The New England Journal of Medicine MUTATIONS IN THE SARCOGLYCAN GENES IN PATIENTS WITH MYOPATHY

Transcription

1 MUTATIONS IN THE SARCOGLYCAN GENES IN PATIENTS WITH MYOPATHY DAVID J. DUGGAN, B.S., J. RAFAEL GOROSPE, M.D., PH.D., MARINA FANIN, M.S., ERIC P. HOFFMAN, PH.D., A CORRADO ANGELINI, M.D. ABSTRACT Background Some patients with autosomal recessive limb-girdle muscular dystrophy have mutations in the genes coding for the sarcoglycan proteins (a-, b-, g-, and d-sarcoglycan). To determine the frequency of sarcoglycan-gene mutations and the relation between the clinical features and genotype, we studied several hundred patients with myopathy. Methods Antibody against a-sarcoglycan was used to stain muscle-biopsy specimens from 556 patients with myopathy and normal dystrophin genes (the gene frequently deleted in X-linked muscular dystrophy). Patients whose biopsy specimens showed a deficiency of a-sarcoglycan on immunostaining were studied for mutations of the a-, b-, and g-sarcoglycan genes with reverse transcription of muscle RNA, analysis involving single-strand conformation polymorphisms, and sequencing. Results Levels of a-sarcoglycan were found to be decreased on immunostaining of muscle-biopsy specimens from 54 of the 556 patients (10 percent); in 25 of these patients no a-sarcoglycan was detected. Screening for sarcoglycan-gene mutations in 50 of the 54 patients revealed mutations in 29 patients (58 percent): 17 (34 percent) had mutations in the a-sarcoglycan gene, 8 (16 percent) in the b-sarcoglycan gene, and 4 (8 percent) in the g-sarcoglycan gene. No mutations were found in 21 patients (42 percent). The prevalence of sarcoglycan-gene mutations was highest among patients with severe (Duchenne-like) muscular dystrophy that began in childhood (18 of 83 patients, or 22 percent); the prevalence among patients with proximal (limb-girdle) muscular dystrophy with a later onset was 6 percent (11 of 180 patients). Conclusions Defects in the genes coding for the sarcoglycan proteins are limited to patients with Duchenne-like and limb-girdle muscular dystrophy with normal dystrophin and occur in 11 percent of such patients. (N Engl J Med 1997;336: ) 1997, Massachusetts Medical Society. MUSCLE diseases (myopathies) are most often caused by inborn errors resulting in the degeneration of muscle fibers (muscular dystrophies). The muscular dystrophies are a clinically and genetically heterogeneous group of disorders. Clinically, many of the muscular dystrophies present with proximallimb muscle weakness or wasting and elevated serum creatine kinase concentrations. Genetically, the pattern of inheritance can be X-linked recessive (as in Duchenne s or Becker s muscular dystrophy), autosomal dominant (as in limb-girdle muscular dystrophy type 1), or autosomal recessive (as in limbgirdle muscular dystrophy type 2). Recently, many of these phenotypically similar, yet genetically distinct, disorders have been shown to be caused by abnormalities of the plasma membrane of muscle fibers. This membrane contains an extensive cytoskeleton that stabilizes the myofibrillar membrane during contraction. Part of this cytoskeleton appears to be responsible for attaching intracellular actin to the extracellular basal lamina by means of dystrophin (Fig. 1). 1-3 Abnormalities of dystrophin are a common cause of muscular dystrophy, 4,5 and testing for the dystrophin gene or protein has become part of the routine diagnostic evaluation of patients who present with progressive proximal muscle weakness, high serum creatine kinase concentrations, and histopathological evidence of a dystrophic process. Patients who have no dystrophin abnormalities are assumed to have an autosomal recessive muscular dystrophy; most cases are isolated, and large families with multiple affected patients are uncommon. In addition to dystrophin, other proteins, often referred to as dystrophin-associated proteins, contribute to the membrane cytoskeleton of myofibers. These proteins are divided into the dystroglycan, sarcoglycan, and syntrophin subcomplexes (Fig. 1). 3,6 Recently, genetic defects of the sarcoglycan complex (sarcoglycanopathies) were found in some patients with autosomal recessive muscular dystrophy The genes and proteins corresponding to these genetic From the Departments of Human Genetics, Molecular Genetics and Biochemistry, Pediatrics, and Neurology, University of Pittsburgh, Pittsburgh (D.J.D., J.R.G., E.P.H.); and the Regional Neuromuscular Center, Department of Neurology, University of Padua, Padua, Italy (M.F., C.A.). Address reprint requests to Dr. Hoffman at Biomedical Science Tower W1211, Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, Pittsburgh, PA Other authors were E. Pegoraro (University of Pittsburgh, Pittsburgh), S. Noguchi and E. Ozawa (National Center of Neurology and Psychiatry, Tokyo, Japan), W. Pendlebury (University of Vermont, Burlington), A.J. Waclawik (University of Wisconsin Madison Medical School, Madison), D.A. Duenas (Miami Children s Hospital, Miami), I. Hausmanowa- Petrusewicz and A. Fidzianska (Polish Academy of Sciences, Warsaw, Poland), S.C. Bean (Medical Center of Delaware, Newark), J.S. Haller (Albany Medical Center, Albany, N.Y.), J. Bodensteiner (Robert C. Byrd Health Sciences Center, Morgantown, W.V.), C.M. Greco (California Pacific Medical Center, San Francisco), A. Pestronk (Washington University, St. Louis), A. Berardinelli (Neurological Institute C.M. Mondino, Pavia, Italy), D.F. Gelinas (California Pacific Medical Center, San Francisco), H. Abram (Nemours Children s Clinic, Jacksonville, Fla.), and R.W. Kuncl (Johns Hopkins University, Baltimore). 618 February 27, 1997

2 MUTATIONS IN THE SARCOGLYCAN GENES IN PATIENTS WITH MYOPATHY Extracellular Merosin Sarcoglycans a b g d a b Dystroglycans Plasma membrane Dystrophin Intracellular Syntrophin Actin Figure 1. Organization of the Plasma-Membrane Dystrophin Cytoskeleton of Myofibers. Dystrophin is part of a large oligomeric complex tightly associated with several other protein complexes. The dystroglycan complex consists of a-dystroglycan, which associates with the basal-lamina protein merosin, and b-dystroglycan, which binds a-dystroglycan and dystrophin. Syntrophin binds to the distal C-terminal region of dystrophin. The sarcoglycan complex consists of four transmembrane proteins: a-, b-, g-, and d-sarcoglycan. The function of the sarcoglycan complex and the nature of the interactions within the complex and between it and the other complexes are not clear. The sarcoglycan complex is formed only in striated muscle, and its subunits preferentially associate with each other, suggesting that the complex may function as a single unit. defects are a-sarcoglycan, 7 b-sarcoglycan, 9,10 g-sarcoglycan, 8 and d-sarcoglycan. 20 Each of these sarcoglycans is a relatively small transmembrane protein expressed either only (a, g, and d) or predominantly (b) in striated muscle (skeletal and cardiac). 7-10,20-23 No patients with primary defects of the other dystrophin-associated proteins (dystroglycans and syntrophins) have been identified; however, the expression of these proteins is not limited to striated muscle. 24,25 Studies with antibodies directed against a-, b-, g-, and d-sarcoglycan have revealed deficiencies of all components of the sarcoglycan complex in musclebiopsy specimens from patients with mutations in any of the sarcoglycan genes. 8-10,17,20 Apparently, mutations in a single sarcoglycan gene lead to destabilization of the entire complex and secondary deficiency of the other sarcoglycan proteins. Thus, a genetic defect of any component of the protein complex should be detectable with antibody against any of the sarcoglycan proteins. 26 Because biopsy specimens from patients with dystrophin-gene abnormalities reveal secondary deficiencies of the sarcoglycans, 27,28 testing for sarcoglycan proteins is informative only if dystrophin is normal. Thus, testing of biopsy specimens from patients with normal dystrophin with antibody directed against a-sarcoglycan should identify most or all patients with mutations of the a-, b-, g-, and d-sarcoglycan genes. We used both biochemical and molecular approaches to screen for abnormalities and genetic defects in the sarcoglycan proteins in patients with myopathy. Selection of Patients METHODS We selected muscle-biopsy specimens for a-sarcoglycan immunostaining from patients with myopathy whose records and biopsy specimens were available at the University of Padua (322 patients) and University of Pittsburgh (234 patients) and who had normal dystrophin on the basis of immunofluorescence or immunoblot analysis and histopathological evidence of myopathy. The Italian patients were from northeastern Italy and were examined in Padua by a single team. The patients whose biopsy specimens were studied in Pittsburgh were examined in neuromuscular clinics throughout the United States with a standard clinical-assessment protocol (manual muscle testing and muscle biopsy). The Italian patients (or their parents) provided written informed consent. The studies done in Pittsburgh were approved by the institutional review Volume 336 Number 9 619

3 TABLE 1. CLINICAL DIAGNOSIS, RESULTS OF IMMUNOSTAINING FOR a-sarcoglycan, A FREQUENCY OF SARCOGLYCAN-GENE MUTATIONS IN 556 PATIENTS WITH MYOPATHY. CLINICAL DIAGNOSIS IMMUNOSTAINING RESULTS TYPE OF SARCOGLYCAN-GENE MUTATION NO. OF PATIENTS COMPLETE DEFICIENCY PARTIAL DEFICIENCY a b g NONE NOT TESTED no. of patients (%) Congenital muscular dystrophy Dystrophinopathy-like disorder Duchenne-like muscular dystrophy Limb-girdle muscular dystrophy *Other neuromuscular disorders included inflammatory myopathy (9 patients), metabolic myopathy (9), congenital structural myopathy (10), myoglobinuria (14), distal myopathy (2), congenital hypotonia (2), familial myopathy with high serum creatine kinase concentrations (5), isolated high serum creatine kinase concentrations (23), isolated myopathy with high serum creatine kinase concentrations or cramps (40), and other muscular dystrophies (78). In the case of 32 patients, inadequate clinical information was available for precise classification of the disorder (10) 9 (5) 8 (10) 2 (2) 2 (1) 11 (13) 9 (5) Other neuromuscular disorders* 224 Total board, but did not require informed consent because the biopsy specimens were preexisting pathological specimens obtained for diagnostic purposes (to rule out a dystrophin abnormality). The patients were divided into three groups on the basis of a clinical examination (Padua) or clinical summaries (Pittsburgh): those with congenital muscular dystrophy, those with a dystrophinopathy-like disorder, and those with other neuromuscular disorders (Table 1). Congenital muscular dystrophy was defined as the presence of weakness or hypotonia at birth, contractures before six months of age, and dystrophy on muscle biopsy. This category included patients with and those without central nervous system involvement. A dystrophinopathy-like disorder was defined on the basis of the presence of progressive proximal muscle weakness beginning after six months of age, high serum creatine kinase concentrations, and dystrophy on muscle biopsy. Other neuromuscular disorders were defined on the basis of findings of muscle weakness or wasting, hypotonia, calf hypertrophy, or high serum creatine kinase concentrations and included the following diagnoses: inflammatory myopathy (9 patients), metabolic myopathy (9), congenital structural myopathy (10), myoglobinuria (14), distal myopathy (2), congenital hypotonia (2), familial myopathy with high serum creatine kinase concentrations (5), isolated high serum creatine kinase concentrations (23), isolated myopathy with high serum creatine kinase concentrations or cramps (40), and other muscular dystrophies (78). An additional 32 patients from the Pittsburgh referral center had inadequate clinical information for precise classification of the neuromuscular disorder. All the patients in the group with other neuromuscular disorders had normal results of a-sarcoglycan immunostaining. The patients with a dystrophinopathy-like disorder were subdivided on the basis of their age at presentation into those with Duchenne-like muscular dystrophy (also known as severe childhood autosomal recessive muscular dystrophy) if they presented at or before the age of 10 years and those with limb-girdle muscular dystrophy (similar to Becker s muscular dystrophy) if they presented after 10 years of age. All patients with Duchenne-like muscular dystrophy had Gowers sign (rising from the floor by pushing one s hands against the shins, knees, and then thighs) before losing the ability to walk, and all patients with either type of muscular dystrophy had high serum creatine kinase concentrations. Biochemical Analysis Frozen sections (4 to 6 mm) of muscle obtained by biopsy were stained with a-sarcoglycan antibody (NCL-50DAG, Novocastra Laboratories, Newcastle, United Kingdom) as previously described. 15 The sections were scored as being completely or partially deficient in a-sarcoglycan relative to results in muscle tissue obtained and processed in parallel from subjects with no histologic evidence of muscle disease, as previously described. 15 The identification of partial deficiencies of a-sarcoglycan was subjective, but interobserver reliability was increased by the use of only two observers for all biopsy specimens (one each in Padua and Pittsburgh), who were unaware of the clinical diagnosis. Molecular Analyses RNA Extraction and Reverse Transcription Total RNA was isolated from the muscle-biopsy specimens of patients with decreased or no a-sarcoglycan staining and reverse transcribed as previously described. 15 Polymerase Chain Reaction Overlapping polymerase-chain-reaction (PCR) products for the complete coding sequences of complementary DNA for the a-, b-, and g-sarcoglycan genes were generated. The a-sarcoglycan PCR products, primers, and conditions have been described previously. 14,15 The b-sarcoglycan PCR products were generated with two primer pairs in addition to those previously described 9 : primer pairs 5 (nucleotides 40 to 267; 5 ACAGTCGGGCG- GGGAGCT3 and 5 CACGGCCCAAATAACAAGTG3 ) and 6 (nucleotides 773 to 982; 5 ATGGATCTGTATGGTCAGC3 and 5 CATGTTGGTGACCTCTGGG3 ), designed on the basis of the b-sarcoglycan messenger RNA sequence 9 with use of the Primer program (Daly MJ, et al.: unpublished data). PCR conditions were as described previously, 9,15 except that an annealing temperature of 60 C and 5 percent dimethylsulfoxide were used for primer pair 5. The g-sarcoglycan PCR products, primers, and conditions have been described previously. 8,17 Analysis Involving Single-Strand Conformation Polymorphisms Radiolabeled PCR product was mixed with an equal volume of stop solution, and the samples were denatured and analyzed with three single-strand conformation polymorphism (SSCP) gels as described previously. 15,29 DNA Sequencing Bands showing an electrophoretic shift in mobility on the basis of SSCP analysis were directly sequenced with the original PCR 620 February 27, 1997

4 MUTATIONS IN THE SARCOGLYCAN GENES IN PATIENTS WITH MYOPATHY primers and the prism Ready Reaction Dyedeoxy Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, Calif.) according to the manufacturer s recommendations. 15 Confirmation of Nucleotide Changes Nucleotide changes and an autosomal recessive pattern of inheritance were confirmed in the genomic DNA of the patients and their parents with exon-specific PCR primers. 18,19 When the identified sequence variant destroyed or created a restriction-enzyme site, the appropriate PCR product was digested with a specific restriction endonuclease. When the identified sequence variant did not change a restriction-enzyme site, amplification-refractory mutation tests were designed. 30 Insertions, duplications, and deletions were analyzed by size fractionation with denaturing polyacrylamide-gel electrophoresis. DNA Analysis Genomic DNA was isolated from peripheral-blood lymphocytes of the patients and their parents or the patients musclebiopsy specimens as described previously. 31,32 Approximately 100 ng of DNA was used for PCR amplification. RESULTS Muscle-biopsy specimens from 556 patients with myopathy and normal dystrophin were available for immunostaining for a-sarcoglycan (Fig. 2). The clinical classifications of these patients and the staining results are shown in Table 1. Deficiency of a-sarcoglycan was evident in biopsy specimens from 54 patients (10 percent). The deficiency was complete in 25 patients (4.5 percent) and partial in 29 patients (5.2 percent). Fifty-two of the 54 patients with a-sarcoglycan deficiency had clinical manifestations of either Duchenne-like or limb-girdle muscular dystrophy (a dystrophinopathy-like disorder). Two of the 69 patients with congenital muscular dystrophy had a partial deficiency of a-sarcoglycan. The prevalence of a-sarcoglycan deficiency in the three groups of patients was similar in the Italian and American patients. RNA was isolated from the muscle-biopsy specimens of 50 of the 54 patients with abnormal a-sarcoglycan immunostaining and screened for mutations in the a-, b-, and g-sarcoglycan genes. Mutations were detected in 29 (58 percent) of the patients (Tables 1, 2, and 3): 18 of 29 patients with Duchenne-like muscular dystrophy (62 percent) and 11 of 19 patients with limb-girdle muscular dystrophy (58 percent). The homozygous or compound heterozygous status of the 25 patients who had mutations of both sarcoglycan-gene alleles was confirmed by tests on genomic DNA from all the patients and, when available, both their parents (17 of 25 patients); in each case their parents were heterozygous for one of the two identified mutant alleles. In four patients (Patients 6, 18, 39, and 40), only one mutant allele was identified. In Patient 6, only mutant RNA (T371C) was present in the musclebiopsy specimen, whereas analysis of genomic DNA revealed the patient to be heterozygous (one wildtype and one mutant allele) at this nucleotide posi- A B Figure 2. a-sarcoglycan Immunostaining of Muscle. Transverse sections of muscle-biopsy specimens were stained with an antibody directed against a-sarcoglycan plus a Cy-3 conjugated antibody. Muscle from a normal subject shows uniform staining of the periphery of each muscle fiber (Panel A, 70). Muscle from Patient 7 shows a marked reduction in the intensity and uniformity of staining (Panel B, 70). TABLE 2. SARCOGLYCAN-GENE MUTATIONS IDENTIFIED IN 50 PATIENTS WITH a-sarcoglycan DEFICIENCY.* IMMUNOSTAINING RESULT NO. OF PATIENTS TYPE OF SARCOGLYCAN-GENE MUTATION a b g NONE no. of patients (%) Complete (58) 5 (21) 0 5 (21) deficiency Partial deficiency 26 3 (12) 3 (12) 4 (15) 16 (62) *Four of the 54 patients with a-sarcoglycan deficiency were not tested: 1 with a complete deficiency of a-sarcoglycan and limb-girdle muscular dystrophy, 2 with a partial deficiency and limb-girdle muscular dystrophy, and 1 with a partial deficiency and congenital muscular dystrophy. Volume 336 Number 9 621

5 TABLE 3. SARCOGLYCAN-GENE MUTATIONS IN THE PATIENTS WITH ABNORMAL RESULTS OF a-sarcoglycan IMMUNOSTAINING.* PATIENT NO. A TYPE OF MUTATION CLINICAL DIAGNOSIS CURRENT AGE (YR) LOSS OF ABILITY TO WALK (AGE AT TIME) TYPE OF a-sarcoglycan DEFICIENCY NUCLEOTIDE CHANGE AMINO ACID SUBSTITUTION OR OTHER CONSEQUENCE OF MUTATION Mutation in the a-sarcoglycan gene 3 LGMD 11 No C C229T 4 LGMD NA No C G101A C229T Arg34His 5 DMD-like 9 No C C229T T371C Ile124Thr 6 LGMD 9 No C T371C Ile124Thr 8 DMD-like 11 Yes (10 yr) C T472T Leu158Phe 11 DMD-like 10 No C G586A Val197Ile 12 DMD-like NA Yes (12 yr) C T308C T518C Ile103Thr Leu173Pro 21 LGMD 31 No C C292T C614A Arg98Cys Pro205His 25 LGMD 17 No P T92C C850T Leu31Pro Arg284Cys 33 LGMD 41 No P C850T Arg284Cys 39 DMD-like 15 Yes (12 yr) C C229T 40 LGMD 13 Yes (13 yr) C Duplication of Frame shift 42 DMD-like 14 No P C614A C683A Pro205His Pro228Gln 441 DMD-like 12 No C C229T A290G Asp97Gly 442 LGMD 18 No C G101A Arg34His 443 DMD-like 13 No C C229T C278T Ala93Val 510 LGMD 12 No C C229T Mutation in the b-sarcoglycan gene 2 DMD-like 8 No C C31T A( 2 exon 3)G Gln11Stop Insertion 9 DMD-like 14 Yes (11 yr) C C31G Gln11Glu 10 DMD-like 21 Yes (15 yr) C C341T Ser114Phe 18 DMD-like 13 No P G416A Gly139Stop 29 DMD-like 11 No C Duplication of Frame shift Deletion of Frame shift DMD-like 20 Yes (10 yr) P Duplication of Frame shift DMD-like 4 No C Duplication of T552G Frame shift Tyr184Stop 487 DMD-like 16 Yes (14 yr) P A544G Tyr182Ala Mutation in the g-sarcoglycan gene 7 DMD-like 12 No P Deletion of TG Frame shift at LGMD 10 No P Deletion of T Frame shift at LGMD 23 Yes (17 yr) P Deletion of TC Frame shift at DMD-like 20 Yes (14 yr) P Insertion of T at Frame shift *LGMD denotes limb-girdle muscular dystrophy, DMD-like Duchenne-like muscular dystrophy, C complete, NA not available, not determined, and P partial. The following patients have been described previously: Patient 8 (Fanin et al. 16 ); Patients 441 and 442 (Duggan et al. 15 ); Patient 43 (Bönnemann et al. 9 ); and Patients 7, 19, 26, and 44 (McNally et al. 17 ). Unless otherwise noted, patients for whom only one mutation is listed are homozygous for that mutation. The nucleotides and amino acids are numbered according to the translational reading frames deduced on the basis of data from McNally et al., 23 Bönnemann et al., 9 and Noguchi et al. 8 This patient was the product of a consanguineous union. Single-strand conformation polymorphism analysis showed an aberrant band of exon 2 that could not be sequenced. Mutations were identified with the use of genomic DNA. 622 February 27, 1997

6 MUTATIONS IN THE SARCOGLYCAN GENES IN PATIENTS WITH MYOPATHY tion. This patient probably had a second undetected mutation that prevented the expression of the wildtype allele, allowing only the mutant allele to be detected in the RNA of the muscle. Because all patients with a primary sarcoglycanopathy are assumed to have an autosomal recessive pattern of inheritance with two mutant alleles, Patients 18, 39, and 40 were presumed to have a second, unidentified mutation. One hundred normal chromosomes were examined for all novel mutations, and all tested negative. Thus, among the 50 patients with a deficiency of a-sarcoglycan on immunostaining, mutations in the a-sarcoglycan gene were detected in 17 (34 percent), mutations in the b-sarcoglycan gene were detected in 8 (16 percent), and mutations in the g-sarcoglycan gene were detected in 4 (8 percent). The mean ( SD) age at presentation or the diagnosis of myopathy in the patients with mutations in the a-sarcoglycan gene was 6 4 years; it was 3 2 and 6 4 years, respectively, in the patients with mutations in the b-sarcoglycan and g-sarcoglycan genes. All patients presented with clinical findings that included calf hypertrophy, Gowers sign, and a deficit in motor skills. The mean serum creatine kinase concentrations in the patients with mutations in the a-sarcoglycan, b-sarcoglycan, and g-sarcoglycan genes were 13, , 15,226 12,528, and 16, IU per liter, respectively (normal, 200). DISCUSSION Mutations of any component of the sarcoglycan complex result in the secondary loss of the other components of the complex. Thus, we hypothesized that we could identify patients who were likely to have mutations in the a-, b-, or g-sarcoglycan gene by immunostaining for a-sarcoglycan. Among the 556 patients with normal dystrophin whom we studied, 54 had a deficiency of a-sarcoglycan on immunostaining. Molecular studies were performed in 50 of these 54 patients and revealed that 58 percent had mutations of the a-, b-, or g-sarcoglycan gene. It is therefore clear that a mutation in these genes does not account for all cases of a-sarcoglycan deficiency, even after adjustment for the secondary deficiency of the sarcoglycan complex in Duchenne s and Becker s muscular dystrophies. Some patients with primary sarcoglycan deficiency (that involving a mutation) might have been missed by our use of a-sarcoglycan immunostaining as the initial screening test. However, the available data suggest that we should have identified most if not all patients with sarcoglycan-gene mutations using this approach Previous studies have identified two unrelated families with mutations in the b-sarcoglycan gene and four unrelated families with mutations in the g-sarcoglycan gene; all patients had a-sarcoglycan deficiency in muscle, even though this deficiency was not a criterion for the identification of the study patients. Moreover, the patients with mutations in the b- or g-sarcoglycan gene in this study all had marked reductions in the levels of these proteins on immunostaining (data not shown). We may not have detected all sarcoglycan mutations in the biopsy specimens tested, but we think that this possibility is unlikely. In autosomal recessive disorders there are mutations in both alleles of the particular gene, and if the mutation-detection strategy lacks sensitivity, then only one mutation will be detected in some patients (they will appear to be heterozygous). We found only 4 of 29 patients to be heterozygous in this study, suggesting that the sensitivity of our mutation analysis was approximately 93 percent (54 of 58 possible mutant alleles detected) and that our ability to identify patients with at least one mutant allele exceeded 99 percent. The large number of patients studied allowed us to estimate the frequencies of sarcoglycan-gene mutations in patients with myopathies and normal dystrophin (Table 1). We found a deficiency of a-sarcoglycan protein in 10 percent of patients with normal dystrophin. If we include only patients with Duchenne-like or limb-girdle muscular dystrophy in the analysis, this figure rises to 20 percent. In the patients with a-sarcoglycan deficiency on immunostaining, a complete deficiency (absence of staining) was more specific for mutations in the a-sarcoglycan gene than for mutations in the b- or g-sarcoglycan gene (Table 2). On the other hand, a partial deficiency of a-sarcoglycan on immunostaining was not specific for mutations of any one of the three genes, and the majority (61 percent) of patients with a partial deficiency had no mutations. We, like others, found that patients with a primary sarcoglycanopathy are clinically indistinguishable from those with either Duchenne s or Becker s muscular dystrophy Cognitive function was normal in all patients with sarcoglycan-gene mutations. Although sarcoglycans are normally present in both skeletal and cardiac muscle, there were no electrocardiographic or echocardiographic abnormalities in the seven patients tested. There were differences in the clinical severity, in that all patients with mutations in the b-sarcoglycan gene had severe dystrophy, whereas half those with mutations in the a- or g-sarcoglycan gene had milder disease. Many genes are known to cause muscular dystrophy, including the genes for dystrophin (Duchenne s or Becker s muscular dystrophy), calpain III (limbgirdle muscular dystrophy type 2A), merosin (congenital muscular dystrophy with merosin deficiency), and a-, b-, g-, and d-sarcoglycan (limb-girdle muscular dystrophy types 2D, 2E, 2C, and 2F, respectively). Molecular genetic analyses can now identify the disease-causing mutations in all these genes. The muscular dystrophies characterized by pro- Volume 336 Number 9 623

7 gressive muscle weakness of the pelvic and shoulder girdle (Duchenne s, Becker s, and limb-girdle muscular dystrophies) are a clinically and genetically heterogeneous group of diseases. The elucidation of the genetic defect leading to the dystrophy has implications for the diagnosis and care of affected patients (and their families). Because defects in several genes can cause phenotypically similar clinical and biochemical manifestations, a definitive diagnosis can only be made by testing of candidate genes or proteins. Supported by grants from the National Institutes of Health (NS [to Dr. Hoffman]), the Muscular Dystrophy Association (to Dr. Hoffman), and Telethon Italy (695 [to Ms. Fanin] and 552 [to Dr. Angelini]). Dr. Hoffman is an Established Investigator of the American Heart Association. REFERENCES 1. Tinsley JM, Blake DJ, Zuellig RA, Davies KE. Increasing complexity of the dystrophin-associated protein complex. Proc Natl Acad Sci U S A 1994;91: Worton R. Muscular dystrophies: diseases of the dystrophin-glycoprotein complex. Science 1995;270: Ozawa E, Yoshida M, Suzuki A, Mizuno Y, Hagiwara Y, Noguchi S. Dystrophin-associated proteins in muscular dystrophy. Hum Mol Genet 1995;4: Hoffman EP, Fischbeck KH, Brown RH, et al. Characterization of dystrophin in muscle-biopsy specimens from patients with Duchenne s or Becker s muscular dystrophy. N Engl J Med 1988;318: Hoffman EP, Arahata K, Minetti C, Bonilla E, Rowland LP. Dystrophinopathy in isolated cases of myopathy in females. Neurology 1992;42: Yoshida M, Suzuki A, Yamamoto H, Noguchi S, Mizuno Y, Ozawa E. Dissociation of the complex of dystrophin and its associated proteins into several unique groups by n-octyl b-d-glucoside. Eur J Biochem 1994;222: Roberds SL, Leturcq F, Allamand V, et al. Missense mutations in the adhalin gene linked to autosomal recessive muscular dystrophy. Cell 1994; 78: Noguchi S, McNally EM, Ben Othmane K, et al. Mutations in the dystrophin-associated protein g-sarcoglycan in chromosome 13 muscular dystrophy. Science 1995;270: Bönnemann CG, Modi R, Noguchi S, et al. b-sarcoglycan (A3b) mutations cause autosomal recessive muscular dystrophy with loss of the sarcoglycan complex. Nat Genet 1995;11: Lim LE, Duclos F, Broux O, et al. b-sarcoglycan: characterization and role in limb-girdle muscular dystrophy linked to 4q12. Nat Genet 1995; 11: Piccolo F, Roberds SL, Jeanpierre M, et al. Primary adhalinopathy: a common cause of autosomal recessive muscular dystrophy of variable severity. Nat Genet 1995;10: Passos Bueno MR, Moreira ES, Vainzof M, et al. A common missense mutation in the adhalin gene in three unrelated Brazilian families with a relatively mild form of autosomal recessive limb-girdle muscular dystrophy. Hum Mol Genet 1995;4: Kawai H, Akaike M, Endo T, et al. Adhalin gene mutations in patients with autosomal recessive childhood onset muscular dystrophy with adhalin deficiency. J Clin Invest 1995;96: Ljunggren A, Duggan DJ, McNally E, et al. Primary adhalin deficiency as a cause of muscular dystrophy in patients with normal dystrophin. Ann Neurol 1995;38: Duggan DJ, Fanin M, Pegoraro E, Angelini C, Hoffman EP. a-sarcoglycan (adhalin) deficiency: complete deficiency patients are 5% of childhood-onset dystrophin-normal muscular dystrophy and most partial deficiency patients do not have gene mutations. J Neurol Sci 1996;140: Fanin M, Martinello F, Duggan DJ, et al. A severe case of Duchennelike muscular dystrophy due to a mutation in the a-sarcoglycan (adhalin) gene. Basic Appl Myol 1996;6: McNally EM, Duggan D, Gorospe JR, et al. Mutations that disrupt the carboxyl-terminus of g-sarcoglycan cause muscular dystrophy. Hum Mol Genet 1996;5: McNally EM, Passos-Bueno MR, Bönnemann CG, et al. Mild and severe muscular dystrophy caused by a single g-sarcoglycan gene mutation. Am J Hum Genet 1996;59: Bönnemann CG, Passos-Bueno MR, McNally EM, et al. Genomic screening for b-sarcoglycan gene mutations: missense mutations may cause severe limb-girdle muscular dystrophy type 2E (LGMD 2E). Hum Mol Genet 1996;5: Nigro V, Moreira ES, Piluso G, et al. Autosomal recessive limb-girdle muscular dystrophy, LGMD2F, is caused by a mutation in the deltasarcoglycan gene. Nat Genet 1996;13: Mizuno Y, Yoshida M, Yamamoto H, Hirai S, Ozawa E. Distribution of dystrophin isoforms and dystrophin-associated proteins 43DAG (A3a) and 50DAG (A2) in various monkey tissues. J Biochem 1993;114: Yamamoto H, Mizuno Y, Hayashi K, Nonaka I, Yoshida M, Ozawa E. Expression of dystrophin-associated protein 35DAG (A4) and 50DAG (A2) is confined to striated muscles. J Biochem 1994;115: McNally EM, Yoshida M, Mizuno Y, Ozawa E, Kunkel LM. Human adhalin is alternatively spliced and the gene is located on chromosome 17q21. Proc Natl Acad Sci U S A 1994;91: Ibraghimov-Beskrovnaya O, Ervasti JM, Leveille CJ, Slaughter CA, Sernett SW, Campbell KP. Primary structure of dystrophin-associated glycoproteins linking dystrophin to the extracellular matrix. Nature 1992;355: Ahn AH, Freener CA, Gussoni E, Yoshida M, Ozawa E, Kunkel LM. The three human syntrophin genes are expressed in diverse tissues, have distinct chromosomal locations, and each bind to dystrophin and its relatives. J Biol Chem 1996;271: Mizuno Y, Noguchi S, Yamamoto H, et al. Selective defect of sarcoglycan complex in severe childhood autosomal recessive muscular dystrophy muscle. Biochem Biophys Res Commun 1994;203: Ohlendieck K, Matsumura K, Ionasescu VV, et al. Duchenne muscular dystrophy: deficiency of dystrophin-associated proteins in the sarcolemma. Neurology 1993;43: Mizuno Y, Yoshida M, Nonaka I, Hirai S, Ozawa E. Expression of utrophin (dystrophin-related protein) and dystrophin-associated glycoproteins in muscles from patients with Duchenne muscular dystrophy. Muscle Nerve 1994;17: Spinardi L, Mazars R, Theillet C. Protocols for an improved detection of point mutations by SSCP. Nucleic Acids Res 1991;19: Little S. Amplification-refractory mutation system (ARMS) analysis of point mutations. In: Dracopoli NC, Haines JL, Korf BR, et al., eds. Current protocols in human genetics. New York: John Wiley, 1994: Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16: Pegoraro E, Schimke RN, Garcia C, et al. Genetic and biochemical normalization in female carriers of Duchenne muscular dystrophy: evidence for failure of dystrophin production in dystrophin-competent myonuclei. Neurology 1995;45: February 27, 1997