Research Communication Role of MicroRNA 126 in Screening, Diagnosis, and Prognosis of Diabetic Patients in Egypt

Transcription

1 Research Communication Role of MicroRNA 126 in Screening, Diagnosis, and Prognosis of Patients in Egypt Noha A. Rezk 1 * Norhan A. Sabbah 1 Mohamed S.S. Saad 2 1 Faculty of Medicine, Medical Biochemistry Department, Zagazig University, Egypt 2 Faculty of Medicine, Internal Medicine Department, Zagazig University, Egypt Abstract MicroRNAs (mirnas), family of non-coding small RNAs, play a vital role in the regulation of blood glucose level. We aimed to investigate the relation of serum mirna-126 expression with impaired glucose tolerance as well as type 2 diabetes mellitus (T2DM) with and without complications. One hundred healthy controls, eighty-six with IGT, and one hundred with T2DM were recruited in this study. Serum mirna- 126 expression was assessed by quantitative real-time polymerase chain reaction. We found a significant decrease of serum mirna-126 expression between IGT as well as diabetic when both compared with controls and between diabetic compared to IGT. A significant decrease of serum mirna-126 expression was detected in diabetic with complications compared to those without evident complications especially those with diabetic macrovascular complications and diabetic retinopathy. Serum microrna-126 expression could be a good marker for diagnosis of IGT and T2DM as well as for monitoring the outcomes of such disease. VC 2016 IUBMB Life, 68(6): , 2016 Keywords: MicroRNA 126; qrt-pcr; diabetes mellitus; IGT; complications Introduction Diabetes is increasing in epidemic proportions globally, exhibiting the most striking increase in the third world countries with emerging economies. This phenomenon is particularly evident in Middle East and North Africa regions, which has the highest prevalence of diabetes in adults. The most concerning indirect cost of diabetes is the missed work by the adult population coupled with the economic burden of loss of productivity. In Egypt alone, 2,623,000 people are already affected, with the expectation of increase this number to 6,726,000 in As many as half of all diabetic remain undiagnosed, these already sizable figures are likely gross underestimations (1). VC 2016 International Union of Biochemistry and Molecular Biology Volume 68, Number 6, June 2016, Pages *Address correspondence to: Noha Rezk, Lecturer of medical biochemistry, Zagazig University, Zagazig, Egypt 002. Tel: nonnarezk@yahoo.com Received 10 March 2016; Accepted 30 March 2016 DOI /iub.1502 Published online 26 April 2016 in Wiley Online Library (wileyonlinelibrary.com) Reliable biological tests are used for screening and diagnosis of diabetes based on blood glucose levels, however there are no means of detecting at-risk or of following diabetic complications. MicroRNAs (mirnas) are a family of small (about 22 nucleotides), noncoding single-strand RNA molecules, their transcription occurs through RNA polymerase II (2) and subsequent processing is mediated by the nuclear ribonuclease III (RNase III) enzyme, Drosha, to form precursor mirnas ( nucleotides), further cleavage occurs via another RNase III enzyme, Dicer, to form the mature mirna (3). MiRNAs modulate both physiological and pathological pathways by posttranscriptionally inhibiting the expression of a plethora of target genes (3). It has been demonstrated that mirnas are not only intracellular molecules, since they were also detected outside the cells in body fluids (e.g., In serum, plasma, saliva, urine, and milk; (4)) Human serum mirnas levels had been shown to be stable, reproducible, and consistent amongst healthy individuals, allowing them to be of potential value as biomarkers of disease (5). The stability of circulating mirnas may be explained by their being carried in membrane-bound vesicles or transported by 452 IUBMB Life

2 high-density lipoproteins (6). It has been suggested that extracellular mirnas have specific physiological functions, regulating immune function, cell migration, differentiation, and other aspects of cell-to-cell communication depending on their cellular origin (6). MiR-126 is highly enriched in endothelial cells, and contributes to the maintenance and repair of vascular integrity, angiogenesis, and wound repair; it also facilitates vascular endothelial growth factor- A (VEGF-A) signaling. Differentially expressed circulatory mirna signature characteristic of type 2 diabetes mellitus (T2DM) have been reported from recent studies outside Middle East (7 9). From these studies, it is expected that the identification of potential-specific mirnas biomarkers may help predict or detect the development and the progression of diabetes and its complications at an early stage, and therefore allow well timed intervention. So, in the present study, we aimed to investigate whether MiR-126 is considered a potential-specific biomarker which can predict or detect the development as well as the progression of diabetes and its complications, especially (macrovascular complications, retinopathy, neuropathy, and nephropathy) in diabetic Egyptian. Subjects and Methods This study was conducted in Medical Biochemistry and Internal Medicine Departments of Zagazig University Hospitals and included 100 subjects suffering from type II diabetes mellitus and 86 subjects with impaired glucose tolerance (IGT), recruited from admitted to the Internal Medicine Out Clinics. They were diagnosed according to American Diabetes Association diagnostic criteria 2015 (10). In long standing diabetics, the duration of their diabetes ranged from 6to12years. were divided into 5 subgroups: Those with newly evident complication (n 5 14); those with evident macrovascular complications (n 5 26), assessed by using ECG, duplex US mainly for coronary artery disease and premature coronary artery disease; those with diabetic neuropathy (n 5 17), diagnosed by full neurological examination; those with diabetic nephropathy (n 5 24), assessed by using albumin to creatinine ratio in spot urine sample and finally those with diabetic retinopathy (n 5 19), diagnosed by the best corrected visual acuity, slitlamp biomicroscopy, and indirect ophthalmoscopy. Exclusion Criteria Patients with a history of liver cirrhosis, malignancy, infection, inflammation, bronchial asthma, or heart failure, were excluded from this study. One hundred healthy subjects with no family history of diabetes mellitus as well as age, sex, and ethnic origin matched to the, were served as a control group. The ethical committee of Zagazig University approved this study and a written informed consent was obtained from all subjects prior to their inclusion in this work. Anthropometric Measurement Body mass index (BMI) was calculated by dividing the weight (kg) by the squared value of height in meters. Biochemical Analysis Blood samples were taken from all studied subjects after 8 H fast as follows: 2 ml blood was taken on fluoride containing tubes, another 2 ml was taken on EDTA containing tubes, and the remaining part was left for 10 min to clot and then was centrifuged at 1,000 3 g for 5 min. Another blood sample was taken after 12 H fast and on fluoride containing tubes 2 H after meal (2hpp). The serum and plasma samples were separated and stored at 2208C till the time of use. Fasting, 2hpp blood glucose, total cholesterol, and triglycerides were measured by routine enzymatic methods (Spinreact). HDLc was determined after precipitation of the apo B-containing lipoproteins. LDLc was calculated using Friedewald formula (11). Glycated hemoglobin (HbAlc) was estimated colorimetrically by using (Biosystems, Barcelona, Spain). Serum insulin and lipoprotein a (LPa) was measured by ELISA using the Quantikine human insulin and LPa assay kits (R and D Systems, Minneapolis, MN). HOMA-IR was calculated using the following formula: [fasting insulin (liu/ml) 3 fasting glucose (mmol/l)]/22.5. Serum mirna Assay Total RNA was isolated from 250 ll serum according to the manufacturer s instructions of the mirneasy extraction kit (Qiagen, Valencia, CA) by adding QIAzol lysis reagent (1 ml) then it was left for 5 min at room temperature. This was followed by adding 200 ll of chloroform and vortexing for 15 sec, the samples were incubated for 3 min at room temperature followed by centrifugation at 14,000 3 g at 48C for 15 min. An equal volume of 100% ethanol was added after removing the upper watery phase. Six hundred microliters of the solution were pipetted in mirneasy Mini spin column and centrifuged at g for 60 sec. Then 600 ll of buffer RWT was added, followed by another centrifugation at g for another 60 sec. Then, 500 ll of buffer RPE was added prior to centrifugation at g for 2 min. The columns were placed in new collection tubes and centrifuged at full speed for 2 min. Fifty microliters of RNase-free water was placed directly into the columns followed by centrifugation for 1 min at g for RNA elution. Twenty microliters of eluted mirna was reverse transcribed by incubation for 1 H at 428C, 3 min at 938C, and then maintained at 48C using the mirneasy serum/plasma Reverse Transcription Kit (Qiagen, Valencia, CA) according to the manufacturer s instructions (12). Real Time-PCR Quantification of Serum mirna-126 Quantification of mirna-126 was carried out by SYBR green quantitative real-time polymerase chain reaction assay using miscript SYBR Green PCR kit (Qiagen, Hilden, Germany) on Rezk et al. 453

3 IUBMB LIFE TABLE 1 Clinical and demographic characteristics of the studied groups Healthy controls (N 5 100) IGT (N 5 86) (N 5 100) P Age (years) Sex (male/female) 46/54 40/46 49/ Fasting blood glucose (mg/dl) < hpp blood glucose (mg/dl) <0.001 HbA1C (%) <0.001 BMI (kg/m 2 ) Fasting insulin (liu/ml) Total cholesterol (mg/dl) Triglycerides (mg/dl) HDL-c (mg/dl) LDL-c (mg/dl) LP (a) (ng/ml) HOMA IR <0.001 Serum mirna-126 expression <0.001 IGT, impaired glucose tolerance; 2 hpp, 2 hours postprandial; BMI, body mass index; HbAlc, glycosylated hemoglobin; HDLc, high density lipoprotein cholesterol; LDLc, low density lipoprotein cholesterol; LPa, lipoprotein (a); HOMA IR, homeostatic model assessment insulin resistance. ABI PRISM 7500 Fast real-time PCR system (Applied Biosystems, Foster City, CA). The procedure was performed on 20 ml final volume containing [2 ml of cdna,0.5 mm of hsa-mir-126- specific primers (Applied Biosystems), and 13 QuantiTect SYBR Green PCR Master mix] (Qiagen, Hilden, Germany). Primers sequence used was mature mirna sequence (5 0 CATTATTACTTTTGGTACGCG 3 0 ) and specific forward PCR primer (5 0 GGGGCATTATTACTTTTGG3 0 ). Cycling condition was denaturation at 958C for 2 min, followed by 35 cycles of 958C for 10 Sec, 578C for 20 sec, and 708C for 10 sec. Then, analysis of melting curve was performed and PCR products were electrophoresed on 2% agarose gels to validate the specific generation of the expected PCR product. The cycle threshold (Ct) value for the genes was determined by SDS software v1.2 (Applied Biosystems, Foster City, CA). Ct is the threshold cycle, the cycle number at which fluorescence is generated in a reaction crossing the threshold. MiRNA expression level was normalized by calculating the D Ct value based on subtracting its Ct value from that of the internal control RNU1A. The amplitude of mirna expression change, observed in in relation to control group, was analyzed by the 2 2DDCt method (13). Statistical Analysis Data were analyzed with SPSS version 15.0 (statistical package for the Social Science, Chicago, IL). Differences of the frequencies in the studied groups were analyzed using chi square (v2) test. Levels of serum mirna-126 expression were expressed as mean 6 SD. Significant differences between the groups were determined using Student s t test and one-way analysis of variance. Pearson correlation analysis was employed to assess the correlation between plasma mirna-126 expression and metabolic parameters in the studied subjects. The ability of mirna-126 expression to discriminate between case and control samples was assessed by plotting the receiver operating characteristics curve, which associates the true positive rate (sensitivity) to the false positive rate (1-specificity) and by computing area under the curve (AUC). A difference was considered significant at the P value <0.05. Results Demographic Characteristics of Control, IGT Patients, and Patients Groups There was a significant difference of fasting blood glucose, 2hpp blood glucose, HbA1C, HOMA IR, and serum mirna MicroRNA 126 in Diabetes

4 TABLE 2 Clinical and demographic characteristics of diabetic with and without complications Newly diagnosed type 2 diabetes mellitus without evident complications (N 5 14) macrovascular complicated (N 5 26) nephropathy (N 5 24) retinopathy (N 5 19) neuropathy (N 5 17) Adjusted P value Age (years) Sex (male/female) (6/8) (12/14) (13/11) (10/9) (8/9) 0.71 Onset of disease (years) <0.001 Fasting blood glucose (mg/dl) hpp blood glucose (mg/dl) HbA1C (%) BMI (kg/m 2 ) Fasting insulin (liu/ml) Total cholesterol (mg/dl) Triglycerides (mg/dl) HDL-c (mg/dl) LDL-c (mg/dl) LP (a) (ng/ml) HOMA IR Serum mirna-126 expression hpp, 2 hours postprandial; BMI, body mass index; HbAlc, glycosylated hemoglobin; HDLc, high density lipoprotein cholesterol; LDLc, low density lipoprotein cholesterol; LPa, lipoprotein (a); HOMA IR, homeostatic model assessment insulin resistance. Adjusted P: multivariate analysis; P adjusted for disease onset. expression levels between IGT as well as diabetic when both compared with control group. However, there was no significant difference between them regarding age, sex, BMI, fasting insulin, lipoid profile, and LP (a) (Table 1). Demographic Characteristics of Patients Subgroups with and without Evident Complications There was a significant difference between diabetic with complications compared to newly diagnosed type 2 diabetes mellitus without regarding serum mirna-126 expression levels (adjusted P ) and HOMA- IR (adjusted P ) (Table 2). Comparison of Serum mirna-126 Expression Levels between the Different Studied Groups A significant decrease of serum mirna-126 expression levels was found between IGT as well as diabetic when both compared to controls as well as between diabetic compared with IGT. On comparison of serum mirna-126 expression levels between diabetic with complications compared with those without, we found a significant decrease between both. Also, serum mirna-126 levels were significantly declined in diabetic macrovascular complicated as well as diabetic retinopathy when both compared compared with diabetic without, while, there was no significant difference of serum mirna-126 expression levels between diabetic neuropathy as well as diabetic nephropathy when both compared with newly diagnosed diabetic without (Table 3). Correlation between Serum mirna-126 Expression and Metabolic Parameters in the Studied Subjects Circulating concentrations of serum mirna-126 were negatively associated with both fasting blood glucose, HbA1c, and Rezk et al. 455

5 IUBMB LIFE TABLE 3 Groups Comparison of serum mirna-126 expression between the different studied groups Adjusted P value IGT versus control group <0.001 versus control group <0.001 versus IGT Complicated diabetic versus newly macrovascular complicated versus newly diagnosed type 2 diabetes mellitus without nephropathy versus newly retinopathy versus newly neuropathy versus newly Adjusted P: multivariate analysis; P adjusted for disease onset. < hpp blood glucose, while, there was no significant association between serum mirna-126 and HOMA-IR in all studied subjects (Table 4). When the cutoff value for serum mirna-126 expression was set to 0.715, the sensitivity and specificity for IGT were 94 and 90% (95% CI: ), respectively, with highly statistical significant difference (P < 0.003), while, the sensitivity and TABLE 4 Correlation between serum mirna-126 expression and metabolic parameters in the studied subjects Serum mirna-126 expression r P FBG (mg/dl) <0.01 2hpp blood glucose (mg/dl) <0.001 HbA1C (%) HOMA-IR FBG, fasting blood glucose; 2hpp, 2 hours postprandial; HbAlc, glycosylated hemoglobin; HOMA IR, homeostatic model assessment insulin resistance. specificity for diabetes mellitus were 95 and 92% (95% CI: ), respectively with highly statistical significant difference (P < 0.002) when the cutoff value for serum mirna-126 expression was set to (Table 5) and (Figs. 1 and 2) Discussion Diabetes is associated with reduced life expectancy, significant morbidity due to related micro vascular complications, increased risk of macrovascular complications (ischemic heart disease, stroke, and peripheral vascular disease) and diminished quality of life (14). Given the predicted explosion in the number of cases of prediabetes and T2DM worldwide especially in Egypt, finding a circulating biomarker that not only detects the IGT and diabetic but also screens the progression of complications at an early stage is essential. In our study, we tried to investigate the role of serum mirna-126 expression in different phases of diabetes.we found a significant decrease of serum mirna-126 expression between IGT and diabetic when both compared to controls as well as between diabetic compared to IGT. Circulating concentrations of serum mirna-126 were negatively associated with both fasting glucose, HbA1c, and 2hpp blood glucose, while, there was no significant association between mirna-126 and HOMA-IR in all studied subjects. These results are in accordance with other studies worldwide including a study done by Liu et al. in China (15), which found an association between mir-126 expression, T2DM, and prediabetic. The previous study indicated that serum mir-126 could be used to discriminate prediabetes from healthy individuals. In addition, low mir-126 expression was significantly associated with poor treatment response. Previous studies had indicated an association between mir-126 expression levels and T2DM with high specificity (9,16,17). Furthermore, a decrease in the circulating mir-126 in nondiabetic people was found to be a significant predictor of DM as reported by Zampetaki et al. (16). In fact, the authors detected a gradual decline in plasma levels of mir-126 from normal glucose tolerance, through IGT, to evident diabetes mellitus (16). In different aspect, mir-126 was found to be notably lower in urine of type-1 diabetic compared to controls (18). However, Karolina et al. (19) reported that there was no change found of mir-126 level between diabetic and controls. This may be explained by differences in biosamples used in each study, differences in methods for expression measurement, difference of the sample size, differences in the recruitment criteria employed for recruitment of the cases, power of association analyses and criteria for statistical significance. MiR-126 is highly abundant in endothelial cells, and plays a pivotal role in maintaining endothelial homeostasis, vascular integrity and regulating angiogenesis (20). It helps vascular endothelial growth factor (VEGF) signaling by suppressing two negative regulators of the (VEGF) pathway, Sprouty-related protein (SPRED1) and phosphoinositol-3 kinase regulatory 456 MicroRNA 126 in Diabetes

6 TABLE 5 Receiver operating characteristics curve (ROC) analysis using serum mirna-126 expression for discriminating IGT and diabetic Serum mirna-126 expression IGT 12 AUC (95% CI) P Std Error Sensitivity Specificity < ( ) % 90% > Serum mirna-126 expression DM 12 AUC (95% CI) P Std Error Sensitivity Specificity < ( ) % 92% > IGT, impaired glucose tolerance; CI, confidence interval; AUC, area under the curve; DM; diabetes mellitus. subunit 2 (PIK3R2/p85-b; (21)). The shedding of mir-126 from endothelial cells could regulate VEGF responsiveness and confer vascular protection in a paracrine manner (22,23). The association of decreased serum mir-126 with high blood glucose in our study and other previous studies (15,16) suggested that elevated plasma glucose might result in the decreased delivery of mir-126 to monocytes (16), which lead to reduction of plasma content of mir-126 in a glucosedependent fashion and in turn contributes to VEGF resistance and endothelial dysfunction resulting in defective collateral vessel development (24). The novelty of our study is that we were the first one who tried to use mir-126 expression levels as a predictor of various complications in T2DM, we found a significant decrease of serum mirna-126 expression between diabetic with complications compared to those without, Also, serum mirna-126 levels was significantly lower in with diabetic macrovascular complications as well as diabetic retinopathy when both compared with diabetic without, while, there was no significant difference was detected in cases of diabetic neuropathy and nephropathy. macrovasular complications are accountable for the higher incidence of sudden cardiac death and represent the main cause of morbidity and mortality among the diabetic (25). MiR-126 is encoded within an intron of Egfl7 and is enriched in endothelial cells (20). Genetic deletion of mir-126 disrupts the vascular integrity and results in partial embryonic lethality. MiR-126 knockout mice survived to adulthood show FIG 1 Receiver operating characteristics curve (ROC) analysis using serum mirna-126 expression for discriminating IGT when the cut off value was set to FIG 2 Receiver operating characteristics curve (ROC) analysis using serum mirna-126 expression for discriminating diabetic when the cut off value was set to Rezk et al. 457

7 IUBMB LIFE defective neo-angiogenesis following a surgical model of myocardial infarction. MiR-126 is enriched in the apoptotic bodies of dying endothelial cells and signals in a paracrine manner to induce the anti-apoptotic, pro-repair, CXCL12-CXCR4 signaling cascade in neighboring vascular cells (22). Direct administration of premir-126, or infusion of mir-126 containing apoptotic bodies, respectively, decreased the size or promoted the stabilization of atherosclerotic lesions in Apoe / mice. The signal pathway of mir-126 effecting on circulating endothelial progenitor cells (EPCs) is partially mediated through Ras/ERK/VEGF and PI3K/Akt/eNOS regulation. MiR-126 is downregulated in EPCs from diabetic, and impairs EPCs-mediated function via its target, Spred-1, and through Ras/ERK/VEGF and PI3K/Akt/eNOS signal pathway (26). Concerning diabetic retinopathy, in agreement with our findings, an experimental study done on rats, showed that mir-126 was not only downregulated under hypoxic conditions in the retinal tissue of streptozotocin-induced diabetic rats in vivo and in vitro (27), but it could also modulate the expression of VEGF and MMP-9 protein levels in monkey chorioretinal vessel endothelial cells (RF/6A; 28). Our study revealed that circulating concentrations of mirna-126 were negatively associated with both fasting blood glucose, HbA1c, and 2hpp blood glucose, while, there is no significant association of mirna-126 with HOMA-IR or lipid parameters in all studied subjects. In line with our results, a study done by Ortega et al. (9) who revealed that circulating concentrations of the selected mirna-126 were significantly associated with fasting glucose, HbA1c (P and 0.014), respectively. In conclusion, serum microrna-126 expression could be good marker for detecting IGT and T2DM and for monitoring the various complications of such disease. Further studies are recommended to understand the mechanisms of the different actions of microrna-126. References [1] WHO. (2000) Country and regional data on diabetes. Available at: int/diabetes/facts/world_figures/en/index2.html. Accessed 12 January [2] Zeng, Y. and Cullen, B. R. (2006) Recognition and cleavage of primary micro- RNA transcripts. Methods Mol. Biol. 342, [3] He, L. and Hannon, G. J. (2004) MicroRNAs: small RNAs with a big role in gene regulation. Nat. Rev. Genet. 5, [4] Chen, X., Liang, H., Zhang, J., Zen, K., and Zhang, C. Y. Y. (2012) Horizontal transfer of micrornas: molecular mechanisms and clinical applications. Protein Cell 3, [5] Gilad, S., Meiri, E., Yogev, Y., Benjamin, S., Lebanony, D., et al. (2008) Serum micrornas are promising novel biomarkers. PloS One 3, e3148. [6] Wagner, J., Riwanto, M., Besler, C., Knau, A., Fichtlscherer, S., et al. (2013) Characterization of levels and cellular transfer of circulating lipoproteinbound micrornas. Arterioscler. Thromb. Vasc. Biol. 33, [7] Pescador, N., Perez-Barba, M., Ibarra, J. M., Corbaton, A., Martınez-Larrad, M. T., and Serrano-Rıos, M. (2013) Serum circulating microrna profiling for identification of potential type 2 diabetes and obesity biomarkers. PloS One 8, e [8] Rong, Y., Bao, W., Shan, Z., Liu, J., Yu, X., et al. (2013) Increased microrna- 146a levels in plasma of with newly diagnosed type 2 diabetes mellitus. PloS One 8, e [9] Ortega, F. J., Mercader, J. M., Moreno-Navarrete, J. M., Rovira, O., Guerra, E., et al. (2014) Profiling of circulating micrornas reveals common micro- RNAs linked to type 2 diabetes that change with insulin sensitization. Diabetes Care 37, [10] American Diabetes Association. (2015) Standards of medical care in diabetes Diabetes Care 38, S1 S93. [11] Frieldewald, W. T., Levy, R. I., and Fredrickson, D. S. (1972) Estimation of the concentration of low density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin. Chem. 18, [12] Margariti, A., Zampetaki, A., Xiao, Q., Zhou, B., Karamariti, E., et al. (2010) Histone deacetylase 7 controls endothelial cell growth through modulation of beta-catenin. Circ. Res. 106, [13] Livak, K. and Schmittgen, T. (2001) Analysis of Relative Gene Expression Data Using RealTime Quantitative PCR and the 2 2DDCt method. Methods 25, [14] American Diabetes Association. (2005) Standards of Medical Care in Diabetes Diabetes Care 28(Suppl 1), S4 36. [15] Liu, Y., Gao, G., Yang, C., Zhou, K., Shen, B., et al. (2014) The role of circulating MicroRNA-126 (mir-126): a novel biomarker for screening prediabetes and newly diagnosed type 2 diabetes mellitus. Int. J. Mol. Sci. 15, [16] Zampetaki, A. and Kiechl, S. (2010) Plasma microrna profiling reveals loss of endothelial mir-126 and other micrornas in type 2 diabetes. Circ. Res. 107, [17] Zhang, T., Chunfang, L., Li, L., Chen, S., Liu, S., Wang, C., and Su, B. (2013) Plasma mir-126 Is a Potential Biomarker for Early Prediction of Type 2 Diabetes Mellitus in Susceptible Individuals. Biomed. Res. Int [18] Osipova, J., Fischer, D. C., Dangwal, S., Volkmann, I., Widera, C., et al. (2014) Diabetes-associated micro RNAs in pediatric with type1diabetes mellitus: across-sectional cohort study. J. Clin. Endocrinol. Metab. 99, E1661 E1665. [19] Karolina, D. S., Armugam, A., Tavintharan, S., Wong, M. T. K., Lim, S. C., et al. (2011) MicroRNA144 impairs insulin signaling by inhibiting the expression of insulin receptor substrate1in type2 diabetes mellitus. PLoS One 6, e [20] Wang, S., Aurora, A. B., Johnson, B. A., Qi, X., McAnally, J., et al. (2008) The endothelial specific microrna mir-126 governs vascular integrity and angiogenesis. Dev. Cell 15, [21] Fish, J. E., Santoro, M. M., Morton, S. U., Yu, S., Yeh, R. F., et al. (2008) mir-126 regulates angiogenic signaling and vascular integrity. Dev. Cell 15, [22] Zernecke, A., Bidzhekov, K., Noels, H., Shagdarsuren, E., Gan, L., et al. (2009) Delivery of microrna-126 by apoptotic bodies induces CXCL12- dependent vascular protection. Sci. Signal 2, ra81. [23] Fichtlscherer, S. and Zeiher, A. M. (2011) Circulating micrornas: biomarkers or mediators of cardiovascular diseases? Arterioscler. Thromb. Vasc. Biol. 31, [24] Waltenberger, J., Lange, J., and Kranz, A. (2000) Vascular endothelial growth factor-a-induced chemotaxis of monocytes is attenuated in with diabetes mellitus: a potential predictor for the individual capacity to develop collaterals. Circulation 102, [25] Chavali, V., Tyagi, S. C., and Mishra, P. K. (2013) Predictors and prevention of diabetic cardiomyopathy. Diabetes Metab. Syndr. Obes. 6, doi: /DMSO.S [26] Meng, S., Cao, J. T., Zhang, B., Zhou, Q., and Shen, C. X. (2012) Down regulation of microrna-126 in endothelial progenitor cells from diabetes, impairs their functional attributes, via target gene Spred-1. J. Mol. Cell Cardiol. 53, [27] Fan J, Xu G, Jiang T, Qin Y, Wang X (2013) MicroRNA-126 Regulates Heme Oxygenase-1-Mediated Alterations in Retinopathy. Invest. Ophthalmol. Vis. Sci. 54, [28] Ye, P., Liu, J., He, F., Xu, W., and Yao, K. (2014) Hypoxia-Induced Deregulation of mir-126 and Its Regulative Effect on VEGF and MMP-9 Expression. Int. J. Med. Sci. 11, doi: /ijms MicroRNA 126 in Diabetes