Figure e-1 (A) Visualization of mapping results of exome sequencing of patient 10 by Integrative Genomics Viewer. The location of a mosaic mutation

Transcription

1 Figure e-1 (A) Visualization of mapping results of exome sequencing of patient 10 by Integrative Genomics Viewer. The location of a mosaic mutation (c.3976g>c) is indicated by an arrow. Exome sequencing was performed with DNA derived from a lymphoblastoid cell line. Pink bars = forward strand. Light blue bars = reverse strand. (B) Sanger sequencing with DNA extracted from blood samples of patient 10 and her parents. Arrow indicates mutant C allele. The mutation was absent in the parents, indicating that the mutation occurred de novo. (C) Sanger sequencing with DNA extracted from lymphoblastoid cell line, saliva, nail, and hair follicle. A low grade of mosaicism was confirmed in these tissues.

2 Figure e-2 Interictal EEG of patients with SCN2A mutations. (A) Patient 10 at 3 years and 2 months. Multifocal spike-and-slow-waves with poor background activity during wakefulness (left) and 2 3 Hz diffuse irregular spike-and-slow-waves during sleep (right). (B) Patient 18 with unclassified early-onset epileptic encephalopathy (EOEE) at 3 months showing focal spikes at the medial temporal lobe. (C) Patient 230 with Ohtahara syndrome at 21 days showing suppression-burst pattern. (D) Patient 251 with unclassified EOEE at 11 months showing multifocal spikes. (E) Patient 305 with unclassified EOEE showing slow waves and burst of multifocal epileptic discharge with synchronization followed by suppression at 13 days of age (left), and multifocal spikes and sharp waves and high-amplitude slow waves at 2 months and 12 days (right).

3 Figure e-3 Brain MRI of patients with SCN2A mutations. (A) T1-weighted image of patient 18 at 9 months showing cerebral atrophy and delayed myelination. (B) T2-weighted image of patient 142 at 1 year and 4 months showing cerebral atrophy with frontal dominancy and delayed myelination. (C) T2-weighted image of patient 207 at 7 years showing decreased volume of bilateral parietal white matter. (D) T2-weighted image of patient 230 at 1 month showing no abnormality. (E) T1- weighted sagittal image of patient 251 at 14 years showing cerebellar atrophy and a thin corpus callosum. T2-weighted images of patient 252 at 16 days (F) and at 4 years (G) showing cerebral atrophy. T2-weighted axial (H) and sagittal (I) images of patient 305 at 11 months showing normal myelination and thin corpus callosum, respectively.

4 Table e-1. Primers and PCR conditions Exon Forward primer (5 >3 ) Reverse primer (5 >3 ) Product size (bp) Ex2 TGCAAGGAGCTAAACAGTGA GCCTATTTACTAATTGGTTCTGGG 360 Ex3 TGTTATACACTATTTTACAGGGCAAT TCTGTGGTTGGCAATGTTATG 330 Ex4 GGTGGTGAAGGCATGGTAGT CCAGACCCTGATTCAAATTCA 293 Ex5 ATATCGTAGGGGGACCAACC TATTTTCCTTGGTGGCTTGC 332 Ex6 GGCAATGTTTCAGCTCTTCG CACAGCTTTTGTGCAGAAGC 327 Ex7-1 TGGCATTCTGCATGACATTT TTCATTGGATGGGAATGGTA 326 Ex7-2 TGCAATGGCCTCCAGATAAT TAAAAGTTCTCATTTGAAAATGTGTTG 348 Ex8 CAGGGTGGCTGAAGTGTTTTA TCCAGTCCCACTCACTCCTC 220 Ex9 AGCAGACTTGCCGTTATTGA TTTTGCAGACACTACGTGCTG 345 Ex10 CGAACTCAAGAGAATTGCTGTA AAATGTTGAGGTCAGTGGCA 380 Ex11-1 AAAATGGAGAATTGTTTTTCAAGA GACAGAGTCCGAAAATCGGA 336 Ex11-2 TCCAAAAGTGAAAAAGAGCTGA AATGGAGAGAAAACCGCCTT 273 Ex12-1 TGTTTTTCAGAATGCCAGCTC CACAGACATGGAGAACGGC 257 Ex12-2 GATGAGCACAGCACCTTTGA GTGCAGGCAGGAGTGTTTTT 297 Ex13 CCTGTTGTAGGAATGCTTTGG GTGCAGGCAGGAGTGTTTTT 256 Ex14 AAACCAAATCTGCTTAATAGAAAGTAA GAAAGAGTTTATAATTGCCTTAGTGAA 361 Ex15 AATTATTCGTGTTTCAAGAGTATTTG AAAATGGCAAGATTTCCCATC 317 Ex16-1 TACAGATTTTTCCCTTCCTGTGTCC GTGGTCGGCATGCAGCTCTTTGGTA 336 Ex16-2 CATTAACACTGTTCTTGCTTTTATTTC GAGACCATGTGGGACTGTATGGAGG 325 Ex16-3 GCACATGCATGACTTTTTCCACTCC AGACCATTGTAATCCACACAAACCC 324 Ex17-1 GATGGAAAGCAATTGAAGCA CCATACCACCATAGAAATAGGCA 329 Ex17-2 CCGCTTGAAGATCTAAATAATAAAAA TTCTGTTGTTTAAAATTATCAGGTGTT 347 Ex18 GTGACCCCTGACCTTTACCA TGTGGTCTTGAGTATCCTCTTTTC 330 Ex19 AAATGAATCTCCCACCAACA TCTTTTCCCTTTCCCTTCAA 294 Ex20 GGCACCTGATAAGAGCTTGCATCGT TCTAGCAATGGTGCCTGACACAGTG 347 PCR conditions HotStartTaq MM Kit HotStartTaq MM Kit

5 Ex21 CAAGACCCCTGGGTGATTTTGAAAC TGAGAGCAGACTGACACTTTGTACCA 315 Ex22-1 TTCTACCCAATATTCAACTTTGAAAC TGGAGAGATGTTTGATGTAAGCGTGG 293 Ex22-2 ATCATGGGAGTGAATCTCTTTGCTG AATGAGATATCCACCTGTTAGAATGGC 292 Ex23 TCAAGCTTATTTATATGCCTGTATTGA GGATGATTTTCTCTAATCACTCTGT 368 Ex24 TCTGTTTGGTTTATTTTCATTCCAGAGA CCTTTAGCCTCCAAAATGCAACCAA 343 Ex25 AATGTGGGAGCCAATTTTCA TCACAGCCCGAATTTCTAGAA 269 Ex26-1 TGCTTTCTTAAAATCAGAAGAATTGA GCTGAAACTGATCTCTCTTCGTT 287 Ex26-2 GGAAACCGATGACCAGAGTC TCACAGCCCGAATTTCTAGAA 280 Ex27-1 CCTGTTCACATTTTGTAAAACTAATG GGATGCCCTTCGAATACAGA 909 Ex27-2 CGGATCCACTGTCTTGACATC GAGAAAACCGATATGACGCC 350 Ex27-3 TGATGGAACACCCATCAAAG TTGTGTCAACAGGACTCCCA The column PCR conditions shows the PCR enzymes used and the range of annealing temperatures. The temperature was lowered by 2 C every 3 cycles to the lowest annealing temperature. Then, the PCR reaction was cycled 30 times. The details of the PCR conditions are as follows: Hot Start Taq MM Kit: 95 C for 10 s, 64 C, 60 C, 58 C, 56 C for 30 s, and 72 C for 30 s KOD-FX: 95 C for 10 s, 64 C, 60 C, 58 C, 56 C for 30 s, and 72 C for 30 s KOD-FX with 2 step PCR: 98 C for 10 s and 70 C, 68 C, 66 C, 64 C for 30 s ExTaq HS: 95 C for 10 s, 64 C, 60 C, 58 C, 56 C for 30 s, and 72 C for 30 s The following PCR amplification enzymes were used: Hot Start Taq MM Kit, Hot Start Taq Master Mix Kit (Qiagen, Tokyo, Japan);, Neo (Toyobo, Osaka, Japan); ExTaq HS, TaKaRa Ex Taq Hot Start Version (Takara, Ohtsu, Japan).

6 Table e-2. Prediction of the pathogenicity of the SCN2A mutations and other genes analyzed in respective cases Case Diagnosis cdna change Amino acid change 10 Ohtahara syndrome c.3976g>c p.v1326l Inheritance SIFT Polyphen2 de novo (mosaic) EOEE c.638t>a p.v213d N/A West syndrome c.2558g>a p.r853q de novo Ohtahara syndrome c.4868c>a p.t1623n de novo Ohtahara syndrome c.707c>g p.t236s de novo Ohtahara syndrome c.4007c>a p.s1336y de novo Ohtahara syndrome c.3967a>g p.m1323v de novo Ohtahara syndrome c.4013t>c p.m1338t de novo EOEE c.638t>a p.v213d de novo Ohtahara syndrome c.634a>g (variant 3) p.n212d de novo EOEE c.506a>g p.e169g de novo EOEE c.4886g>t p.r1629l N/A Ohtahara syndrome c.2627a>c p.n876t de novo EOEE c.787g>a p.a263t de novo Ohtahara syndrome c.2995g>a p.e999k N/A 0.01 N/A = parents not available; EOEE = early-onset epileptic encephalopathy SIFT ( scores of less than 0.05% indicate substitutions that are predicted as intolerant. Mutation Taster In-house database 0/212 Other genes analysis Whole exome 0/212 ND 0/212 CDKL5 0/212 Whole exome 0/212 STXBP1 0/212 STXBP1 0/212 Whole exome 0/212 STXBP1 0/212 ND 0/212 Whole exome 0/212 CDKL5 0/212 CDKL5 0/212 0/212 0/212 Whole exome STXBP1 SPATN1 CDKL5 Whole exome PolyPhen-2 ( scores are evaluated as (most probably benign) to (most probably damaging). Mutation Taster ( rapid evaluation of DNA sequence alterations. The alterations are classified as disease causing or polymorphism.

7 Appendix e-1 Case reports Patient 10 The 20-year-old Japanese female was born to non-consanguineous parents as a first child after 39 weeks of gestation. The birth weight was 3,250 g and head circumference (HC) 33 cm. She had no asphyxia. At 8 days of age she had tonic spasms and was diagnosed with Ohtahara syndrome because of suppression-burst pattern on electroencephalography (EEG). At 4 months of age her tonic spasms continued with a frequency of 3 5 series per day, and her EEG showed hypsarrhythmia. She received adrenocorticotropic hormone (ACTH) therapy, phenobarbital (PB), clonazepam (CZP), valproic acid (VPA), phenytoin (PHT), zonisamide (ZNS) and lamotrigine (LTG), which reduced her seizures. At 2 years of age, she showed tonic seizure several times per week and myoclonic seizure several times per day. Brain magnetic resonance imaging (MRI) showed cerebral atrophy and delayed myelination (figure 2D). At 20 years of age, she showed severe psychomotor developmental delay without meaningful words, and also suffered from aspiration pneumonia and severe scoliosis. Patient 18 The 8-year-old Japanese girl was born after 37 weeks of gestation with no asphyxia, but had tracheal intubation for 1 day because of transient tachypnea of the newborn (TTN). The Apgar score was 7 at 1 minute and 8 at 5 minutes. Her birth weight, height, and HC were 2,538 g, 49 cm, and 34.2 cm, respectively. She had hypotonia, rigidity of the upper limbs, tachypnea and hyponatremia. The metabolic examination, including organic acids, amino acids, lactate, pyruvate and lysosomal enzymes, was all negative. At 3 months of age she developed secondarily generalized tonic seizures, and EEG showed

8 focal spikes at the medial temporal lobe (figure e-2d). Because of central dyspnea, she had a tracheostomy at 7 months of age, and then needed continuous mechanical ventilation. Brain MRI showed mild cerebellar atrophy, progressive diffuse cerebral atrophy and delayed myelination at 9 months (figure e-3a). Administration of PB, ZNS, carbamazepine (CBZ), VPA, CZP and thyrotropin-releasing hormone was not significantly effective. She showed very severe psychomotor developmental delay. Patient 99 This 6-year-old Japanese girl was born to non-consanguineous parents without asphyxia after 38 gestational weeks. The birth weight was 2,832 g and HC 33 cm. At 4 months of age her head control disappeared. She showed tonic seizure and hypsarrhythmia on EEG at 10 months of age, after which her seizures changed to series of tonic spasms. Her seizures were initially abolished by ACTH therapy and VPA, but recurred at 1 year of age. A second ACTH treatment in combination with clobazam (CLB) was partially effective, and nitrazepam (NZP) worsened the seizures. She also had severe psychomotor developmental delay without meaningful words, and had dystonia, chorea and ballismus. Brain MRI at 4 years of age showed cerebral atrophy of the frontal and temporal lobes, a thin corpus callosum and atrophy of the cerebellar vermis. At 6 years of age, the seizures and epileptic discharges on EEG disappeared after administration of LTG. Patient 142 The 4-year-old Japanese boy was born after 39 weeks of gestation with no asphyxia. The Apgar score was 7 and 9 at 1 and 5 minutes, respectively. He developed TTN and received oxygen therapy. His birth weight, height, and HC were 3,168 g, 50 cm, and 34

9 cm, respectively. He developed tonic seizures at 1 day of age, and EEG at 4 days showed suppression-burst pattern. EEG findings transitioned from a suppression-burst pattern to multifocal spikes at 2 months of age, and then to hypsarrhythmia at 3 months. Although his seizures were refractory to PB, VPA and CLB, the seizure frequency decreased by ZNS administration. The seizures were also relieved by ACTH therapy, but got worse 2 weeks after the therapy. After corpus callosotomy at 8 months of age, the tonic seizures decreased gradually, but secondarily generalized tonic seizures arising from the frontal lobe persisted. EEG at 1 year and 4 months showed focal spikes at the left frontotemporal region. Brain MRI showed cerebral atrophy with frontal dominancy and delayed myelination (figure e-3b). He had very severe psychomotor developmental delay, without any head control or meaningful words. Patient 146 This 17-month-old Canadian girl presented with central hypotonia since birth. She started to have apneic episodes necessitating stimulation from 12 hours of life. Blood sugar levels normalized very quickly after the initial hypoglycemia. The episodes were also associated with jerky movements of the upper and lower limbs. Brain MRI at 1 day of age was normal, and EEG showed multiple seizures, some subclinical and others associated with clinical jerky movements (multifocal multiple seizures). Administration of PB at 2 days and pyridoxine phosphate for 3 days from 7 days of age had no effect on the seizures. She continued to have clinical seizures, such as lip smacking and clonic movements, that usually lasted for seconds and were not associated with a drop in O 2 saturation or heart rate. PHT provided some clinical improvement. At 1 month of age, EEG demonstrated suppression-burst pattern consistent with Ohtahara syndrome. The possibilities of sepsis, meningitis or herpes encephalitis were ruled out. Metabolic

10 examination for organic acids, biotinidase, amino acids, ammonia, lactate, and pyruvate and Ontario Newborn Screening were negative. Her karyotype was 46, XX. The eye exam was normal, ruling out cataract, retinopathy or ocular anomalies. Seizures were initially treated with fosphenytoin and topiramate (TPM) with intermittent doses of lorazepam and paraldehyde. At the beginning, seizures were initially continuous and difficult to manage. Control was eventually obtained with ZNS, levetiracetam (LEV), PHT and vigabatrin (VGB). At 5 months of age, the awake EEG showed interictal epileptiform discharges over the bilateral temporal and posterior regions independently. This was consistent with multiple independent spike foci. Brain MRI at 17 months revealed marked thinning of the corpus callosum, obvious periventricular white matter thinning with patchy white matter T2 hyperintensity, a wavy configuration of the lateral ventricles, dilatation of pericerebral subarachnoid space, and symmetric increased T2 signal within bilateral globi pallidi with maintained volume. The optic nerves and chiasm were markedly thinned. Myelination was appropriate for age. The patient had severe developmental delay. Patient 185 The 5-year-old Israeli boy was born after 40 weeks of gestation with no specific events. His birth weight and HC were 3,325 g and 33 cm, respectively. His mother had felt explosive movements from the 6 th month of gestation, which were different from previous pregnancies. At 1 day of age he developed myoclonic and tonic seizures, and EEG showed suppression-burst pattern. At 1 month of age a brain MRI showed no abnormal findings. His seizures changed to focal seizures at 7 months of age, and EEG findings transitioned to modified hypsarrhythmia at 1 year and 3 months. VGB, CZP and trichlonam had partial effects on seizures, but vitamin B6, PB, hydantoin and

11 sulthiame were ineffective. Metabolic examination for organic acids, biotinidase, amino acids, lactate, carnitine and very long chain fatty acids was all negative. He showed very severe psychomotor developmental delay, and his motor function was limited to a withdrawal response to pain. He died at 5 years of age because of respiratory arrest. Patient 207 The 23 year-old Japanese male was born to non-consanguineous parents after 38 weeks of gestation without asphyxia. The birth weight was 3,036 g. There was no family history of epilepsy. At 8 days after birth, hypothermia (33.3 C), poor milk sucking and lethargy developed and he was admitted to the local hospital. Sepsis workup was all negative except for mild elevation of C-reactive protein. He was treated with intravenous fluid infusion and antibiotics in suspect of cold injury and his milk sucking and body temperature improved gradually. However, 13 days after birth, he had frequent generalized tonic-clonic convulsions. EEG at 18 days of age showed suppression-burst pattern (figure 2A). Amino acid analysis, NH 3, blood gas analysis, and routine blood analysis showed normal results except for hypoglycemia (36 mg/dl). The brain computed tomography (CT) scan appeared normal. His seizures (mainly tonic) were intractable and occurred more than 20 times a day despite various anticonvulsants including diazepam, PB, vitamin B6, VPA, and gamma-globulin. EEG at 2.5 months showed hypsarrhythmia. His seizures were finally controlled with ACTH at three months of age, and the EEG findings were modified to polyspikes over the bilateral occipital areas. However, his tonic seizures recurred once a day at 5 months of age. Since then, his seizures have persisted in spite of various anticonvulsants. The brain MRI at 7 years of age showed cortical atrophy of the left temporal region, spotty high T2 signal lesion in bilateral insular subcortical region, dilated bilateral inferior horn of

12 the lateral ventricle, and decreased volume of bilateral parietal white matter (figure 2E and figure e-3c). The patient had spastic quadriplegia, microcephaly, and severe intellectual disability without meaningful words, visual pursuit, head control or rolling. All his daily activities needed assistance by a caregiver. EEG showed multifocal spikes. Patient 230 The 5-year-old Mexican girl was born after 38 weeks of gestation without asphyxia. The Apgar score was 9 and 9 at 1 and 5 minutes, respectively. Birth weight, height, and HC were 2,950 g, 50 cm, and 35 cm, respectively. At 14 days of age, she developed spasms that occurred 20 times per day. EEG at 21 days of age showed suppression-burst pattern (figure e-2c). Metabolic examination and karyotype were normal. At 6 months of age, she had flexor spasms and developmental delay. She was suspected to have West syndrome, but EEG was not done. At 11 months she also presented extensor spasms (up to 15 times daily), EEG showed multifocal paroxysmal discharges but no hypsarrhythmia on basal activity. Combination therapy with VPA, VGB and CZP from 2 years of age was completely effective against her seizures, but multifocal paroxysmal discharges persisted on EEG. Brain MRI was normal at 1 month of age (figure e-3d), but revealed cortical and subcortical cerebral atrophy at 4 years and 7 months. She had severe developmental delay and generalized hypotonia. Partial head support and eye contact and follow were acquired but no words. Patient 251 This 14-year-old Japanese girl was born to non-consanguineous parents after 40 weeks of gestation. Although she had meconium aspiration syndrome and hypernatremia at birth, she had no asphyxia. At 1.5 months of age she started having tonic seizures, and

13 her EEG at 11 months showed multifocal spikes (figure e-2d). Brain MRI at 1 year of age showed cerebral and cerebellar atrophy and delayed myelination (figure 2F). Antiepileptic drugs, such as PHT, ZNS, PB, VPA, CLB, and ethosuximide (ESM) were partially effective. At 14 years of age her EEG showed multifocal spikes and sometimes diffuse spike-and-slow-waves, and brain MRI showed a thin corpus callosum and cerebral and cerebellar atrophy (figure e-3e). She was bedridden with severe psychomotor developmental delay and no meaningful words. Patient 252 This 4-year-old Japanese boy was born to non-consanguineous parents after 37 weeks of gestation without asphyxia. The birth weight was 3,282 g and HC 36 cm. At 14 days of age he showed seizures with pedaling movements and dyspnea, and suppression-burst pattern on EEG (figure 2C). At 3 months of age his EEG findings transitioned to hypsarrhythmia and a month later, his seizures changed to spasms (figure 2C). PB, ZNS, CZP and TPM were partially effective, but generalized tonic seizures appeared approximately 10 times a day at 4 years of age. Brain MRI showed cerebral atrophy at 16 days (figure e-3f), diffuse progressive cerebral atrophy and delayed myelination at 10 months of age (figure 2G), and severe cerebral atrophy at 4 years (figure e-3g). He was bedridden with very severe developmental delay, showing no meaningful words and no response to a call. Patient 254 This 5-year-and-9-month-old Japanese girl was born after 41 weeks of gestation with fetal distress but no asphyxia. Her birth weight, height, and HC were 3,392 g, 50 cm, and 33 cm, respectively. At 6 months of age she had no head control and developed

14 brief tonic seizures, and EEG showed multifocal spike-and-slow-wave complexes at a right parieto-occipital region and the left frontal lobe. She showed a cluster of seizures with fever during infancy, and at 1 year of age she showed several types of seizure, such as myoclonic, tonic and focal seizures. Metabolic examination for organic acids, amino acids and lactate, was negative. After ACTH therapy, her seizures decreased, but focal seizures appeared. Brain MRI showed diffuse cerebral atrophy and thin corpus callosum at 5 years of age. She showed severe psychomotor developmental delay, no meaningful words, microcephaly, dystonia of upper limbs and trunk, deafness and hand mouthing. Patient 255 This 4-month-old Japanese girl was born after 37 weeks of gestation by Cesarean section. Her birth weight was 2,870 g. Because of meconium aspiration syndrome, she had asphyxia and the Apgar score was 2 at 1 minute and 4 at 5 minutes. She developed focal motor seizures and myoclonus 10 to 20 times per day at 3 days of age. EEG showed bursts of focal spikes at frontotemporal regions and rhythmic slow waves. Brain MRI at 3 months of age showed hypoplasia of the corpus callosum and cerebral white matter and enlargement of the lateral ventricles. At 4 months of age she had non-epileptic myoclonus and HC was 40 cm. Administration of PB, VPA and ZNS had no significant effects on her seizure. Patient 271 This 1-year-and-8-month-old Japanese boy was born after 36 weeks of gestation without asphyxia. The Apgar score was 9 and 10 at 1 and 5 minutes, respectively. His birth weight was 1,986 g. At 8 days of age he showed eye deviation, mouth automatisms and generalized tonic seizures, and EEG showed suppression-burst pattern.

15 Metabolic examination for lactate, amino acids, and NH 3 was all negative. At 1 months of age his seizures included eye jerking, mouth automatisms and clonic seizures. At 5 months of age he developed spasms and the EEG findings transitioned to hypsarrhythmia. Although ACTH therapy decreased his seizure frequency, he showed focal tonic seizures at 1 years of age. VPA, ZNS, LTG and LEV had no significant effects on his seizures. A brain MRI revealed mild cerebral atrophy and delayed myelination at 10 months of age (figure 2H). He did not have any meaningful words, visual pursuit or head control. Patient 305 This 1-year-old Slovenian girl was born to non-consanguineous parents without any events. The birth weight, height, and HC were 2,860 g, 49 cm, and 33 cm, respectively. Her maternal cousin had neonatal convulsions with a favorable outcome. The seizures started at 3 days of age, and were subtle (eye jerking, ocular fixation, eyelid closure, lip smacking and suckling), with bilateral and symmetrical clonic and tonic posturing. She occasionally had status epilepticus that responded well to fosphenytoin. EEG at 13 days of age showed discontinuous tracing with multifocal epileptiform discharges with frontal predomination, in some parts resembling suppression-burst pattern (figure e-2e). At the end of her first month of life, the seizures were mostly tonic with a drop in O 2 saturation. The seizure frequency was several seizures per day, but she was seizure-free for several days after fosphenytoin rescue treatment. EEG at 2 months and 12 days of age showed multifocal epileptiform discharges with frontal-frontocentral predominance and segments of disorganized activity with high-amplitude slow waves and multifocal spikes and sharp waves, resembling modified hypsarrhythmia (figure e-2e). EEG at 4 months showed slow waves which sometimes had asynchrony between the two

16 hemispheres, and multifocal epileptiform activity with synchronization in short bursts followed by suppression. VPA and VGB had no significant effect on seizure frequency, but EEG findings were improved. At 6 months of age combination therapy of TPM, VPA and LTG controlled her seizures well. Brain MRI showed thin corpus callosum at 2.5 months and 11 months of age (figure e-3h and I). Patient 322 The 9-month-old Japanese boy was born after 37 weeks of gestation without asphyxia. The birth weight was 3,150 g and HC 32.0 cm. His parents were non-consanguineous and he had two healthy brothers. At 6 days of age he showed clonic seizures, and his EEG at 7 days revealed suppression-burst pattern (figure 2B). At 3 months of age his EEG transitioned to hypsarrhythmia, and then his seizures changed to series of tonic spasms at 4 months of age. Vitamin B6, VPA and PB were ineffective, and ZNS was partially effective. The seizures almost disappeared after ACTH therapy. His brain MRI at 2 months of age showed no abnormalities.