before six months of age, and dystrophy on muscle biopsy. This category included patients with and those without central nervous system involvement. A dystrophinopathy-like disorder was defined on the basis of the presence of progressive proximal muscle weakness beginning after six months of age, high serum creatine kinase concentrations, and dystrophy on muscle biopsy. Other neuromuscular disorders were defined on the basis of findings of muscle weakness or wasting, hypotonia, calf hypertrophy, or high serum creatine kinase concentrations and included the following diagnoses: inflammatory myopathy (9 patients), metabolic myopathy (9), congenital structural myopathy (10), myoglobinuria (14), distal myopathy (2), congenital hypotonia (2), familial myopathy with high serum creatine kinase concentrations (5), isolated high serum creatine kinase concentrations (23), isolated myopathy with high serum creatine kinase concentrations or cramps (40), and other muscular dystrophies (78). An additional 32 patients from the Pittsburgh referral center had inadequate clinical information for precise classification of the neuromuscular disorder. All the patients in the group with other neuromuscular disorders had normal results of a-sarcoglycan immunostaining. The patients with a dystrophinopathy-like disorder were subdivided on the basis of their age at presentation into those with Duchenne-like muscular dystrophy (also known as severe childhood autosomal recessive muscular dystrophy) if they presented at or before the age of 10 years and those with limb-girdle muscular dystrophy (similar to Becker s muscular dystrophy) if they presented after 10 years of age. All patients with Duchenne-like muscular dystrophy had Gowers sign (rising from the floor by pushing one s hands against the shins, knees, and then thighs) before losing the ability to walk, and all patients with either type of muscular dystrophy had high serum creatine kinase concentrations. Biochemical Analysis Frozen sections (4 to 6 mm) of muscle obtained by biopsy were stained with a-sarcoglycan antibody (NCL-50DAG, Novocastra Laboratories, Newcastle, United Kingdom) as previously described. 15 The sections were scored as being completely or partially deficient in a-sarcoglycan relative to results in muscle tissue obtained and processed in parallel from subjects with no histologic evidence of muscle disease, as previously described. 15 The identification of partial deficiencies of a-sarcoglycan was subjective, but interobserver reliability was increased by the use of only two observers for all biopsy specimens (one each in Padua and Pittsburgh), who were unaware of the clinical diagnosis. Molecular Analyses RNA Extraction and Reverse Transcription Total RNA was isolated from the muscle-biopsy specimens of patients with decreased or no a-sarcoglycan staining and reverse transcribed as previously described. 15 Polymerase Chain Reaction Overlapping polymerase-chain-reaction (PCR) products for the complete coding sequences of complementary DNA for the a-, b-, and g-sarcoglycan genes were generated. The a-sarcoglycan PCR products, primers, and conditions have been described previously. 14,15 The b-sarcoglycan PCR products were generated with two primer pairs in addition to those previously described 9 : primer pairs 5 (nucleotides 40 to 267; 5 ACAGTCGGGCG- GGGAGCT3 and 5 CACGGCCCAAATAACAAGTG3 ) and 6 (nucleotides 773 to 982; 5 ATGGATCTGTATGGTCAGC3 and 5 CATGTTGGTGACCTCTGGG3 ), designed on the basis of the b-sarcoglycan messenger RNA sequence 9 with use of the Primer program (Daly MJ, et al.: unpublished data). PCR conditions were as described previously, 9,15 except that an annealing temperature of 60 C and 5 percent dimethylsulfoxide were used for primer pair 5. The g-sarcoglycan PCR products, primers, and conditions have been described previously. 8,17 Analysis Involving Single-Strand Conformation Polymorphisms Radiolabeled PCR product was mixed with an equal volume of stop solution, and the samples were denatured and analyzed with three single-strand conformation polymorphism (SSCP) gels as described previously. 15,29 DNA Sequencing Bands showing an electrophoretic shift in mobility on the basis of SSCP analysis were directly sequenced with the original PCR 620 February 27, 1997

4 MUTATIONS IN THE SARCOGLYCAN GENES IN PATIENTS WITH MYOPATHY primers and the prism Ready Reaction Dyedeoxy Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, Calif.) according to the manufacturer s recommendations. 15 Confirmation of Nucleotide Changes Nucleotide changes and an autosomal recessive pattern of inheritance were confirmed in the genomic DNA of the patients and their parents with exon-specific PCR primers. 18,19 When the identified sequence variant destroyed or created a restriction-enzyme site, the appropriate PCR product was digested with a specific restriction endonuclease. When the identified sequence variant did not change a restriction-enzyme site, amplification-refractory mutation tests were designed. 30 Insertions, duplications, and deletions were analyzed by size fractionation with denaturing polyacrylamide-gel electrophoresis. DNA Analysis Genomic DNA was isolated from peripheral-blood lymphocytes of the patients and their parents or the patients musclebiopsy specimens as described previously. 31,32 Approximately 100 ng of DNA was used for PCR amplification. RESULTS Muscle-biopsy specimens from 556 patients with myopathy and normal dystrophin were available for immunostaining for a-sarcoglycan (Fig. 2). The clinical classifications of these patients and the staining results are shown in Table 1. Deficiency of a-sarcoglycan was evident in biopsy specimens from 54 patients (10 percent). The deficiency was complete in 25 patients (4.5 percent) and partial in 29 patients (5.2 percent). Fifty-two of the 54 patients with a-sarcoglycan deficiency had clinical manifestations of either Duchenne-like or limb-girdle muscular dystrophy (a dystrophinopathy-like disorder). Two of the 69 patients with congenital muscular dystrophy had a partial deficiency of a-sarcoglycan. The prevalence of a-sarcoglycan deficiency in the three groups of patients was similar in the Italian and American patients. RNA was isolated from the muscle-biopsy specimens of 50 of the 54 patients with abnormal a-sarcoglycan immunostaining and screened for mutations in the a-, b-, and g-sarcoglycan genes. Mutations were detected in 29 (58 percent) of the patients (Tables 1, 2, and 3): 18 of 29 patients with Duchenne-like muscular dystrophy (62 percent) and 11 of 19 patients with limb-girdle muscular dystrophy (58 percent). The homozygous or compound heterozygous status of the 25 patients who had mutations of both sarcoglycan-gene alleles was confirmed by tests on genomic DNA from all the patients and, when available, both their parents (17 of 25 patients); in each case their parents were heterozygous for one of the two identified mutant alleles. In four patients (Patients 6, 18, 39, and 40), only one mutant allele was identified. In Patient 6, only mutant RNA (T371C) was present in the musclebiopsy specimen, whereas analysis of genomic DNA revealed the patient to be heterozygous (one wildtype and one mutant allele) at this nucleotide posi- A B Figure 2. a-sarcoglycan Immunostaining of Muscle. Transverse sections of muscle-biopsy specimens were stained with an antibody directed against a-sarcoglycan plus a Cy-3 conjugated antibody. Muscle from a normal subject shows uniform staining of the periphery of each muscle fiber (Panel A, 70). Muscle from Patient 7 shows a marked reduction in the intensity and uniformity of staining (Panel B, 70). TABLE 2. SARCOGLYCAN-GENE MUTATIONS IDENTIFIED IN 50 PATIENTS WITH a-sarcoglycan DEFICIENCY.* IMMUNOSTAINING RESULT NO. OF PATIENTS TYPE OF SARCOGLYCAN-GENE MUTATION a b g NONE no. of patients (%) Complete (58) 5 (21) 0 5 (21) deficiency Partial deficiency 26 3 (12) 3 (12) 4 (15) 16 (62) *Four of the 54 patients with a-sarcoglycan deficiency were not tested: 1 with a complete deficiency of a-sarcoglycan and limb-girdle muscular dystrophy, 2 with a partial deficiency and limb-girdle muscular dystrophy, and 1 with a partial deficiency and congenital muscular dystrophy. Volume 336 Number 9 621

5 TABLE 3. SARCOGLYCAN-GENE MUTATIONS IN THE PATIENTS WITH ABNORMAL RESULTS OF a-sarcoglycan IMMUNOSTAINING.* PATIENT NO. A TYPE OF MUTATION CLINICAL DIAGNOSIS CURRENT AGE (YR) LOSS OF ABILITY TO WALK (AGE AT TIME) TYPE OF a-sarcoglycan DEFICIENCY NUCLEOTIDE CHANGE AMINO ACID SUBSTITUTION OR OTHER CONSEQUENCE OF MUTATION Mutation in the a-sarcoglycan gene 3 LGMD 11 No C C229T 4 LGMD NA No C G101A C229T Arg34His 5 DMD-like 9 No C C229T T371C Ile124Thr 6 LGMD 9 No C T371C Ile124Thr 8 DMD-like 11 Yes (10 yr) C T472T Leu158Phe 11 DMD-like 10 No C G586A Val197Ile 12 DMD-like NA Yes (12 yr) C T308C T518C Ile103Thr Leu173Pro 21 LGMD 31 No C C292T C614A Arg98Cys Pro205His 25 LGMD 17 No P T92C C850T Leu31Pro Arg284Cys 33 LGMD 41 No P C850T Arg284Cys 39 DMD-like 15 Yes (12 yr) C C229T 40 LGMD 13 Yes (13 yr) C Duplication of Frame shift 42 DMD-like 14 No P C614A C683A Pro205His Pro228Gln 441 DMD-like 12 No C C229T A290G Asp97Gly 442 LGMD 18 No C G101A Arg34His 443 DMD-like 13 No C C229T C278T Ala93Val 510 LGMD 12 No C C229T Mutation in the b-sarcoglycan gene 2 DMD-like 8 No C C31T A( 2 exon 3)G Gln11Stop Insertion 9 DMD-like 14 Yes (11 yr) C C31G Gln11Glu 10 DMD-like 21 Yes (15 yr) C C341T Ser114Phe 18 DMD-like 13 No P G416A Gly139Stop 29 DMD-like 11 No C Duplication of Frame shift Deletion of Frame shift DMD-like 20 Yes (10 yr) P Duplication of Frame shift DMD-like 4 No C Duplication of T552G Frame shift Tyr184Stop 487 DMD-like 16 Yes (14 yr) P A544G Tyr182Ala Mutation in the g-sarcoglycan gene 7 DMD-like 12 No P Deletion of TG Frame shift at LGMD 10 No P Deletion of T Frame shift at LGMD 23 Yes (17 yr) P Deletion of TC Frame shift at DMD-like 20 Yes (14 yr) P Insertion of T at Frame shift *LGMD denotes limb-girdle muscular dystrophy, DMD-like Duchenne-like muscular dystrophy, C complete, NA not available, not determined, and P partial. The following patients have been described previously: Patient 8 (Fanin et al. 16 ); Patients 441 and 442 (Duggan et al. 15 ); Patient 43 (Bönnemann et al. 9 ); and Patients 7, 19, 26, and 44 (McNally et al. 17 ). Unless otherwise noted, patients for whom only one mutation is listed are homozygous for that mutation. The nucleotides and amino acids are numbered according to the translational reading frames deduced on the basis of data from McNally et al., 23 Bönnemann et al., 9 and Noguchi et al. 8 This patient was the product of a consanguineous union. Single-strand conformation polymorphism analysis showed an aberrant band of exon 2 that could not be sequenced. Mutations were identified with the use of genomic DNA. 622 February 27, 1997

6 MUTATIONS IN THE SARCOGLYCAN GENES IN PATIENTS WITH MYOPATHY tion. This patient probably had a second undetected mutation that prevented the expression of the wildtype allele, allowing only the mutant allele to be detected in the RNA of the muscle. Because all patients with a primary sarcoglycanopathy are assumed to have an autosomal recessive pattern of inheritance with two mutant alleles, Patients 18, 39, and 40 were presumed to have a second, unidentified mutation. One hundred normal chromosomes were examined for all novel mutations, and all tested negative. Thus, among the 50 patients with a deficiency of a-sarcoglycan on immunostaining, mutations in the a-sarcoglycan gene were detected in 17 (34 percent), mutations in the b-sarcoglycan gene were detected in 8 (16 percent), and mutations in the g-sarcoglycan gene were detected in 4 (8 percent). The mean ( SD) age at presentation or the diagnosis of myopathy in the patients with mutations in the a-sarcoglycan gene was 6 4 years; it was 3 2 and 6 4 years, respectively, in the patients with mutations in the b-sarcoglycan and g-sarcoglycan genes. All patients presented with clinical findings that included calf hypertrophy, Gowers sign, and a deficit in motor skills. The mean serum creatine kinase concentrations in the patients with mutations in the a-sarcoglycan, b-sarcoglycan, and g-sarcoglycan genes were 13, , 15,226 12,528, and 16, IU per liter, respectively (normal, 200). DISCUSSION Mutations of any component of the sarcoglycan complex result in the secondary loss of the other components of the complex. Thus, we hypothesized that we could identify patients who were likely to have mutations in the a-, b-, or g-sarcoglycan gene by immunostaining for a-sarcoglycan. Among the 556 patients with normal dystrophin whom we studied, 54 had a deficiency of a-sarcoglycan on immunostaining. Molecular studies were performed in 50 of these 54 patients and revealed that 58 percent had mutations of the a-, b-, or g-sarcoglycan gene. It is therefore clear that a mutation in these genes does not account for all cases of a-sarcoglycan deficiency, even after adjustment for the secondary deficiency of the sarcoglycan complex in Duchenne s and Becker s muscular dystrophies. Some patients with primary sarcoglycan deficiency (that involving a mutation) might have been missed by our use of a-sarcoglycan immunostaining as the initial screening test. However, the available data suggest that we should have identified most if not all patients with sarcoglycan-gene mutations using this approach Previous studies have identified two unrelated families with mutations in the b-sarcoglycan gene and four unrelated families with mutations in the g-sarcoglycan gene; all patients had a-sarcoglycan deficiency in muscle, even though this deficiency was not a criterion for the identification of the study patients. Moreover, the patients with mutations in the b- or g-sarcoglycan gene in this study all had marked reductions in the levels of these proteins on immunostaining (data not shown). We may not have detected all sarcoglycan mutations in the biopsy specimens tested, but we think that this possibility is unlikely. In autosomal recessive disorders there are mutations in both alleles of the particular gene, and if the mutation-detection strategy lacks sensitivity, then only one mutation will be detected in some patients (they will appear to be heterozygous). We found only 4 of 29 patients to be heterozygous in this study, suggesting that the sensitivity of our mutation analysis was approximately 93 percent (54 of 58 possible mutant alleles detected) and that our ability to identify patients with at least one mutant allele exceeded 99 percent. The large number of patients studied allowed us to estimate the frequencies of sarcoglycan-gene mutations in patients with myopathies and normal dystrophin (Table 1). We found a deficiency of a-sarcoglycan protein in 10 percent of patients with normal dystrophin. If we include only patients with Duchenne-like or limb-girdle muscular dystrophy in the analysis, this figure rises to 20 percent. In the patients with a-sarcoglycan deficiency on immunostaining, a complete deficiency (absence of staining) was more specific for mutations in the a-sarcoglycan gene than for mutations in the b- or g-sarcoglycan gene (Table 2). On the other hand, a partial deficiency of a-sarcoglycan on immunostaining was not specific for mutations of any one of the three genes, and the majority (61 percent) of patients with a partial deficiency had no mutations. We, like others, found that patients with a primary sarcoglycanopathy are clinically indistinguishable from those with either Duchenne s or Becker s muscular dystrophy Cognitive function was normal in all patients with sarcoglycan-gene mutations. Although sarcoglycans are normally present in both skeletal and cardiac muscle, there were no electrocardiographic or echocardiographic abnormalities in the seven patients tested. There were differences in the clinical severity, in that all patients with mutations in the b-sarcoglycan gene had severe dystrophy, whereas half those with mutations in the a- or g-sarcoglycan gene had milder disease. Many genes are known to cause muscular dystrophy, including the genes for dystrophin (Duchenne s or Becker s muscular dystrophy), calpain III (limbgirdle muscular dystrophy type 2A), merosin (congenital muscular dystrophy with merosin deficiency), and a-, b-, g-, and d-sarcoglycan (limb-girdle muscular dystrophy types 2D, 2E, 2C, and 2F, respectively). Molecular genetic analyses can now identify the disease-causing mutations in all these genes. The muscular dystrophies characterized by pro- Volume 336 Number 9 623

7 gressive muscle weakness of the pelvic and shoulder girdle (Duchenne s, Becker s, and limb-girdle muscular dystrophies) are a clinically and genetically heterogeneous group of diseases. The elucidation of the genetic defect leading to the dystrophy has implications for the diagnosis and care of affected patients (and their families). Because defects in several genes can cause phenotypically similar clinical and biochemical manifestations, a definitive diagnosis can only be made by testing of candidate genes or proteins. Supported by grants from the National Institutes of Health (NS [to Dr. Hoffman]), the Muscular Dystrophy Association (to Dr. Hoffman), and Telethon Italy (695 [to Ms. Fanin] and 552 [to Dr. Angelini]). Dr. Hoffman is an Established Investigator of the American Heart Association. REFERENCES 1. Tinsley JM, Blake DJ, Zuellig RA, Davies KE. Increasing complexity of the dystrophin-associated protein complex. Proc Natl Acad Sci U S A 1994;91: Worton R. Muscular dystrophies: diseases of the dystrophin-glycoprotein complex. Science 1995;270: Ozawa E, Yoshida M, Suzuki A, Mizuno Y, Hagiwara Y, Noguchi S. Dystrophin-associated proteins in muscular dystrophy. Hum Mol Genet 1995;4: Hoffman EP, Fischbeck KH, Brown RH, et al. Characterization of dystrophin in muscle-biopsy specimens from patients with Duchenne s or Becker s muscular dystrophy. N Engl J Med 1988;318: Hoffman EP, Arahata K, Minetti C, Bonilla E, Rowland LP. Dystrophinopathy in isolated cases of myopathy in females. Neurology 1992;42: Yoshida M, Suzuki A, Yamamoto H, Noguchi S, Mizuno Y, Ozawa E. Dissociation of the complex of dystrophin and its associated proteins into several unique groups by n-octyl b-d-glucoside. Eur J Biochem 1994;222: Roberds SL, Leturcq F, Allamand V, et al. Missense mutations in the adhalin gene linked to autosomal recessive muscular dystrophy. Cell 1994; 78: Noguchi S, McNally EM, Ben Othmane K, et al. Mutations in the dystrophin-associated protein g-sarcoglycan in chromosome 13 muscular dystrophy. Science 1995;270: Bönnemann CG, Modi R, Noguchi S, et al. b-sarcoglycan (A3b) mutations cause autosomal recessive muscular dystrophy with loss of the sarcoglycan complex. Nat Genet 1995;11: Lim LE, Duclos F, Broux O, et al. b-sarcoglycan: characterization and role in limb-girdle muscular dystrophy linked to 4q12. Nat Genet 1995; 11: Piccolo F, Roberds SL, Jeanpierre M, et al. Primary adhalinopathy: a common cause of autosomal recessive muscular dystrophy of variable severity. Nat Genet 1995;10: Passos Bueno MR, Moreira ES, Vainzof M, et al. A common missense mutation in the adhalin gene in three unrelated Brazilian families with a relatively mild form of autosomal recessive limb-girdle muscular dystrophy. Hum Mol Genet 1995;4: Kawai H, Akaike M, Endo T, et al. Adhalin gene mutations in patients with autosomal recessive childhood onset muscular dystrophy with adhalin deficiency. J Clin Invest 1995;96: Ljunggren A, Duggan DJ, McNally E, et al. Primary adhalin deficiency as a cause of muscular dystrophy in patients with normal dystrophin. Ann Neurol 1995;38: Duggan DJ, Fanin M, Pegoraro E, Angelini C, Hoffman EP. a-sarcoglycan (adhalin) deficiency: complete deficiency patients are 5% of childhood-onset dystrophin-normal muscular dystrophy and most partial deficiency patients do not have gene mutations. J Neurol Sci 1996;140: Fanin M, Martinello F, Duggan DJ, et al. A severe case of Duchennelike muscular dystrophy due to a mutation in the a-sarcoglycan (adhalin) gene. Basic Appl Myol 1996;6: McNally EM, Duggan D, Gorospe JR, et al. Mutations that disrupt the carboxyl-terminus of g-sarcoglycan cause muscular dystrophy. Hum Mol Genet 1996;5: McNally EM, Passos-Bueno MR, Bönnemann CG, et al. Mild and severe muscular dystrophy caused by a single g-sarcoglycan gene mutation. Am J Hum Genet 1996;59: Bönnemann CG, Passos-Bueno MR, McNally EM, et al. Genomic screening for b-sarcoglycan gene mutations: missense mutations may cause severe limb-girdle muscular dystrophy type 2E (LGMD 2E). Hum Mol Genet 1996;5: Nigro V, Moreira ES, Piluso G, et al. Autosomal recessive limb-girdle muscular dystrophy, LGMD2F, is caused by a mutation in the deltasarcoglycan gene. Nat Genet 1996;13: Mizuno Y, Yoshida M, Yamamoto H, Hirai S, Ozawa E. Distribution of dystrophin isoforms and dystrophin-associated proteins 43DAG (A3a) and 50DAG (A2) in various monkey tissues. J Biochem 1993;114: Yamamoto H, Mizuno Y, Hayashi K, Nonaka I, Yoshida M, Ozawa E. Expression of dystrophin-associated protein 35DAG (A4) and 50DAG (A2) is confined to striated muscles. J Biochem 1994;115: McNally EM, Yoshida M, Mizuno Y, Ozawa E, Kunkel LM. Human adhalin is alternatively spliced and the gene is located on chromosome 17q21. Proc Natl Acad Sci U S A 1994;91: Ibraghimov-Beskrovnaya O, Ervasti JM, Leveille CJ, Slaughter CA, Sernett SW, Campbell KP. Primary structure of dystrophin-associated glycoproteins linking dystrophin to the extracellular matrix. Nature 1992;355: Ahn AH, Freener CA, Gussoni E, Yoshida M, Ozawa E, Kunkel LM. The three human syntrophin genes are expressed in diverse tissues, have distinct chromosomal locations, and each bind to dystrophin and its relatives. J Biol Chem 1996;271: Mizuno Y, Noguchi S, Yamamoto H, et al. Selective defect of sarcoglycan complex in severe childhood autosomal recessive muscular dystrophy muscle. Biochem Biophys Res Commun 1994;203: Ohlendieck K, Matsumura K, Ionasescu VV, et al. Duchenne muscular dystrophy: deficiency of dystrophin-associated proteins in the sarcolemma. Neurology 1993;43: Mizuno Y, Yoshida M, Nonaka I, Hirai S, Ozawa E. Expression of utrophin (dystrophin-related protein) and dystrophin-associated glycoproteins in muscles from patients with Duchenne muscular dystrophy. Muscle Nerve 1994;17: Spinardi L, Mazars R, Theillet C. Protocols for an improved detection of point mutations by SSCP. Nucleic Acids Res 1991;19: Little S. Amplification-refractory mutation system (ARMS) analysis of point mutations. In: Dracopoli NC, Haines JL, Korf BR, et al., eds. Current protocols in human genetics. New York: John Wiley, 1994: Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16: Pegoraro E, Schimke RN, Garcia C, et al. Genetic and biochemical normalization in female carriers of Duchenne muscular dystrophy: evidence for failure of dystrophin production in dystrophin-competent myonuclei. Neurology 1995;45: February 27, 1997

Progress in human genetics has identified a number. -Sarcoglycan Deficiency Leads to Muscle Membrane Defects and Apoptosis Independent of Dystrophin

Progress in human genetics has identified a number. -Sarcoglycan Deficiency Leads to Muscle Membrane Defects and Apoptosis Independent of Dystrophin -Sarcoglycan Deficiency Leads to Muscle Membrane Defects and Apoptosis Independent of Dystrophin Andrew A. Hack,* Chantal T. Ly, Fang Jiang, Cynthia J. Clendenin, Kirsten S. Sigrist, Robert L. Wollmann,

More information

Revised spectrum of mutations in sarcoglycanopathies

Revised spectrum of mutations in sarcoglycanopathies (2008) 16, 793 803 & 2008 Nature Publishing Group All rights reserved 1018-4813/08 $30.00 www.nature.com/ejhg ARTICLE Revised spectrum of mutations in sarcoglycanopathies Madiha Trabelsi 1,3,4, Niloufar

More information

Disease taxonomy - monogenic muscular dystrophy

Disease taxonomy - monogenic muscular dystrophy Disease taxonomy - monogenic muscular dystrophy Jacques S Beckmann URA CNRS 1922 - Genethon, Evry, France The field of the autosomal recessive progressive muscular dystrophies has clarified significantly

More information

Sarcoglycan Subcomplex Expression in Normal Human Smooth Muscle

Sarcoglycan Subcomplex Expression in Normal Human Smooth Muscle Volume 55(8): 831 843, 2007 Journal of Histochemistry & Cytochemistry http://www.jhc.org ARTICLE Sarcoglycan Subcomplex Expression in Normal Human Smooth Muscle Giuseppe Anastasi, Giuseppina Cutroneo,

More information

What is muscular dystrophy?

What is muscular dystrophy? What is muscular dystrophy? The word dystrophy comes from Latin and Greek roots meaning faulty nutrition. The term muscular dysrophy refers to a group of genetic diseases marked by progressive weakness

More information

Hutterite brothers both affected with two forms of limb girdle muscular dystrophy: LGMD2H and LGMD2I

Hutterite brothers both affected with two forms of limb girdle muscular dystrophy: LGMD2H and LGMD2I (2005) 13, 978 982 & 2005 Nature Publishing Group All rights reserved 1018-4813/05 $30.00 ARTICLE www.nature.com/ejhg Hutterite brothers both with two forms of limb girdle muscular dystrophy: LGMD2H and

More information

raav vector-mediated sarcogylcan gene transfer in a hamster model for limb girdle muscular dystrophy

raav vector-mediated sarcogylcan gene transfer in a hamster model for limb girdle muscular dystrophy Gene Therapy (1999) 6, 74 82 1999 Stockton Press All rights reserved 0969-7128/99 $12.00 http://www.stockton-press.co.uk/gt raav vector-mediated sarcogylcan gene transfer in a hamster model for limb girdle

More information

SMA IS A SEVERE NEUROLOGICAL DISORDER [1]

SMA IS A SEVERE NEUROLOGICAL DISORDER [1] SMA OVERVIEW SMA IS A SEVERE NEUROLOGICAL DISORDER [1] Autosomal recessive genetic inheritance 1 in 50 people (approximately 6 million Americans) are carriers [2] 1 in 6,000 to 1 in 10,000 children born

More information

Advances and Perspectives in Muscular Dystrophies Abstract Key words X-Linked Muscular Dystrophies

Advances and Perspectives in Muscular Dystrophies Abstract Key words X-Linked Muscular Dystrophies Advances and Perspectives in Muscular Dystrophies Corrado Angelini Department of Neurological and Psychiatric Sciences, University of Padova, Padova, Italy Abstract The muscular dystrophies are inherited

More information

IVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois

IVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois FERTILITY AND STERILITY VOL. 80, NO. 4, OCTOBER 2003 Copyright 2003 American Society for Reproductive Medicine Published by Elsevier Inc. Printed on acid-free paper in U.S.A. CASE REPORTS Preimplantation

More information

Electron microscopy in the investigation and diagnosis of muscle disease

Electron microscopy in the investigation and diagnosis of muscle disease Electron microscopy in the investigation and diagnosis of muscle disease Roy Weller Clinical Neurosciences University of Southampton School of Medicine Normal Muscle Normal Muscle The Sarcomere The names

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Leber congenital amaurosis OMIM number for disease 204000 Disease alternative

More information

Disorders of Muscle. Disorders of Muscle. Muscle Groups Involved in Myopathy. Needle Examination of EMG. History. Muscle Biopsy

Disorders of Muscle. Disorders of Muscle. Muscle Groups Involved in Myopathy. Needle Examination of EMG. History. Muscle Biopsy Disorders of Muscle Disorders of Muscle Zakia Bell, M.D. Associate Professor of Neurology and Physical Medicine & Rehabilitation Virginia Commonwealth University Cardinal symptom of diseases of the muscle

More information

Skeletal Muscle and the Molecular Basis of Contraction. Lanny Shulman, O.D., Ph.D. University of Houston College of Optometry

Skeletal Muscle and the Molecular Basis of Contraction. Lanny Shulman, O.D., Ph.D. University of Houston College of Optometry Skeletal Muscle and the Molecular Basis of Contraction Lanny Shulman, O.D., Ph.D. University of Houston College of Optometry Like neurons, all muscle cells can be excited chemically, electrically, and

More information

Lecture 17: Human Genetics. I. Types of Genetic Disorders. A. Single gene disorders

Lecture 17: Human Genetics. I. Types of Genetic Disorders. A. Single gene disorders Lecture 17: Human Genetics I. Types of Genetic Disorders A. Single gene disorders B. Multifactorial traits 1. Mutant alleles at several loci acting in concert C. Chromosomal abnormalities 1. Physical changes

More information

Mutations and Disease Mutations in the Myosin Gene

Mutations and Disease Mutations in the Myosin Gene Biological Sciences Initiative HHMI Mutations and Disease Mutations in the Myosin Gene Goals Explore how mutations can lead to disease using the myosin gene as a model system. Explore how changes in the

More information

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: GAIN,

More information

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced. mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes

More information

Human inherited diseases

Human inherited diseases Human inherited diseases A genetic disorder that is caused by abnormality in an individual's DNA. Abnormalities can range from small mutation in a single gene to the addition or subtraction of a whole

More information

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced.

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced. mix P241-D2 MODY mix 1 Lot D2-0716, D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent

More information

Clinical and pathologic aspects of congenital myopathies

Clinical and pathologic aspects of congenital myopathies Neurol J Southeast Asia 2001; 6 : 99 106 88 Clinical and pathologic aspects of congenital myopathies Ikuya NONAKA MD National Center of Neurology and Psychiatry, Kodaira, Tokyo, Japan Abstract The term

More information

Bio 111 Study Guide Chapter 17 From Gene to Protein

Bio 111 Study Guide Chapter 17 From Gene to Protein Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and

More information

Agro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17

Agro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17 Agro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17 INTRODUCTION - Our genes underlie every aspect of human health, both in function and

More information

LIPOPROTEINE ATEROGENE E ANTI-ATEROGENE ATEROGENE

LIPOPROTEINE ATEROGENE E ANTI-ATEROGENE ATEROGENE LIPOPROTEINE ATEROGENE E ANTI-ATEROGENE ATEROGENE Sebastiano Calandra Dipartimento di Scienze Biomediche Università di Modena e Reggio Emilia Incidence Rate/1000 200-150 - 100-50 - Women 0 Men

More information

Identification of a novel duplication mutation in the VHL gene in a large Chinese family with Von Hippel-Lindau (VHL) syndrome

Identification of a novel duplication mutation in the VHL gene in a large Chinese family with Von Hippel-Lindau (VHL) syndrome Identification of a novel duplication mutation in the VHL gene in a large Chinese family with Von Hippel-Lindau (VHL) syndrome L.H. Cao 1, B.H. Kuang 2, C. Chen 1, C. Hu 2, Z. Sun 1, H. Chen 2, S.S. Wang

More information

Deficiency of -sarcoglycan differently affects fast- and slow-twitch skeletal muscles

Deficiency of -sarcoglycan differently affects fast- and slow-twitch skeletal muscles Am J Physiol Regul Integr Comp Physiol 289: R1328 R1337, 2005. First published July 7, 2005; doi:10.1152/ajpregu.00673.2004. Deficiency of -sarcoglycan differently affects fast- and slow-twitch skeletal

More information

FEP Medical Policy Manual

FEP Medical Policy Manual FEP Medical Policy Manual FEP 2.04.102 Whole Exome and Whole Genome Sequencing for Diagnosis of Genetic Disorders Effective Date: April 15, 2017 Related Policies: 2.04.59 Genetic Testing for Developmental

More information

Abstract. Introduction

Abstract. Introduction Brazilian Journal of Medical and Biological Research (2003) 36: 1403-1407 Thr(118)Met in Charcot-Marie-Tooth disease ISSN 0100-879X 1403 Thr(118)Met amino acid substitution in the peripheral myelin protein

More information

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,

More information

The Meaning of Genetic Variation

The Meaning of Genetic Variation Activity 2 The Meaning of Genetic Variation Focus: Students investigate variation in the beta globin gene by identifying base changes that do and do not alter function, and by using several CD-ROM-based

More information

Muscle Diseases: The Muscular Dystrophies

Muscle Diseases: The Muscular Dystrophies Annu. Rev. Pathol. Mech. Dis. 2007. 2:87 109 The Annual Review of Pathology: Mechanisms of Disease is online at pathmechdis.annualreviews.org This article s doi: 10.1146/annurev.pathol.2.010506.091936

More information

Implementation of Newborn Screening for Duchenne Muscular Dystrophy.

Implementation of Newborn Screening for Duchenne Muscular Dystrophy. Implementation of Newborn Screening for Duchenne Muscular Dystrophy. Michele A. Lloyd-Puryear, MD, PhD 1, Stuart J Moat, PhD 2, Amy Brower 3, PhD, Annie Kennedy 1, Petra Furu 4, Michael Watson, PhD 3,

More information

Novel pharmacological approaches to treat protein-misfolding diseases

Novel pharmacological approaches to treat protein-misfolding diseases IRCCS E. Medea, Bosisio Parini (LC) 14 November 2014 Distrofia dei cingoli da deficit di Calpaina 3 Dal gene al paziente Novel pharmacological approaches to treat protein-misfolding diseases Dorianna Sandonà

More information

SALSA MLPA KIT P050-B2 CAH

SALSA MLPA KIT P050-B2 CAH SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Choroideremia OMIM number for disease 303100 Disease alternative names please

More information

The Human Major Histocompatibility Complex

The Human Major Histocompatibility Complex The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure

More information

SALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted.

SALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted. mix P169-C2 HIRSCHSPRUNG-1 Lot C2-0915. As compared to version C1 (lot C1-0612), the length of one has been adjusted. Hirschsprung disease (HSCR), or aganglionic megacolon, is a congenital disorder characterised

More information

Disruption of the -Sarcoglycan Gene Reveals Pathogenetic Complexity of Limb-Girdle Muscular Dystrophy Type 2E

Disruption of the -Sarcoglycan Gene Reveals Pathogenetic Complexity of Limb-Girdle Muscular Dystrophy Type 2E Molecular Cell, Vol. 5, 141 151, January, 2000, Copyright 2000 by Cell Press Disruption of the -Sarcoglycan Gene Reveals Pathogenetic Complexity of Limb-Girdle Muscular Dystrophy Type 2E Madeleine Durbeej,*

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Loeys-Dietz Syndrome OMIM number for disease 609192; 608967; 610380; 610168 Disease

More information

New Approaches to the Genetic Evaluation of Developmental Delay

New Approaches to the Genetic Evaluation of Developmental Delay November-2017 Bret Bostwick, M.D. New Approaches to the Genetic Evaluation of Developmental Delay The following individuals have reported financial relationships with commercial interests (drug/device

More information

Structural vs. nonstructural proteins

Structural vs. nonstructural proteins Why would you want to study proteins associated with viruses or virus infection? Receptors Mechanism of uncoating How is gene expression carried out, exclusively by viral enzymes? Gene expression phases?

More information

Lab Activity Report: Mendelian Genetics - Genetic Disorders

Lab Activity Report: Mendelian Genetics - Genetic Disorders Name Date Period Lab Activity Report: Mendelian Genetics - Genetic Disorders Background: Sometimes genetic disorders are caused by mutations to normal genes. When the mutation has been in the population

More information

Asingle inherited mutant gene may be enough to

Asingle inherited mutant gene may be enough to 396 Cancer Inheritance STEVEN A. FRANK Asingle inherited mutant gene may be enough to cause a very high cancer risk. Single-mutation cases have provided much insight into the genetic basis of carcinogenesis,

More information

TREAT-NMD Conference 2013

TREAT-NMD Conference 2013 TREAT-NMD Conference 2013 Utility of patient registries for clinical care and post-marketing surveillance Jan Verschuuren Leiden University Medical Centre Newcastle 30 October 1 November 2013 2 Improving

More information

p and q can be thought of as probabilities of selecting the given alleles by

p and q can be thought of as probabilities of selecting the given alleles by Lecture 26 Population Genetics Until now, we have been carrying out genetic analysis of individuals, but for the next three lectures we will consider genetics from the point of view of groups of individuals,

More information

SALSA MLPA probemix P315-B1 EGFR

SALSA MLPA probemix P315-B1 EGFR SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional

More information

Muscle Protein Alterations in LGMD2I Patients With Different Mutations in the Fukutin-related Protein Gene

Muscle Protein Alterations in LGMD2I Patients With Different Mutations in the Fukutin-related Protein Gene Volume 56(11): 995 1001, 2008 Journal of Histochemistry & Cytochemistry http://www.jhc.org ARTICLE Muscle Protein Alterations in LGMD2I Patients With Different Mutations in the Fukutin-related Protein

More information

HASPI Medical Anatomy & Physiology 09a Lab Activity

HASPI Medical Anatomy & Physiology 09a Lab Activity HASPI Medical Anatomy & Physiology 09a Lab Activity Name(s): Period: Date: http://www.fallingpixel.com/products/33817/mains/0000-malemuscular_1.jpg The Muscular System The main function of the muscular

More information

The Fate of Dystrophin and Some Signs of Apoptosis in the Skeletal Muscle Work-Overloaded in Extension

The Fate of Dystrophin and Some Signs of Apoptosis in the Skeletal Muscle Work-Overloaded in Extension The Fate of Dystrophin and Some Signs of Apoptosis in the Skeletal Muscle Work-Overloaded in Extension Donatella Biral, Marco Sandri, Anna Jakubiec-Puka (1) Department ofbiomedical Sciences, The University

More information

Eukaryotic Gene Regulation

Eukaryotic Gene Regulation Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,

More information

Genetic diagrams show the genotype and phenotype of the offspring of two organisms. The different generation are abbreviated like so:

Genetic diagrams show the genotype and phenotype of the offspring of two organisms. The different generation are abbreviated like so: Genetics 2 Genetic Diagrams and Mendelian Genetics: Genetic diagrams show the genotype and phenotype of the offspring of two organisms. The different generation are abbreviated like so: P parent generation

More information

AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria

AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria AIDS - Knowledge and Dogma Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/17 2010, Vienna, Austria Reliability of PCR to detect genetic sequences from HIV Juan Manuel

More information

7.012 Quiz 3 Answers

7.012 Quiz 3 Answers MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84

More information

Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins.

Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins. Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins. The RNA transcribed from a complex transcription unit

More information

A very simplified introduction to neuromuscular illnesses (NMIs) with a particular focus on the muscular dystrophies.

A very simplified introduction to neuromuscular illnesses (NMIs) with a particular focus on the muscular dystrophies. 1 A very simplified introduction to neuromuscular illnesses (NMIs) with a particular focus on the muscular dystrophies. Available on-line at: Bill Tillier Calgary Alberta September, 2008. Terminology.

More information

Research Article Serum Creatinine Level: A Supplemental Index to Distinguish Duchenne Muscular Dystrophy from Becker Muscular Dystrophy

Research Article Serum Creatinine Level: A Supplemental Index to Distinguish Duchenne Muscular Dystrophy from Becker Muscular Dystrophy Disease Markers Volume 2015, Article ID 141856, 5 pages http://dx.doi.org/10.1155/2015/141856 Research Article Serum Creatinine Level: A Supplemental Index to Distinguish Duchenne Muscular Dystrophy from

More information

Point total. Page # Exam Total (out of 90) The number next to each intermediate represents the total # of C-C and C-H bonds in that molecule.

Point total. Page # Exam Total (out of 90) The number next to each intermediate represents the total # of C-C and C-H bonds in that molecule. This exam is worth 90 points. Pages 2- have questions. Page 1 is for your reference only. Honor Code Agreement - Signature: Date: (You agree to not accept or provide assistance to anyone else during this

More information

TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer

TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer AD Award Number: W81XWH-04-1-0325 TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer PRINCIPAL INVESTIGATOR: Valerie Boka CONTRACTING ORGANIZATION: University of Texas Health Science

More information

Pedigree Analysis Why do Pedigrees? Goals of Pedigree Analysis Basic Symbols More Symbols Y-Linked Inheritance

Pedigree Analysis Why do Pedigrees? Goals of Pedigree Analysis Basic Symbols More Symbols Y-Linked Inheritance Pedigree Analysis Why do Pedigrees? Punnett squares and chi-square tests work well for organisms that have large numbers of offspring and controlled mating, but humans are quite different: Small families.

More information

Diploma in Equine Science

Diploma in Equine Science The process of meiosis is summarised in the diagram below, but it involves the reduction of the genetic material to half. A cell containing the full number of chromosomes (two pairs) is termed diploid,

More information

Muscle Physiology. Dr. Ebneshahidi Ebneshahidi

Muscle Physiology. Dr. Ebneshahidi Ebneshahidi Muscle Physiology Dr. Ebneshahidi Skeletal Muscle Figure 9.2 (a) Functions of the muscular system 1. Locomotion body movements are due to skeletal muscle contraction. 2. Vasoconstriction and vasodilatation

More information

Introduction to LOH and Allele Specific Copy Number User Forum

Introduction to LOH and Allele Specific Copy Number User Forum Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.

More information

When bad things happen to good genes: mutation vs. selection

When bad things happen to good genes: mutation vs. selection When bad things happen to good genes: mutation vs. selection Selection tends to increase the frequencies of alleles with higher marginal fitnesses. Does this mean that genes are perfect? No, mutation can

More information

Amyloidosis: Neurology

Amyloidosis: Neurology Klinik für Neurologie Neuromuskuläres Zentrum Amyloidosis: Neurology J.A. Petersen Systemic Amyloidosis: Classification Primary Amyloidosis (AL) Primary systemic amyloidosis Monoclonal light Multiple-myeloma-associated

More information

Immunolocalization of Caveolin-1 and Caveolin-3 in Monkey Skeletal, Cardiac and Uterine Smooth Muscles

Immunolocalization of Caveolin-1 and Caveolin-3 in Monkey Skeletal, Cardiac and Uterine Smooth Muscles CELL STRUCTURE AND FUNCTION 27: 375 382 (2002) 2002 by Japan Society for Cell Biology Immunolocalization of Caveolin-1 and Caveolin-3 in Monkey Skeletal, Cardiac and Uterine Smooth Muscles Yasuko Hagiwara

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

Neonatal Hypotonia. Encephalopathy acute No encephalopathy. Neurology Chapter of IAP

Neonatal Hypotonia. Encephalopathy acute No encephalopathy. Neurology Chapter of IAP The floppy infant assumes a frog legged position. On ventral suspension, the baby can not maintain limb posture against gravity and assumes the position of a rag doll. Encephalopathy acute No encephalopathy

More information

TEACHER S GUIDE. Case Study. Lactose tolerance. Steve Cross, Bronwyn Terrill and colleagues. Wellcome Trust Sanger Institute Hinxton. Version 1.

TEACHER S GUIDE. Case Study. Lactose tolerance. Steve Cross, Bronwyn Terrill and colleagues. Wellcome Trust Sanger Institute Hinxton. Version 1. TEACHER S GUIDE Case Study Lactose tolerance Version 1.1 Steve Cross, Bronwyn Terrill and colleagues Wellcome Trust Sanger Institute Hinxton Lactose tolerance The majority of people living today are unable

More information

Genetics of Alcoholic Liver Disease

Genetics of Alcoholic Liver Disease VII Workshop Internacional de Atulização em Hepatologia, Curitiba 2014 Genetics of Alcoholic Liver Disease Felix Stickel Hepatology Unit, Hirslanden Klinik Beau Site, Bern, Switzerland & Department of

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider TEST DISEASE/CONDITION POPULATION TRIAD Submitting laboratory: London North East RGC GOSH Approved: September

More information

The Chromosomal Basis Of Inheritance

The Chromosomal Basis Of Inheritance The Chromosomal Basis Of Inheritance Chapter 15 Objectives Explain the chromosomal theory of inheritance and its discovery. Explain why sex-linked diseases are more common in human males than females.

More information

Facts About Limb-Girdle. Muscular Dystrophies

Facts About Limb-Girdle. Muscular Dystrophies Facts About Limb-Girdle Muscular Dystrophies Updated December 2009 Mandy Van Benthuysen Dear Friends: When I was 4 years old, my parents took me to a specialist to find out why I walked with an unusual

More information

Tay Sachs, Cystic Fibrosis, Sickle Cell Anemia and PKU. Tay Sachs Disease (also called Hexosaminidase deficiency)

Tay Sachs, Cystic Fibrosis, Sickle Cell Anemia and PKU. Tay Sachs Disease (also called Hexosaminidase deficiency) Tay Sachs, Cystic Fibrosis, Sickle Cell Anemia and PKU Tay Sachs Disease (also called Hexosaminidase deficiency) Introduction 1. Tay Sachs is a rare condition named after 2 physicians, Tay and Sachs, who

More information

Blood Types and Genetics

Blood Types and Genetics Blood Types and Genetics Human blood type is determined by codominant alleles. An allele is one of several different forms of genetic information that is present in our DNA at a specific location on a

More information

NCG Diagnostic and Management Service for McArdle Disease and Related Disorders Lead clinician: Dr Ros Quinlivan

NCG Diagnostic and Management Service for McArdle Disease and Related Disorders Lead clinician: Dr Ros Quinlivan Queen Square Centre for Neuromuscular Diseases NCG Diagnostic and Management Service for McArdle Disease and Related Disorders Lead clinician: Dr Ros Quinlivan Described 1951 Autosomal recessive McArdle

More information

ISSN X (Print) Research Article

ISSN X (Print) Research Article Scholars Journal of Applied Medical Sciences (SJAMS) Sch. J. App. Med. Sci., 2014; 2(3A):942-948 Scholars Academic and Scientific Publisher (An International Publisher for Academic and Scientific Resources)

More information

The passing of traits from parents to offspring. The scientific study of the inheritance

The passing of traits from parents to offspring. The scientific study of the inheritance Inheritance The passing of traits from parents to offspring Genetics The scientific study of the inheritance Gregor Mendel -Father of modern genetics -Used peas to successfully identify the laws of heredity

More information

BMS : An Anti-Myostatin Adnectin Targeting Duchenne Muscular Dystrophy

BMS : An Anti-Myostatin Adnectin Targeting Duchenne Muscular Dystrophy BMS-986089: An Anti-Myostatin Adnectin Targeting Duchenne Muscular Dystrophy Leslie Jacobsen, MD Medical Lead GS Tirucherai, M Ahlijanian, F Luo, C Bechtold and the BMS Anti-Myostatin Team PPMD Connect

More information

7.1 Molecular Characterization of Fragile X Syndrome

7.1 Molecular Characterization of Fragile X Syndrome 7 GENETIC DISORDERS Advances in knowledge of molecular genetics, cytogenetics and biochemical genetics have led to availability of diagnostic tests for various genetic disorders. The most important application

More information

See pedigree info on extra sheet 1. ( 6 pts)

See pedigree info on extra sheet 1. ( 6 pts) Biol 321 Quiz #2 Spring 2010 40 pts NAME See pedigree info on extra sheet 1. ( 6 pts) Examine the pedigree shown above. For each mode of inheritance listed below indicate: E = this mode of inheritance

More information

1" 7I'?? 1" : t"i"i"itf

1 7I'?? 1 : tiiitf Cell, Vol. 80, 1-5, January 13, 1995, Copyright 1995 by Cell Press Genes for SMA: Multum In Parvo Minireview Benjamin Lewin Cell In this issue of Ceil, we take the unusual step of publishing two articles

More information

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution

More information

HIV INFECTION: An Overview

HIV INFECTION: An Overview HIV INFECTION: An Overview UNIVERSITY OF PAPUA NEW GUINEA SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY & MOLECULAR BIOLOGY PBL MBBS II SEMINAR VJ

More information

Class XII Chapter 5 Principles of Inheritance and Variation Biology

Class XII Chapter 5 Principles of Inheritance and Variation Biology Question 1: Mention the advantages of selecting pea plant for experiment by Mendel. Mendel selected pea plants to carry out his study on the inheritance of characters from parents to offspring. He selected

More information

Ch 10: Skeletal Muscle Tissue (Myology)

Ch 10: Skeletal Muscle Tissue (Myology) Ch 10: Skeletal Muscle Tissue (Myology) main objectives: Describe the distinguishing characteristics of the different muscle tissues Discuss the organization of skeletal muscle Explain the micro-anatomy

More information

Analysis of the Sex-determining Region of the Y Chromosome (SRY) in a Case of 46, XX True Hermaphrodite

Analysis of the Sex-determining Region of the Y Chromosome (SRY) in a Case of 46, XX True Hermaphrodite Clin Pediatr Endocrinol 1994; 3(2): 91-95 Copyright (C) 1994 by The Japanese Society for Pediatric Endocrinology Analysis of the Sex-determining Region of the Y Chromosome (SRY) in a Case of 46, XX True

More information

Chapter 4-1. Patterns of single-gene inheritance

Chapter 4-1. Patterns of single-gene inheritance Chapter 4-1. Patterns of single-gene inheritance Outline Pedigree Inheritance pattern Autosomal dominant inheritance, AD Autosomal recessive inheritance, AR X-linked dominant inheritance,xd X-linked recessive

More information