X/01/$03.00/0 Vol. 86, No. 1 The Journal of Clinical Endocrinology & Metabolism Copyright 2001 by The Endocrine Society

Transcription

1 X/01/$03.00/0 Vol. 86, No. 1 The Journal of Clinical Endocrinology & Metabolism Printed in U.S.A. Copyright 2001 by The Endocrine Society Early-Onset Type 2 Diabetes: Metabolic and Genetic Characterization in the Mexican Population* CARLOS A. AGUILAR-SALINAS, EDUARDO REYES-RODRÍGUEZ, MA. LUISA ORDÓÑEZ-SÁNCHEZ, MARCELO ARELLANO TORRES, SALVADOR RAMÍREZ-JIMÉNEZ, AARÓN DOMÍNGUEZ-LÓPEZ, JUAN RAMÓN MARTÍNEZ-FRANCOIS, MA. LUISA VELASCO-PÉREZ, MELCHOR ALPIZAR, EDUARDO GARCÍA-GARCÍA, FRANCISCO GÓMEZ-PÉREZ, JUAN RULL, AND MA. TERESA TUSIÉ-LUNA Departmento de Medicina y Unidad de Genética de la Nutrición del Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México (M.L.O.-S., S.R.-J., A.D.-L., J.R.M.-F., M.T.T.-L.); Departamento de Endocrinología y Metabolismo de Lípidos del Instituto Nacional de Ciencias Médicas y Nutrición (C.A.A.-S., E.R.-R., M.A.T., M.L.V.-P., E.G.-G., F.G.-P., J.R.); and Instituto Mexicano del Seguro Social (M.A.), Mexico City 14000, Mexico ABSTRACT The objective of this study was to investigate possible defects in the insulin sensitivity and/or the acute insulin response in a group of Mexican patients displaying early-onset type 2 diabetes and to evaluate the contribution of mutations in three of the genes linked to maturity-onset diabetes of the young. We studied 40 Mexican patients with an age of diagnosis between 20 and 40 yr in which the insulin sensitivity as well as the insulin secretory response were measured using the minimal model approach. A partial screening for possible mutations in 3 of the 5 genes linked to maturity-onset diabetes of the young was carried out by PCR-single strand conformation polymorphism analysis. A low insulin secretory capacity (AIRg U/mL min) and a near-normal insulin sensitivity ( min/ U ml 10 4 ) were found in these patients. Among this group we found two individuals carrying missense mutations in exon 4 of the TYPE 2 DIABETES mellitus is one of the major health and socio-economic problems worldwide, with a prevalence as high as of 8% in the Mexican population. In Mexico, according to a 1993 National Survey it was calculated that almost 1.9 million subjects were affected by type 2 diabetes; 300,000 of them were diagnosed at age yr old (1). The socioeconomic and biological consequences of the early onset of type 2 diabetes are enormous. A large number of temporal or definitive incapacities before age 50 yr results from this characteristic of the disease. Also, these subjects frequently exhibit a more aggressive form of the disease, require insulin treatment at earlier time, and suffer from severe chronic complications (2). This subset of patients, generally refereed as early onset type 2 diabetes, is likely to represent an heterogeneous group. Maturity-onset diabetes of the young (MODY), a monogenic form of diabetes due to deficient Received April 25, Revision received August 10, Accepted October 2, Address all correspondence and requests for reprints to: Carlos Alberto Aguilar-Salinas, M.D., or Ma. Teresa Tusié-Luna, M.D., Ph.D., Vasco de Quiroga 15, Mexico City 14000, Mexico. caas@ aztlan.innsz.mx. * This work was supported by Grant IN from the Dirección General de Asuntos del Personal Académico, UNAM. hepatocyte nuclear factor-1 (HNF-4 ) gene (Asp 126 3His/Tyr and Arg 154 3Gln, respectively) and one carrying a nonsense mutation in exon 7 of the HNF-1 gene (Gln 486 3stop codon); 7.5% had positive titers for glutamic acid decarboxylase antibodies. Thirty-five percent of cases had insulin resistance; these subjects had the lipid abnormalities seen in the metabolic syndrome. A defect in insulin secretion is the hallmark in Mexican diabetic patients diagnosed between 20 and 40 yr of age. Mutations in either the HNF-1 or the HNF-4 genes are present among the individuals who develop early-onset diabetes in our population. These particular sequence changes have not been previously reported and therefore represent putative new mutations. Even in the absence of endogenous hyperinsulinemia, insulin resistance is associated with an adverse lipid profile. (J Clin Endocrinol Metab 86: , 2001) insulin secretion (3), is present in a proportion of patients who develop the disease at early age (usually before 25 yr of age). On the other hand, Doria and co-workers described the presence of insulin resistance in a large proportion of earlyonset patients from families not linked to any known MODY genes (4). Finally, some cases may correspond to a late-onset autoimmune diabetes. Mutations in the genes encoding hepatocyte nuclear factor- 4 (HNF-4 ) (5), glucokinase (6), HNF-1 (7), insulin promoter factor-1 (8), and HNF-1 (9) are linked to MODY. Clinical heterogeneity is well established among MODY patients. Those with mutations in the glucokinase gene (MODY 2) present a mild hyperglycemia, good glycemic control without the need for insulin, and rare or null appearance of vascular complications (10). In contrast, patients carrying mutations in the HNF-4 or the HNF-1 genes (MODY 1 and MODY 3, respectively) exhibit severe fasting hyperglycemia, a high percentage of insulin requirement, and a frequent occurrence of microvascular complications (11, 12). Different studies suggest that the prevalence of mutations in these genes differs considerably among various ethnic groups (13, 14). Very few papers had focused their attention on characterization of the metabolic and genetic abnormalities ob- 220

2 METABOLIC AND GENETIC CHARACTERIZATION OF EARLY-ONSET TYPE 2 DIABETES 221 served in patients with type 2 diabetes diagnosed at age yr. We believe that early-onset type 2 diabetes would be a useful model to study the metabolic consequences of the interaction of several degrees of insulin resistance and insulin deficiency in a group of subjects in whom the confounding effect of different ages is not present. The purpose of this study is to describe the metabolic and genetic abnormalities found in a group of type 2 diabetic patients diagnosed at age yr. Subjects Subjects and Methods Forty diabetic patients diagnosed between 20 and 40 yr of age were included in the study. They were recruited from the out-patient clinic of the Department of Endocrinology and Metabolism of the Instituto Nacional de la Nutrición Salvador Zubirán in Mexico City. Patients with type 1 or 2 diabetes were also included as controls (20 in each group). All cases were found among the patients who attended the clinic during a 3-month period. Diabetes was classified according the National Diabetes Data Group criteria (15). Exclusion criteria included plasma creatinine more than 265 mol/l, nephrotic syndrome, or the presence of any acute disorder during the 4 weeks previous to the evaluation. Informed consent was obtained from all participants through their attending physicians. Metabolic studies The evaluation included the measurement, after a 12-h fasting, of glucose, creatinine, uric acid, blood count, hemoglobin A 1c, thyroid and hepatic function tests, C peptide, anti-glutamic acid decarboxylase (GAD) antibody titers, lipid profile, apolipoprotein A1 (apoa1), apob, apo(a), high density lipoprotein (HDL), and low density lipoprotein (LDL) subclasses and Lp(a) concentrations in every individual. In addition, an insulin-modified iv glucose tolerance test was performed only in the early-onset type 2 group (16). Three blood samples were obtained, at 10, 5, and 0 min, for basal serum glucose and insulin determinations. The mean values for the three samples were taken as basal levels. Thereafter, 0.3 g/kg glucose (50 ml 50% dextrose water) were infused over a 1-min period, followed by iv insulin (0.05 U/kg) dissolved in 30 ml 0.9% normal saline 19 min later, over a 1-min period. Twelve blood samples were obtained at frequent intervals for serum glucose and insulin levels. Samples were centrifuged at 4 C, and the sera were frozen and stored at 20 C until assayed. The insulin sensitivity index (S I ; 10 4 min/ U ml) and the acute insulin response (AIRg; microunits per ml/min) were estimated using the minimal model software program described by Bergman (17). Genetic studies For mutation screening, total genomic DNAs were extracted from whole blood as previously described (18). PCR-single strand conformation polymorphism (SSCP) analysis was performed to screen for the presence of possible mutations within the exons and the intron-exon junctions of the glucokinase, HNF-4, or HNF-1 genes. The search was focused on those exons with the highest prevalence of mutations reported for each of these genes (19). The primer sequences and the annealing temperature for each of the analyzed exons are shown in Table 2. PCR amplifications were performed in the presence of [ - 32 P]CTP. For the SSCP analysis the PCR products were denatured at 95 C in a solution containing 95% formamide and run in 6% acrylamide gels in the presence or absence of 10% glycerol at 2 8 watts for h as previously described (20, 21). To determine whether a change in migration corresponded to a possible mutation or represented a sequence polymorphism, a group of 110 healthy individuals was analyzed in parallel. In the SSCP analysis a PCR fragment containing a putative mutation will display a migration pattern not observed among the control individuals. Those fragments with an anomalous migration pattern were further analyzed by direct sequencing by either automatic or manual methods. For manual sequencing the Sequenase version 2.0 kit was used. Automated sequencing was performed using an Applied Biosystem 310 sequencer from Perkin-Elmer Corp. (Foster City, CA), according to the manufacturer s specifications. Methods The laboratory of the Department of Endocrinology and Metabolism of the Instituto Nacional de la Nutrición performed all lipid and clinical laboratory measurements using standardized procedures. This laboratory is certified for standardization of the tests by the External Comparative Evaluation of Laboratories Program of the College of American Pathologist. Blood samples were taken after an overnight fast (9 12 h). All laboratory analysis was performed with commercially available standardized methods. Glucose was measured using the glucose oxidase method. Hemoglobin A 1c using latex immunoagglutination inhibition (Bayer Corp., Tarrytown, NY). Total serum cholesterol and triglycerides were measured using an enzymatic method [SERA-PAK; coefficient of variation, 3.3%). HDL cholesterol was precipitated with fosfotungstic acid and Mg 2 (coefficient of variation, 2.5%). The LDL cholesterol concentration was estimated using the Friedewald formula. Direct LDL cholesterol was determined by ultracentrifugation ( quantification) at baseline and at the end of the treatment and in every patient in which triglyceride levels were above 400 mg/dl. The apob concentration was measured by an immunonephelometric method. Insulin concentrations were estimated using an enzyme-linked immunosorbent assay method. C Peptide levels were measured by a RIA procedure. LDL subclass isolation was performed using a density gradient ultracentrifugation method using a Beckman Coulter, Inc. (Palo Alto, CA), SW40 Ti rotor (22). The cholesterol concentration of the HDL subfractions were measured using a double precipitation assay. The GAD antibody titers were measured using a ELISA method. Statistical analysis Results are expressed as the mean sd. Differences between groups were evaluated using the Kruskal-Wallis test. Statistical analysis was performed with the Stata, statistics/data analysis version 5.0. All testing was two sided and conducted at a 5% level of significance. Results The general characteristics of the studied population are shown in Table 1. Eighty percent of the cases had a low income and lived in the Mexico City. Type 1 and 2 diabetic controls were very representative of the vast majority of patients affected by these disorders. In the early-onset type 2 diabetes, the mean age at diagnosis was 28 yr. The majority of the patients were lean at the time of evaluation [body mass index (BMI), kg/m 2 ] and required insulin treatment. Seventy-three percent had a first degree relative who had also type 2 diabetes; only 20% of them had a history of diabetes in both parental lines. Significant differences were found between the early-onset group and the type 2 diabetes cases in BMI, percentage of cases who required insulin treatment, and fasting triglyceride concentrations. The earlyonset group required insulin several years later than the type 1 diabetics. Insulin sensitivity and secretion Insulin secretion was assessed measuring the fasting C peptide concentrations and the acute insulin response during the minimal model (AIRg). As shown in Table 1, the fasting C peptide concentrations of the early-onset type 2 groups were different from the type 1 and 2 patients. Their C peptide levels were intermediate between the other two groups. In the early-onset type 2 group, all cases had either low (72%) or inappropriately normal (28%) concentration (reference range, nmol/l). The insulin secretory defect ob-

3 222 AGUILAR-SALINAS ET AL. JCE&M 2001 Vol. 86 No. 1 TABLE 1. Clinical characteristics of the type 1, type 2, and early-onset type 2 diabetic subjects Type 1 (n 20) Early-onset type 2 (n 40) Type 2 (n 20) P value Age (yr) Sex (male/female) 9/11 11/29 11/9 NS Age at diagnosis (yr) BMI (kg/m 2 ) a b Insulin treatment (%) 100 a 87 b Time during which insulin therapy was required (yr) a,b a,c b,c Glucose (mmol/l) a a HbA 1c (%) a a Cholesterol (mmol/dl) NS Triglycerides (mmol/dl) a HDL cholesterol (mmol/l) NS C Peptide (nmol/l) a a a Vs. type 2 group. b Vs. early-onset type 2 group. c Vs. type 1 group. TABLE 2. Oligonucleotides used for the amplification and sequencing of the corresponding exons for the glucokinase, TCF-14, and the TCF-1 genes Gen Exon S A AT bp TCF-14 (MODY 1) E4 CCACCCCCTACTCCATCCCTGT CCCTCCCGTCAGCTGCTCCA 68 C 272 E7 GCACCAGCTATCTTGCCAAC AGGAGAAGTCTGGCAGAGCG 66 C 285 GCK (MODY 2) E4 TAGCTTGGCTTGAGGCCGTG TGAAGGCAGAGTTCCTCTGG 63 C 271 E7 AGTGCAGCTCTCGCTGACAG CATCTGCCGCTGCACCAGAG 62 C 315 TCF-1 (MODY 3) E2 CATGCACAGTCCCCACCCTCA CTTCCAGCCCCCACCTATGAG 68 C 384 E3 GGGCAAGGTCAGGGGAATGGA CAGCCCAGACCAAACCAGCAC 68 C 306 E4 CAGAACCCTCCCCTTCATGCC GGTGACTGCTGTCAATGGGAC 66 C 404 E6 TGGAGCAGTCCCTAGGGAGGC GTTGCCCCATGAGCCTCCCCAC 66 C 320 E7 GGTCTTGGGCAGGGGTGGGAT CTGGAATGCCTGCCAGGCACC 68 C 345 E9 CCTCTGACAGAGCCCCTCACC AGGACAGCAACAGAAGGGGTG 69 C 286 The sequences of the primers used for amplification, the annealing temperatures used for each primer pair, and the lengths of the corresponding amplification fragment are shown. S, Sense; A, antisense; AT, annealing temperature. served in this group was confirmed during the insulinmodified iv glucose tolerance test. The mean AIRg was U/mL. An AIRg lower than 100 U/mL, a cut-off point used for severe insulin deficiency (23), was found in 34 of the 40 cases. Insulin sensitivity was measured using the sensitivity index (SI) obtained during the insulin-modified iv glucose tolerance test. The mean SI of the early-onset type 2 group was (normal range, 4 6) (24, 25). Thirteen patients (32.5%) had a SI below 4; these cases were classified as insulin resistant. GAD antibodies Three cases (7.5%) had positive titers for GAD antibodies in the early-onset type 2 group. All GAD-positive subjects had a C peptide below 0.12 pmol/ml, an AIRg below 100, and a SI above 3. Their BMI was kg/m 2 ; insulin treatment was required in all three cases (as a mean, yr after the diagnosis). Search for HNF-1 and -4 and glucokinase mutations In the early-onset type 2 diabetes group, we identified two individuals carrying missense mutations in exon 4 of the HNF-4 gene (Asp 126 3His/Tyr and Arg 154 3Gln, respectively) and one carrying a nonsense mutation in exon 7 of the HNF-1 gene (Gln 486 3stop codon). Segregation analysis of possible mutations in HNF-1 and HNF-4 could not be performed in any case, because family members were not available. The biochemical and clinical profiles of patients with detected mutations are shown in Table 3. Two of these patients have very low plasma C peptide concentration, all three required insulin within the first 5 yr from diagnosis and have a normal lipid profile. None of them is obese. These patients displayed chronic diabetic complications. Patient 1, carrying the nonsense mutation at the codon 486 of the HNF-1 gene, presented ketoacidosis at the time of diagnosis and developed nonproliferative retinopathy as has been described for patients carrying mutations in the MODY3 gene (11) (12). It is interesting that patient 3 who has a double substitution in codon 126 Asp3His/Tyr in the HNF-4 gene developed neuropathy 2 yr after diagnosis, suggesting a more aggressive form of diabetes compared with the other two patients with detected mutations who presented complications yr after the onset of the disease. Through clinical questioning, the familial history of diabetes of these three patients was investigated. Two of the individuals belonged to pedigrees compatible with an autosomal dominant inheritance (patients 1 and 2 from Table 3; Fig. 1), suggesting that they represent MODY patients. In contrast, the pedigree for patient 3 does not present a clear dominant pattern of inheritance, and in addition, this patient carries positive anti-gad antibodies and presents a clinical history of Graves disease. None of the sequence changes we identified have been pre-

4 METABOLIC AND GENETIC CHARACTERIZATION OF EARLY-ONSET TYPE 2 DIABETES 223 TABLE 3. Clinical and biochemical characteristics of the patients with HNF 1 or HNF4 mutations Characteristic Patient 1 Patient 2 Patient 3 Genotype HNF1 HNF4 HNF4 Gln stop codon Arg Gln Asp His/Tyr Gender Female Male Female Age at diagnosis (yr) Yr after diagnosis Probable pattern of inheritance Autosomal dominant Autosomal dominant Not defined BMI (kg/m 2 ) Treatment Insulin Insulin Insulin Fasting plasma glucose (mmol/l) HbA 1c (%) Minimal model SI (min/ U ml 10 4 ) AIRg ( U/mL) Complications Nonproliferative retinopathy Sensorimotor polineuropathy Sensorimotor polineuropathy GAD s antibodies Negative Negative Positive C Peptide (nmol/l) Cholesterol (mmol/l) LDL cholesterol (mmol/l) HDL cholesterol (mmol/l) Triglycerides (mmol/l) LDL pattern A B A HDL2 cholesterol (mmol/l) HDL3 cholesterol (mmol/l) Apolipoprotein AI (g/l) Apolipoprotein B (g/l) Lipoprotein(a) (mg/dl) FIG. 1. Pedigrees corresponding to the three patients with detected mutations. Familial history of diabetes was investigated through clinical questioning. Patients 1 and 2 showed pedigrees compatible with autosomal dominant inheritance. viously reported in other populations and therefore represent putative new mutations. Lipoprotein abnormalities The plasma lipid profile of the early-onset type 2 group was different from the type 2 patients. They had significantly lower plasma triglycerides and higher HDL cholesterol levels. No statistical differences were found against the type 1 patients. Impact of insulin resistance on clinical parameters in the early-onset type 2 group The presence of insulin resistance had a significant impact on the lipid profile and blood pressure. As shown in Table 4, cases with a SI below 4 had significantly higher concentrations of plasma trigylcerides and LDL cholesterol; the predominance among the LDL particles of the smaller and denser LDL subclasses were also more common in these subjects. The insulin-resistant cases also had lower levels of HDL and HDL3 cholesterol and lipoprotein(a). A striking difference was observed in the prevalence of arterial hypertension between the insulin-sensitive (0%) and insulin-resistant (30%) subjects. The mean systolic blood pressure was significantly higher in the insulin-resistant group. Discussion About 15% of type 2 diabetic patients in Mexico are diagnosed between 20 and 40 yr of age. We have here described

5 224 AGUILAR-SALINAS ET AL. JCE&M 2001 Vol. 86 No. 1 TABLE 4. Clinical characteristics of insulin-sensitive and insulin-resistant early-onset type 2 diabetic subjects Insulin resistant (SI 4; n 13) Insulin sensitive (SI 4; n 27) P value Age (yr) NS Sex (male/female) 8/5 21/6 NS BMI (kg/m 2 ) NS Insulin treatment (%) NS Insulin dose (U/day) NS HbA 1c (%) NS Cholesterol (mmol/l) NS Triglycerides (mmol/l) HDL cholesterol (mmol/l) LDL cholesterol (mmol/l) HDL2 cholesterol (mmol/l) NS HDL3 cholesterol (mmol/l) Lipoprotein(a) (mg/dl) Dense LDL predominance (%) Apoprotein B (g/l) NS Systolic blood pressure (mm Hg) Diastolic blood pressure (mm Hg) Arterial hypertension (%) a a Arterial hypertension is defined as a blood pressure of 140/90 or greater. a group of Mexican diabetic patients who presented as diabetics at age yr, but subsequently displayed atypical metabolic features of type 2 diabetes. The genetic pattern, the early insulin requirement, the lack of insulin dependence for some few years, and the type of onset are clinical patterns difficult to include in a single type of diabetes. Similar cases have been described in other ethnic groups, including African-American, Chinese, and Native American (26, 27) subjects. Several degrees of insulin deficiency or insulin resistance have been described in these cases (28). Also, mutations affecting the glucokinase and the HNF-1 genes have been reported (29, 30). Our main purpose was to describe some of the genetic and metabolic characteristics observed in Mexican patients with type 2 diabetes diagnosed between ages 20 and 40 yr. Insulin resistance has been implicated as one of the main determinants of type 2 diabetes, especially in Mexican Americans. However, several groups have previously reported that even in subjects older than 40 yr, some patients with type 2 diabetes are not insulin resistant (31 36). The proportion was lower than 10% in every ethnic group (including Mexican Americans) analyzed in the Insulin Resistance Atherosclerosis Study project (31). Even in nonobese subjects (BMI, 30 kg/m 2 ) the proportion of insulin-sensitive cases was low ( %). A greater proportion ( 40%) of insulin-sensitive cases was reported by Banerji (32) and Chaiken (33). Those who were insulin sensitive had lower BMI, less intraabdominal fat (34), and fewer cardiovascular risk factors. In the early-onset cases here reported, a striking feature was a deficient insulin secretion and a near-normal insulin sensitivity. Eighty-five percent of them had severe insulin deficiency during the insulin-modified iv glucose tolerance test. This finding is in accordance with other reports in young type 2 diabetics (28). The absence of insulin resistance in a large proportion of the cases and the demonstration of insulin deficiency in almost every case suggest that insulin deficiency is the main abnormality responsible for the premature presentation of diabetes in this group. There seems to be multiple causes of the insulin deficiency. The presence of markers of autoimmune destruction of the -cells was observed in 7.5% of the cases. Also, mutations in the HNF-1 and HNF-4 genes were identified among our group of patients. Two of the subjects with detected mutations are likely to represent MODY individuals, suggesting that this monogenic type of diabetes is present in at least 3% of the early-onset cases in our population. However, in the vast majority of the cases, the reason for the severe insulin deficiency was not identified. It is possible that mutations exist within the exons and/or introns of the HNF-1, HNF-4, or glucokinase genes, which were not analyzed in the present study. Also, it might be possible that the other known MODY genes (insulin promoter factor-1 and HNF-1 ) as well as other as yet unidentified genes contribute to the expression of early-onset diabetes in our population. The absence of mutations within the exons analyzed for the glucokinase gene is consistent with a previous study in which glucokinase mutations were not found among 22 Mexican families displaying early-onset type 2 diabetes, including MODY families in which the analysis included the entire gene (37). HNF-1 mutations have been identified in subjects with early-onset type 2 diabetes in different populations. However, the frequency of such mutations varies widely among ethnic groups. They were found in 9 of 25 unrelated earlyonset diabetics from Germany (13). In contrast, mutations were present in less than 5% of the early-onset type 2 patients in Northern Europe, and none was found in the Japanese population (13, 38, 39). In the report by Lehto and co-workers (13), they studied a population of 155 unrelated individuals with early-onset diabetes. Among this group, they found 12 different MODY mutations (2 in the HNF4, 4 in glucokinase, and 6 in the HNF-1 genes), corresponding to a prevalence of around 13.8% of MODY cases. Additionally, in about 40% of their families with a transmission pattern compatible with autosomal dominant, none of the MODY genes seemed to be responsible, implying the involvement of different genes in a high proportion of the families. It is interesting that in our study every patient displayed insulin deficiency regardless of the low proportion of them with positive anti-gad an-

6 METABOLIC AND GENETIC CHARACTERIZATION OF EARLY-ONSET TYPE 2 DIABETES 225 FIG. 2. Schematic representation of the HNF-4 gene, showing the sites for known and new mutations. Previously reported mutations are shown below each of the corresponding exons in bold. The new putative mutations identified in exon 4 appear close to the previously reported mutation. tibodies or HNF-1 and HNF-4 mutations, supporting the participation of additional MODY genes in this and other populations. The presence of insulin resistance was observed in 35% of the early-onset type 2 group. This finding is in accordance with the results obtained by Doria et al. (4), who reported the presence of insulin resistance in early-onset patients type 2 patients. No differences were found between insulin-sensitive and insulin-resistant cases regarding glycemic control, BMI, or insulin dosage. The presence of insulin resistance had a significant impact on the lipid profile and the blood pressure. The insulin-resistant cases showed many of the lipid abnormalities described in the metabolic syndrome (40). They had significantly higher concentrations of plasma trigylcerides and LDL cholesterol; the predominance among the LDL particles of the smaller and denser LDL subclasses were also more common in these subjects. The insulinresistant cases also had lower levels of HDL and HDL3 cholesterol and lipoprotein(a). These observations are similar to those reported by Haffner and co-workers (41, 42). They demonstrated that insulin-resistant prediabetic and type 2 diabetic patients had more cardiovascular risk factors than their insulin-sensitive control peers. Controversy exists regarding the role of hyperinsulinemia in the pathophysiology of the lipid abnormalities of the metabolic syndrome (43). These observations demonstrate that even in the absence of endogenous hyperinsulinemia, insulin resistance is associated with an adverse lipid profile. Our data also confirm that a low level of lipoprotein(a) is a feature of the insulin-resistant syndrome, as previously reported by Rainwater and co-workers (44). This effect is independent of the apo(a) genotype. We believe that early-onset type 2 diabetes could be an adequate model for the study of the diabetes-related lipoprotein abnormalities. The presence or absence of insulin resistance in a group of lean insulinopenic subjects and a narrow range of age are characteristics desirable for isolating the effects of insulin resistance on different metabolic parameters. We identified a patient with an apparent type 1 diabetes carrying a double substitution in codon 126 of the HNF-4 gene (Asp 126 3His/Tyr). Although mutations in the HNF-1 gene have been described for type 1 diabetics in the Japanese and Caucasian populations and in one Mexican-American patient (45 47), this is the first report of putative mutations in the HNF-4 gene in a patient carrying -cell autoimmunity markers. The double substitution found in this patient deserves further analysis, as neither the mother of the proband nor any of her siblings are diabetic, suggesting that one of the substitutions may not be diabetogenic. Functional studies of independent mutants (Asp His and Asp 126 3Tyr) will be necessary to determine the roles of these changes in the expression of diabetes in this patient. Previously reported mutations and the new putative mutations identified in exon 4 are shown in Fig. 2. In conclusion, patients with type 2 diabetes diagnosed between ages 20 and 40 yr is a clinically and genetically heterogeneous group. Insulin deficiency seems to be a common feature in this group. The coexistence of insulin resistance was found in 35% of cases. Even in the absence of endogenous hyperinsulinemia, insulin resistance is associated with an adverse lipid profile Acknowledgment We thank Laura Riba for the critical reading of the manuscript. References 1. Secretaría de Salud Encuesta Nacional de Enfermedades Crónicas. Dirección General de Epidemiología SSA, Mexico. 2. Rull JA, Rios JM, Gómez Pérez FJ The impact of diabetes mellitus on public health in México. In: Schwartz CJ, Born G (eds) New horizons in diabetes mellitus and cardiovascular disease. Current Science; Froguel P, Velho G Molecular genetics of maturity-onset diabetes of the young. Trends Endocrinol Metab. 10: Doria A, Yang Y, Malecki M, et al Phenotypic characteristics of earlyonset autosomal-dominant type 2 diabetes unlinked to known maturity-onset diabetes on the young (MODY) genes. Diabetes Care. 22: Yamagata K, Furuta H, Oda N, et al Mutations in the hepatocyte nuclear factor-4 gene in maturity-onset diabetes of the young. Nature. 384: Froguel P, Zouali H, Vionnet N, et al Familial hyperglycemia due to mutations in glucokinase: definition of a subtype of diabetes mellitus. N Engl J Med. 328: Yamagata K, Oda N, Kaisaki PJ, et al Mutations in the hepatocyte nuclear factor-1 gene in maturity-onset diabetes of the young. Nature. 384: Stoffers DA, Ferrer J, Clarke WL, Habener JF Early-onset type II diabetes mellitus (MODY 4) linked to IPF-1. Nat Genet. 17: Horikawa Y, Iwasaki N, Hara M, et al Mutations in the hepatocyte nuclear factor- 1 gene (TCF2) associated with MODY. Nat Genet. 17: Velho G, Froguel P Genetic, metabolic and clinical characteristics of maturity onset diabetes of the young. Eur J Endocrinol 138: Isomaa B, Henricsson M, Lehto M, et al Chronic diabetic complications in patients with MODY 3 diabetes. Diabetologia. 41: Froguel P, Velho G Molecular genetics of maturity-onset diabetes of the young. Trends Endocrinol Metab. 10: Lehto M, Wipemo C, Ivarsson SA, et al High frequency of mutations in

7 226 AGUILAR-SALINAS ET AL. JCE&M 2001 Vol. 86 No. 1 MODY and mitochondrial genes in Scandinavian patients with familial earlyonset diabetes. Diabetologia. 42: Kaisaki PJ, Menzel R, Linder T, et al Mutations in the hepatocyte nuclear factor 1 gene in MODY and early-onset NIDDM: evidence for mutational hotspot in exon 4. Diabetes. 46: Expert Committee on Diagnosis and Classification of Diabetes Mellitus Report of the Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. Diabetes Care. 20: Welch NS, Gebhart SP, Bergman RN, Phillips LS Minimal model IVGTT derived insulin sensitivity in diabetics. J Clin Endocrinol Metab. 71: Bergman R, Prager R, Volund A, Olefsky JM Equivalence of insulin sensitivity index in man derived by minimal model method and euglycemic glucose clamp. J Clin Invest. 79: Buffone GJ, Darlington GJ Isolation of DNA from biological specimens without extraction with phenol. Clin Chem. 31: Hattersley AT Maturity-onset diabetes of the young: clinical heterogeneity explained by genetic heterogeneity. Diabetes Med. 15: Orita M, Susuki Y, Sekiya T, Hayashi K Rapid and sensitive detection of point mutations and DNA polymorphisms using polymerase chain reaction. Genomics. 5: Orita M, Iwahana H, Kanasawa H, Hayashi K, Sekiya T Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc Natl Acad Sci USA. 86: Lossow WJ, Lindgren F T,Murchio JC, Stevens GR, and Jensen L Particle size and protein content of six fractions of the sf 20 plasma lipoproteins isolated by density gradient centrifugation. J Lipid Res. 10: Clausen J, Borch-Johnsen K, Ibsen H, Bergman R, Hougaard P, Winther K, Pedersen O Insulin sensitivity index, acute insulin response and glucose effectiveness in a population based sample of 380 young healthy Caucasians. J Clin Invest. 98: MacLean P, Vadlamudi S, MacDonald K, Pories W, Houmard J, Barakat H Impact of insulin resistance on lipoprotein subpopulation distribution in lean and morbidly obese nondiabetic women. Metabolism. 49: Escalante JM, Fletes V, Escalante A, Herrera A, Gonzalez M, Martinez E, Alpizar M Historia de diabetes gestacional y su relación con el síndrome plurimetabólico. Rev Endocrinol Metab. 6: Winter WE, MacLaren NK, Riley WJ, Clarke DW, Kappy MS, Spillar RP Maturity onset diabetes of the youth in black Americans. N Engl J Med. 316: Tan K, Mackay I, Zimmet P, Hawkins B, Lam K Metabolic and immunologic features of Chinese patients with atypical diabetes mellitus. Diabetes Care. 23: Rosenbloom AL, Young RS, Joe JR, Winter WE Emerging epidemic of type 2 diabetes in youth. Diabetes Care. 22: Frayling TM, Bulman MP, Ellard S, et al Mutations in the hepatocyte nuclear factor-1 gene are common cause of maturity-onset diabetes of the young in the UK. Diabetes. 46: Malecki MT, Yang Y, Antonellis A, Curtis S, Warram JH, Krolewski AS Identification of new mutations in the hepatocyte nuclear factor 4 gene among families with early onset type 2 diabetes mellitus. Diabet Med. 16: Haffner SM, Howard G, Mayer E, et al Insulin sensitivity and acute insulin response in African-Americans, non-hispanic whites, and hispanics with NIDDM. The Insulin Resistance Atherosclerosis Study. Diabetes. 46: Banerji MA, Lebovitz HE Insulin-sensitive and insulin-resitant variants in NIDDM. Diabetes. 38: Chaiken RL, Banerji MA, Pasmantier RM, Huey H, Hirsch S, Lebovitz HE Patterns of glucose and lipid abnormalities in black NIDDM sujects. Diabetes Care. 91: Banerji MA, Chaiken RL, Gordon D, Kral JG, Lebovitz HE Does intra-abdominal adipose tissue in black men determine whether NIDDM is insulin resistant or insulin sensitive? Diabetes. 44: Arner P, Pollare T, Lithell H. Different etiologies of type 2 (non-insulindependent) diabetes mellitus in obese and non-obese subjects. Diabetologia. 34: Yoshinaga H, Kosaka K Heterogeneous relationship of early insulin response and fasting insulin level with development of non-insulin-dependent diabetes mellitus in non-diabetic Japanese subjects with or without obesity. Diabetes Res Clin Pract. 44: Del Bosque-Plata L, García-García E, Ramírez-Jiménez S, et al Analysis of the glucokinase gene in Mexican families displaying early-onset non-insulin dependent diabetes mellitus including MODY families. Am J Med Genet. 72: Elbein SC, Teng K, Yount P, Scroggin E Linkage and molecular scanning analyses of MODY3/hepatocyte nuclear factor-1 gene in typical familial type 2 diabetes: evidence for novel mutations in exons 8 and 10. J Clin Endocrinol Metab. 83: Kaisaki PJ, Menzel R, Linder T, et al Mutations in the hepatocyte nuclear factor 1 gene in MODY and early-onset NIDDM: evidence for mutational hotspot in exon 4. Diabetes. 46: Reaven GM Pathophysiology of insulin resistance in human disease. Physiol Rev. 75: Haffner SM, D Agostino Jr R, Mykkanen L, et al Insulin sensitivity in subjects with type 2 diabetes. Relationship with cardiovascular risk factors: the Insulin Resistance Atherosclerosis Study. Diabetes Care. 22: Haffner SM, Mykkanen L, Festa A, Burke JP, Stern MP Insulin resitant prediabetic subjects have more atherogenic risk factors than insulin snsitive prediabetic subjects:implications for preventig coronary heart disease during the prediabetic state. Circulation. 101: Tilly-Kiesi M, Knudsen P, Groop L. Hyperinsulinemia and insulin resistance are associated with multiple abnormalities of lipoprotein subclasses in glucose tolerant relatives of NIDDM patients. Botnia Study Group J Lipid Res. 37: Rainwater DL, Haffner SM Insulin and 2 hour glucose levels are inversely related to Lp(a) concentration controlled for LPA genotype. Arterioscler Thromb Vasc Biol. 18: Yamada S, Nishigori H, Onda H, et al Identification of mutations in the hepatocyte nulear factor (HNF) 1 gene in Japanese subjects with IDDM. Diabetes. 46: Moller AM, Dalgaard LT, Pociot F, Nerup J, Hansen T, Pedersen O Mutations in the hepatocyte nuclear factor 1- gene in Caucasian families originally classified as having type 1 diabetes. Diabetologia. 41: Hathout E, Cockburn BN, Mace JW, Sharkey J, Chen-Daniel J, Bell GI A case of hepatocyte nuclear factor 1 diabetes/mody 3 masquerading as type 1 diabetes in a Mexican-American adolescent and responsive to a low dose of sulfonylurea. Diabetes Care. 22: