Sian Ellard, Michael P. Bulman, Timothy M. Frayling, Maggie Shepherd, and Andrew T. Hattersley

Transcription

1 HUMAN MUTATION Mutation in Brief #360 (2000) Online MUTATION IN BRIEF Proposed Mechanism for a Novel Insertion/Deletion Frameshift Mutation (I414G415ATCG CCA) in the Hepatocyte Nuclear Factor 1 Alpha (HNF-1α) Gene Which Causes Maturity-Onset Diabetes of the Young (MODY) Sian Ellard, Michael P. Bulman, Timothy M. Frayling, Maggie Shepherd, and Andrew T. Hattersley Department of Vascular Medicine and Diabetes Research, School of Postgraduate Medicine and Health Sciences, University of Exeter, UK Correspondence to Dr. Sian Ellard, Molecular Genetics Laboratory, Department of Pathology, Royal Devon & Exeter NHS Healthcare Trust, Barrack Road, Exeter EX2 5DW. Communicated by R.G.H. Cotton Maturity-onset diabetes of the young (MODY) is a monogenic subgroup of non-insulin dependent diabetes (NIDDM) characterized by an early age of diagnosis (usually < 25 years) and an autosomal dominant mode of inheritance. Mutations in the hepatocyte nuclear factor 1 alpha (HNF-1α) [MODY3] gene represent the most common cause of MODY in the UK and a common cause of MODY in many other populations. Sixty-three different mutations have been described in a total of 112 families worldwide. This report describes two families, not known to be related, who carry a novel insertion/deletion mutation (I414G415ATCG CCA) and a 6bp intronic deletion of the HNF-1α gene in cis. We propose that the insertion/deletion mutation has arisen by formation of a hairpin loop due to the presence of a quasi-palindromic sequence, followed by insertion of CC and deletion of TCG resulting in the increased stability of the hairpin loop Wiley-Liss, Inc. KEY WORDS: maturity-onset diabetes of the young; MODY; hepatocyte nuclear factor 1-alpha; HNF-1α; transcription factor 1; TCF1 INTRODUCTION Maturity-onset diabetes of the young (MODY) is a monogenic subgroup of diabetes characterized by autosomal dominant inheritance and a young age of onset (usually diagnosed before 25 years of age) (Hattersley 1998; Tattersall 1974). Heterozygous mutations in the genes encoding the glycolytic enzyme glucokinase (Froguel et al. 1992; Hattersley et al. 1992) and the transcription factors, hepatocyte nuclear factor (HNF)-1α (MODY3; MIM# ) (Yamagata et al. 1996b), HNF-4α (MODY1; MIM# ) (Yamagata et al. 1996a), insulin promoter factor (IPF)-1(MODY4; MIM# ), (Stoffers et al. 1997) and HNF-1β (MODY5; MIM# )[Horikawa et al. 1997] have been shown to cause MODY. Received 10 February 2000; Revised manuscript accepted 8 June WILEY-LISS, INC.

2 2 Ellard et al. Mutations in the HNF-1α gene have been shown to be the most common cause of MODY in the UK (Frayling et al. 1997) and a common cause of MODY in German (Kaisaki et al. 1997), Danish (Hansen et al. 1997), Italian (Gragnoli et al. 1997), Finnish (Glucksmann et al. 1997), North American (Glucksmann et al. 1997) and Japanese (Iwasaki et al. 1997) pedigrees. A total of 63 different mutations have been reported in 112 MODY families (Ellard 2000, Mutation Update submitted). These include 15 small (less than 5bp) insertion or deletion mutations, all of which result in frameshifts. Many of these mutations are located within repetitive sequences of the HNF-1α gene and may have arisen as a result of slipped mispairing during DNA replication (Darvasi and Kerem 1995). Complex mutations which involve the deletion of bases at the site of an insertion mutation and result in a net gain or loss of bases are described as indels. These mutations are rare; only 149 indel mutations have been reported in a total of 94 genes, representing 0.76% of the mutations on the Human Gene Mutation Database (Krawczak and Cooper 1997). Here we report the first indel mutation in the HNF-1α gene and suggest a mechanism by which it may have arisen. MATERIALS AND METHODS Subjects The families were recruited to the BDA Warren MODY collection since they fulfilled the selection criteria for MODY (non-insulin dependent diabetes diagnosed before the age of 25 years in at least one family member and clear autosomal dominant inheritance)(hattersley 1998). The study was approved by the local ethics committee and conducted in accordance with the Declaration of Helsinki principles. Mutation analysis of the HNF-1α gene Genomic DNA was extracted from peripheral lymphocytes using a Nucleon DNA extraction kit (Scotlab, Coatbridge, UK). The coding regions of the 10 exons and the intron/exon boundaries of the HNF-1α gene were amplified by PCR using the primers described by Yamagata (Yamagata et al. 1996b). PCR products were purified using QIAquick PCR purification columns (Qiagen, Crawley, UK) and both strands sequenced using a BigDye Terminator Cycle Sequencing kit (PE Biosystems, Warrington, UK) according to the manufacturer s recommendations. Reactions were analyzed on an ABI Prism TM 377 DNA Sequencer (PE Biosystems, Warrington, UK). Segregation analysis of the HNF-1α variants Fluorescently labeled PCR products were generated by using a FAM-labeled exon 6 forward primer ( 5 - ACAGCACTGCACAGCTTGGAGCAG-3 ). Two reverse primers were employed; Indel-R 5 - GTTTCCTGTGTTGGTGAACGTAGGA-3 and Indel + intronic deletion-r 5 - GTTTGAATGAATGAGTCCCAGTGGCT-3. A 5 GTTT PIGtail was added to both reverse primers. This modification results in the consistent addition of a non-templated A to the 3 end of the labeled PCR product, therefore greatly reducing the problem of 1 bp stutter and enabling the detection of 1 bp deletions (Brownstein 1996). The products were analyzed on an ABI Prism TM 377 DNA Sequencer (PE Biosystems, Warrington, UK) and length differences between normal and mutant alleles were detected using Genescan and Genotyper software (PE Biosystems, Warrington, UK). Intragenic polymorphism analysis Exon 2 PCR products from affected members of both families were sequenced and haplotypes were constructed using the intragenic polymorphisms within this region (Intron 1 nt-91 A G, nt-52 T G, nt-42 G A and codon 126 CAC CAT) by inspection of segregation patterns and assuming a minimal number of crossovers. RESULTS AND DISCUSSION Sequencing of the sense strand of the exon 6 PCR product from the proband of family BDA95 revealed a frameshift from codon 415 (Figure 1a). Examination of the electropherogram revealed a simultaneous insertion of CC and deletion of TCG with a net 1bp deletion (I414G415ATCG CCA). This frameshift is predicted to lead

3 Proposed Mechanism for a Novel Indel Frameshift Mutation in the HNF-1α Gene 3 to premature termination at codon 457. The antisense strand was frameshifted from IVS6nt+5 (Figure 1b) due to a 6bp deletion (GCTGGT) within intron 6 (IVS6nt+5del6). a C T T C C TG G G G TC A T G A CC M Y MG G S C Y KG K K RR S C Y K Y b C ATGAGCCT CC A CCCA GT GCCCACCCA T CCCCWYMMSSWTRM C Figure 1. Electropherograms showing (a) I414G415ATCG CCA and (b) IVS6nt+5del6. Both the insertion/deletion mutation and the 6bp intronic deletion co-segregated with diabetes within the family (pedigree shown in Figure 2). This co-segregation of the two variants suggested that they were present on the same chromosome (in cis). In order to investigate this hypothesis, primers were designed to amplify (a) from codons 384 to 430 of exon 6 which includes the site of the indel mutation but excludes the intronic deletion and (b) from codon 384 of exon 6 to nt+95 of intron 6 which includes both the indel mutation and the intronic deletion. The unaffected family members (BDA95/04 and BDA95/06) were homozygous for products of 145bp (indel primers) and 257bp (indel + intron deletion primers). The affected sisters (BDA95/01, BDA95/02) and their niece (BDA95/03) were heterozygous for products of 144bp (indel allele) and 145bp (normal allele) using the indel primers and two products of 250bp (indel plus intronic deletion allele) and 257bp (normal allele) with the indel + intron deletion primers. These data confirm that the indel mutation and the intronic 6bp deletion are present on the same chromosome.

4 4 Ellard et al NN 06 NN Figure 2. Pedigree of family BDA95. Solid symbols represent affected and open symbols unaffected individuals, respectively. The HNF-1α genotype of each individual tested is indicated: N - normal; M - I414G415ATCG CCA and IVS6nt+5del6. A second family, BDA226, was found to carry the same exonic indel and intronic deletion mutations (see Figure 3 for pedigree) which co-segregated with diabetes. This family was one of the initial 3 families described by Tattersall in 1974 (Tattersall 1974). Examination of 4 intragenic polymorphisms (Frayling et al. 1997; Yamagata et al. 1996b) is consistent with a founder effect, although tracing descendents through four previous generations of both families has not revealed a common ancestor NN 02 Figure 3. Pedigree of family BDA226 (family R from Tattersall 1974). Solid symbols represent affected and open symbols unaffected individuals, respectively. The HNF-1α genotype of each individual tested is indicated: N - normal; M - I414G415ATCG CCA and IVS6nt+5del6.

5 Proposed Mechanism for a Novel Indel Frameshift Mutation in the HNF-1α Gene 5 Indel mutations may be mediated by quasi-palindromic sequences which form imperfect hairpin loop structures (Ripley 1982). The misaligned bases in these structures may then provide templates for either deletions (by endonucleolytic base excision) or insertions (by gap repair). We propose that the insertion/deletion mutation I414G415ATCG CCA results from the formation of an imperfect hairpin loop due to the presence of a quasipalindromic sequence in exon 6 of the HNF-1α gene (Figure 4). The hairpin loop is subsequently modified to produce the perfect hairpin loop structure and consequently the mutation by insertion of CC and deletion of the sequence TCG. Quasi-palindromic sequence TTCCTGGGGTCATGACCATCGGGG Hairpin loop A T T A G G T A T C G T T CCT Insertion / deletion A T T A inscc T A deltcg T T CCT Figure 4. Proposed mechanism for the insertion/deletion frameshift mutation I414G415ATCG CCA. Exon 6 of the HNF-1α gene appears to represent a hotspot for insertion and deletion mutations since of the 8 mutations reported to date in this exon, 6 are frameshifts (75%) compared to a frequency of 17% (9/52) frameshift mutations throughout the remainder of the gene. In this report we have described the first indel mutation in HNF-1α gene and proposed a mechanism by which it may have arisen. REFERENCES Brownstein MJ, Carpten, John D. and Smith, Jeffrey R Modulation of Non-Templated Nucleotide Addition by Taq DNA polymerase: Primer Modifications that Facilitate Genotyping. Biotechniques 20: Darvasi A, Kerem B Deletion and insertion mutations in short tandem repeats in the coding regions of human genes. European Journal of Human Genetics 3: Frayling T, Bulman MP, Ellard S, Appleton M, Dronsfield M, Mackie A, Baird J, Kaisaki P, Yamagata K, Bell G, Bain S, Hattersley A Mutations in the Hepatocyte Nuclear Factor 1 Alpha gene are a common cause of maturity-onset diabetes of the young in the United Kingdom. Diabetes 46: Froguel P, Vaxillaire M, Sun F, Velho G, Zouali H, Butel MO, Lesage S, Vionnet N, Clement K, Fougerousse F, Tanizawa Y, Weissenbach J, Beckmann JS, Lathrop GM, Passa P, Permutt MA, Cohen D Close linkage of glucokinase locus on chromosome 7p to early-onset non-insulin-dependent diabetes mellitus. Nature 356:

6 6 Ellard et al. Glucksmann MA, Lehto M, Tayber O, Scotti S, Berkemeier L, Pulido C, Wu Y, Nir W-J, Fang L, Markel P, Munnelly KD, Goranson J, Orho M, Young BM, Whitacre JL, McMenimen C, Wantman M, Tuomi T, Warram J, Krolewski AS, Groop LC, Thomas JD Novel mutations and a mutational hotspot in the MODY3 gene. Diabetes 46: Gragnoli C, Lindner T, Marozzi G, Andreani D Disruption of the HNF-4α promoter in an Italian family with MODY. Diabetologia 40: A7. Hansen T, Eiberg H, Rouard M, Vaxillaire M, Moller AM, Rasmussen SK, Fridberg M, Urhammer SA, Holst JJ, Almind K, Echwald SM, Hansen L, Bell GI, Pedersen O Novel MODY3 Mutations in the Hepatic Nuclear Factor-1α Gene. Diabetes 46: Hattersley Maturity-onset diabetes of the young: clinical heterogeneity explained by genetic heterogeneity. Diabetic Medicine 15: Hattersley AT, Turner RC, Permutt MA, Patel P, Tanizawa Y, Chiu KC, O'Rahilly S, Watkins PJ, Wainscoat JS Linkage of type 2 diabetes to the glucokinase gene. Lancet 339: Horikawa Y, Iwasaki N, Hara M, Furuta H, Hinokio Y, Cockburn B, Lindner T, Yamagata K, Ogata M, Tomonaga O, Kuroki H, Kasahar T, Iwamoto Y, Bell GI Mutation in hepatocyte nuclear factor-1β gene (TCF2) associated with MODY. Nature Genetics 17: Iwasaki N, Oda N, Ogata M, Hara M, Hinokio Y, Oda Y, Yamagata K, Kanematsu S, Ohgawara H, Omori Y, Bell GI Mutations in the Hepatocyte Nuclear Factor-1α/MODY3 gene in Japanese subjects with early- and late-onset NIDDM. Diabetes 46: Kaisaki PJ, Menzel S, Lindner T, Oda N, Rjasanowski I, Sahm J, Meincke G, Schulze J, Schmechel H, Petzold C, Ledermann HM, Sachse G, Boriraj VV, Menzel R, Kerner W, Turner RC, Yamagata K, Bell GI Mutations in the Hepatocyte Nuclear Factor 1 α Gene in MODY and Early-onset NIDDM : Evidence for a Mutational Hotspot in Exon 4. Diabetes 45: Krawczak M, Cooper D The Human Gene Mutation Database. Trends in Genetics 13: Stoffers DA, Ferrer J, Clarke WL, Habener JF 1997 Early-onset type-ii diabetes mellitus (MODY4) linked to IPF1. Nature Genetics 17: Tattersall RB Mild familial diabetes with dominant inheritance. Q J Med 43: Yamagata K, Furuta H, Oda N, Kaisaki PJ, Menzel S, Cox NJ, Fajans SS, Signorini S, Stoffel M, Bell GI 1996a. Mutations in the hepatocyte nuclear factor 4 alpha gene in maturity-onset diabetes of the young (MODY1). Nature 384: Yamagata K, Oda N, Kaisaki PJ, Menzel S, Furuta H, Vaxillaire M, Southam L, Cox RD, Lathrop GM, Boriraj VV, Chen X, Cox NJ, Oda Y, Yano H, Le Beau MM, Yamada S, Nishigori H, Takeda J, Fajans SS, Hattersley AT, Iwasaki N, Pedersen O, Polonsky KS, Turner RC, Velho G, Chevre J-C, Froguel P, Bell GI 1996b. Mutations in the hepatic nuclear factor 1 alpha gene in maturity-onset diabetes of the young (MODY3). Nature 384: