Diagnosis idili other ALI. definite highly likely probable possible unlikely. excluded excluded unlikely probable
|
|
|
- Charles Jennings
- 5 years ago
- Views:
Transcription
1 Diagsis idili other ALI Causality likelihood definite highly likely probable possible unlikely Other causes of liver injury excluded excluded unlikely probable highly probable Drug signature typical typical atypical atypical compatible atypical Co-medication ne compatible signature ne compatible signature any any Re-challenge positive with single agent* positive with multiple agents** t done t done negative Supplementary Table S1: Template for causality likelihood used for idili diagsis and drug causality. For each case diagsis was made by assessing each drug involved. The highest causality likelihood equals the case likelihood and therefore diagsis of idili or other ALI (acute liver injury). *positive rechallenge with a single agent proved the respective drug as definite. **Positive rechallenge with multiple drugs resulted in highly likely for the drugs with positive re-challenge.
2 characteristics DicloDILI tolerator otherdili otherali healthy otherdil otherali I P DicloDILI vs other goups total N female N ,535 female% 0,25 0, ,33 0,75 0,33 - caucasian N ,338 caucasian% 0, , Age (Median/Range) pattern N 52,5 (15-59) 37 (29-40) 38,5 (35-42) 39 (26-73) 26 (24-49) 68 (52-79) 52 (40-70) 0,967 3 na 2 1 na 2 0 0,279 % 0,75 na 1 0,33 na 0,5 0 - Severity (Median/Range) Acute liver failure N Acute liver failure% RUCAM Diclo (Median/Range) RUCAM other drug (Median/Range) MH positive Diclo MH positive other drug 1,5 (1-4) na 2 (1-3) 2 (2-3) na 2 (1-4) 1 (1-2) 0,862 1 na 1 1 na 1 0 0,603 0,25 na 0,5 0,33 na 0, (7-9) na 4,5 (4-5) 4 (-1-4) na na na 0,016* 6,5 (5-8) na 7,5 (7-8) 4 (-1-5) na 6,5 (6-7) 5 (2-5) 0,379 4 na 0 0 na na 2 0 na Supplementary Table S2: Characteristics of study subjects and, where applicable detail on liver injury. Severity was scored as described in Ref. 15. *p<0.05 vs all other groups.
3 Subject ID RUC AM Diclo DicloDILI1 8 DicloDILI2 9 DicloDILI3 8 other drug progeste rone Phenpro coumon Pantopra zole RUCAM other drug Group based on causality assessment (ALI diagsis) 5 DicloDILI 8 DicloDILI 8 DicloDILI DicloDILI4 7 Cefaclor 5 DicloDILI tolerator1 tolerator2 tolerator3 otherdili1 otherdili2 otherali1 otherali2 otherali3 healthy1 healthy2 healthy3 otherdili1 otherdili2 otherdili3 otherdili4 otherali1 otherali2 otherali3 Investigations leading to diagsis Diclofenac with Diclofenac with Diclofenac with Diclofenac with Underlying disease (drug indication) gender age ethnicity severity pattern ne (headache) female 50 hispanic 4 arterial hypertension (back pain) male 59 caucasian 2 ne (dicus prolaps) male 55 caucasian 1 heart insufficiency due to perinatal myocarditis (flu symptoms) male 15 caucasian 1 acute liver failure Supplementary Table S3: Details on study subject diagsis, comorbidities and comedications. latency (days) dose (mg) yes tolerator male 37 caucasian tolerator female 40 caucasian tolerator female 29 caucasian Amoxicillin /Clavula nate 7 otherdili 8 otherdili otherali (Adult Still s Disease) otherali (acute Hepatitis A) otherali (Benign recurrent intrahepatic cholestasis) Carbimazole with subarachid hemorrhage (hyperthyreosis) Metamizole with impingement syndrom (post shoulder surgery) Laboratory, symptoms, serology Serology, viral load History, genetics ne (arthralgias, fever) ne (fever, abdominal pain) cutaneous abscess post surgery male 42 caucasian 1 male 35 caucasian 3 male 73 caucasian 2 male 26 arabic 3 male 39 caucasian 2 Carbimazole Metamizole Ciprofloxacin 150 Metamizole yes yes (Carbimazole); 1 mazole); (Carbi- (Diclo- 150 fenac) (Metamizole); 311 ole); 150 (Metamiz healthy male 26 caucasian healthy male 24 caucasian healthy female 49 caucasian 6 otherdili 7 otherdili 6 otherdili 7 otherdili Dabigatran with Amoxicillin/Clavulanate with compatible time to onset Pirfenidone with Amoxicillin/Clavulanate with compatible time to onset 5 otherali (alcohol) History, laboratory 5 2 otherali (secondary sclerosing cholangitis) otherali (Vasculitis) Imaging, course of disease Serology, clinical symptoms, organ involvement atrial fibrillation female 79 caucasian 1 dental surgery female 52 caucasian 2 idiopathic pulmonary fibrosis restless legs (pneumonia) brest cancer (post surgery) subarachid hemorrhage (post surgery) Vasculitis (Fever and malaise) male 76 caucasian 4 female 60 caucasian 2 female 52 caucasian 1 male 70 caucasian 1 male 40 caucasian Dabigatran 141 (Dabigatran) 15 (Dabigatran) Amoxicillin /Clavulanate Pirfenidone 800 (Pirfenidone) Amoxicillin /Clavulanate Amoxicillin /Clavulanate Meropenem 1500 (Meropenem) Moxifloxacin yes 19 (Amox- 442 (Pirfenidone) 5 (Amox- 5 (Amox- 25 (Meropenem) 3 (Moxifloxacin) 2000 (Amox (Amox (Amox- 400 (Moxifloxacin)
4 Name No. of proteins Enrichment P-value Spliceosome 25 1,9 0,0003 Protein processing in endoplasmic reticulum 19 1,4 0,0385 Antigen processing and presentation 9 1,7 0,0366 Cell adhesion molecules (CAMs) 8 1,7 0,0481 Metabolism of xebiotics by cytochrome P ,3 0,0242 Supplementary Table S4: Pathways significantly enriched in the protein cluster predominantly upregulated in DicloDILI (dotted rectangle in Fig. 2a).
5 Protein name Gene name Cellular localization Diclo DILI Relative change in expression: Diclo vs. vehicle control tolerator other DILI other ALI healthy other DILI otherali Tubulin beta-1 chain TUBB1 intracellular 32,723 0,446 0,513 1,222 0,671 0,782 0,938 Fatty acyl-coa reductase 1 FAR1 intracellular 7,800 0,852 0,951 1,678 0,969 1,092 0,486 Nicotinamide phosphoribosyltra NAMPT intracellular 6,974 1,105 1,033 1,075 1,093 1,365 1,138 nsferase EH domaincontaining protein EHD3 intracellular 5,713 0,811 1,498 0,827 1,052 0,601 1,437 3 GPI transamidase component PIG-T PIGT intracellular 5,039 0,835 1,123 0,908 0,941 0,992 1,004 Pseudouridine-5- mophosphatase HDHD1 intracellular 4,790 1,080 1,093 0,764 1,491 1,097 1,076 Misshapen-like kinase 1 MINK1 intracellular 4,600 0,918 0,931 1,193 0,967 0,964 0,661 Leukocyte elastase SERPINB intracellular inhibitor 1 4,438 0,964 0,877 1,001 1,027 1,066 1,116 Integrin beta 3 Receptor expressionenhancing protein 3 ITGB3 membrane 4,204 1,384 0,684 0,867 0,622 1,304 0,730 REEP3 intracellular 4,195 1,061 1,070 1,341 0,849 0,656 1,042 Supplementary Table S5: List of first ten upregulated proteins in Diclofenac-treated MH cells from DicloDILI subjects, compared to vehicle control.
6 Component 2 (12,8%) Component 1 (48,2%) Vehicle control Diclofenac DicloDILI tolerator otherdili otherali healthy otherdili otherali Supplementary Figure S1: Principal component analysis of protein expression in MH cells from the different subject groups. Circles indicate samples which belong to the same subject group and were treated with DMSO (vehicle control) or Diclofenac.
7 SSC-A Granulocytes Lymphocytes FSC-A Platelets Mocytes Supplementary Figure S2: Gating strategy for the analysis of erythrocyte-lysed whole blood by flow cytometry. Representative density plot (forward vs side scatter area), showing the different blood cell populations.
8 ITGB3 Transaminases (U/l) ITGB3 Transaminases (U/l) (A) 100% DicloDILI % 80% 70% 60% 50% 40% 30% 20% 10% ITGB3 ALT AST 0% Acute Remission 0 (B) DicloDILI2 60% % % 400 ITGB3 30% 300 ALT 20% 200 AST 10% 100 0% Acute Remission 0 Supplementary Figure S3: Evolution of ITGB3 values and liver transaminases (ALT, AST) in DicloDILI1 (A) and DicloDILI2 (B) from the acute phase of the disease to remission. ITGB3 correlated inversely to ALT and AST in both subjects.
Click to view Biosketch and Presentation Abstract or page down to review presentation
Alexander Gerbes, MD Professor of Internal Medicine, Medizinische Klinik und Poliklinik II Klinikum der Universität München, FRG Andreas Benesic, MD Physician, Researcher Medizinische Klinik und Poliklinik
Diagnostic evaluation of suspected Drug-Induced Liver Injury
Diagnostic evaluation of suspected Drug-Induced Liver Injury Ynto de Boer, MD Department of Gastroenterology and Hepatology Disclosure No disclosures Drug-induced liver injury? Outline What is DILI? What,
Supplemental Figure 1. Gating strategies for flow cytometry and intracellular cytokinestaining
Supplemental Figure 1. Gating strategies for flow cytometry and intracellular cytokinestaining of PBMCs. Forward scatter area (FSC-A) versus side scatter area (SSC-A) was used to select lymphocytes followed
Leonard B. Seeff, MD Hepatology Consultant, Retired
Leonard B. Seeff, MD Hepatology Consultant, Retired Subjects with Active Liver Disease Need Special Observation Leonard B. Seeff, MD Hepatology Consultant, Retired DILI Conference XIV 19-20 March 2014
Supplementary Table 1: Summary of Reactogenicity Events by Group and Time of Onset in Entebbe
Supplementary Table 1: Summary of Reactogenicity Events by Group and Time of Onset in Group A (n=39) B (n=11) A (n=39) B (n=11) Onset Post-Vaccination Event 3 Minutes 3-14 days Pain 5 (13%) 1 (1%) 6 (15%)
Present-on-Admission (POA) Coding
1 Present-on-Admission (POA) Coding Michael Pine, MD, MBA Michael Pine and Associates, Inc 2 POA and Coding Guidelines (1) Unless otherwise specified, a POA modifier must be assigned to each principal
Supplementary appendix
Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Blum CA, Nigro N, Briel M, et al. Adjunct prednisone
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
Pretreatment Evaluation
Pretreatment Evaluation Objective At the end of this lecture, the learner will be able to: Outline the appropriate evaluation of a person infected with HCV in order to assess the benefits and risks of
Acute Hepatitis in a Patient with NASH and Elevation of CMV-IgM
Acute Hepatitis in a Patient with NASH and Elevation of CMV-IgM Uta Drebber, MD Disclosure of Relevant Financial Relationships USCAP requires that all faculty in a position to influence or control the
Monocyte subsets in health and disease. Marion Frankenberger
Monocyte subsets in health and disease Marion Frankenberger main cellular components: Leukocytes Erythrocytes Composition of whole blood Monocytes belong to the cellular components of peripheral blood
Resident, PGY1 David Geffen School of Medicine at UCLA. Los Angeles Society of Pathology Resident and Fellow Symposium 2013
Resident, PGY1 David Geffen School of Medicine at UCLA Los Angeles Society of Pathology Resident and Fellow Symposium 2013 85 year old female with past medical history including paroxysmal atrial fibrillation,
LIVER SPECIALTY CONFERENCE USCAP Maha Guindi, M.D. Clinical Professor of Pathology Cedars-Sinai Medical Center Los Angeles, CA
LIVER SPECIALTY CONFERENCE USCAP 2016 Maha Guindi, M.D. Clinical Professor of Pathology Cedars-Sinai Medical Center Los Angeles, CA Nothing to disclose Case History 47-year-old male, long standing ileal
Should There Be a Standard of Care (SOC) for Drug-Induced Liver Injury (DILI)? Leonard B Seeff, MD
Should There Be a Standard of Care (SOC) for Drug-Induced Liver Injury (DILI)? Leonard B Seeff, MD Drug-Induced Liver Injury: Are We Ready to Look? March 23-24,2011 AASLD, FDA/CDER, PhRMA A Common Statement
Appendix B: Provincial Case Definitions for Reportable Diseases
Ministry of Health and Long-Term Care Infectious Diseases Protocol Appendix B: Provincial Case Definitions for Reportable Diseases Disease: Hepatitis A Revised March 2017 Hepatitis A 1.0 Provincial Reporting
Gene expression profiling in ANCA-vasculitis renal biopsies
Gene expression profiling in ANCA-vasculitis renal biopsies Marcia Friedman, MD Northwest Rheumatism Society Meeting OHSU Fellow Research Presentation April 29 th 2017 Disclosures I have no disclosures
HD1 (FLU) HD2 (EBV) HD2 (FLU)
ramer staining + anti-pe beads ramer staining a HD1 (FLU) HD2 (EBV) HD2 (FLU).73.11.56.46.24 1.12 b CD127 + c CD127 + d CD127 - e CD127 - PD1 - PD1 + PD1 + PD1-1 1 1 1 %CD127 + PD1-8 6 4 2 + anti-pe %CD127
Human Infection with Novel Influenza A Virus Case Report Form
Human Infection with Novel Influenza A Virus Case Report Form Form Approved OMB No. 0920-0004 Exp. Date 6/30/2013 Reporter Information State: Date reported to state/local health department: / / (MM/DD/YYYY)
Inflammatory Response Parameters in Cutaneous Radiation Syndrome. Dubner, D.; Molinari, A.; Rossini, A.; Michelin, S. and Portas, M.
Inflammatory Response Parameters in Cutaneous Radiation Syndrome Dubner, D.; Molinari, A.; Rossini, A.; Michelin, S. and Portas, M. Presentado en: International Experts Meeting on Radiation Protection
Pharmacy and Referrals Pharmacy Name, Street Address & Telephone #: Primary Care Physician s Name, Location & Telephone #:
Patient Registration Please Print Clearly Date: Last Name: First Name: Middle Initial: Sex: Date of Birth: / / Age: Social Security: - - Address: City: State: Zip Code - Circle Preferred Phone Number Home
Leonard B. Seeff, M.D. Consultant Einstein Healthcare Network. Click to view Biosketch and Presentation Abstract or page down to review presentation
Leonard B. Seeff, M.D. Consultant Einstein Healthcare Network Click to view Biosketch and Presentation Abstract or page down to review presentation ALT as a Biomarker for Drug-Induced Liver Injury Leonard
Liver Functions as a marker of severity of disease in children with Dengue fever
Article ID: WMC004962 ISSN 2046-1690 Liver Functions as a marker of severity of disease in children with Dengue fever Peer review status: No Corresponding Author: Dr. Sampada A Tambolkar, Associate Professor,
Moving from Preclinical to Clinical Studies
Global Product Patient Safety Biomarkers for DILI: Moving from Preclinical to Clinical Studies Arie Regev, M.D. Global Patient Safety Eli Lilly and Company Indianapolis, IN New IDILI Biomarkers in the
Form 2033 R3.0: Wiskott-Aldrich Syndrome Pre-HSCT Data
Key Fields Sequence Number: Date Received: - - CIBMTR Center Number: CIBMTR Recipient ID: Has this patient's data been previously reported to USIDNET? USIDNET ID: Today's Date: - - Date of HSCT for which
Pharmacy and Referrals Pharmacy Name, Street Address & Telephone #: Primary Care Physician s Name, Location & Telephone #:
Patient Registration Please Print Clearly Date: Last Name: First Name: Middle Initial: Sex: Date of Birth: / / Age: Social Security: - - Address: City: State: Zip Code - Home Phone #: Work Phone #: Cell
2. Liver blood tests and what they mean p2 Acute and chronic liver screen
Hepatology referral pathways for GP 1 Scope For use within hepatology Contents 2. Liver blood tests and what they mean p2 Acute and chronic liver screen p2 Common reasons for hepatology referral 3. Raised
Multi-organ Failure from Fulminant Leptospirosis: A Case Report CSIM 2015: Ted Giles Clinical Case Presentation October 17, 2015
Multi-organ Failure from Fulminant Leptospirosis: A Case Report CSIM 2015: Ted Giles Clinical Case Presentation October 17, 2015 Karan Bami, PGY-2, Internal Medicine, University of Ottawa Karan Bami MD,
Supplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
Full Novartis CTRD Results Template
Full Novartis CTRD Results Template Sponsor Novartis Generic Drug Name vildagliptin Therapeutic Area of Trial Type 2 diabetes Approved Indication Type 2 diabetes Protocol Number CLAF237A23138E1 Title A
In 1993, the International Autoimmune Hepatitis Group
CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2012;10:417 421 Validation and Modification of Simplified Diagnostic Criteria for Autoimmune Hepatitis in Children ELIZABETH MILETI,* PHILIP ROSENTHAL,*, and MARION
CHECK LIST FORM-MONTH 27 (Please note Month 27 is from enrolment not randomisation)
CHECK LIST FORM-MONTH 27 (Please note Month 27 is from enrolment not randomisation) Participant Initials: Date of Birth: Were the following forms completed for this visit? Follow Up Form Done t Done BVASWG
Chamydiae/Rickettsiae/Anaplasmacetaceae: Obligate Intracellular Pathogens
Chamydiae/Rickettsiae/Anaplasmacetaceae: Obligate Intracellular Pathogens These groups are degenerate highly specialized Gramnegative bacteria with very small genomes. Due to loss of essential biosynthetic
Hepatitis C January 26, 2018
Hepatitis C January 26, 2018 Case Investigation Guidelines Contents A. Purpose...2 B. Case Definitions...2 a. Acute Hepatitis C (2016...2 b. Chronic Hepatitis C (2016)...3 c. Perinatal Hepatitis C (2017
ACCME/Disclosures. The Overlap Syndromes: Do They Exist? Key Points and Questions 4/6/2016. Hans Popper Hepatopathology Society
ACCME/Disclosures The USCAP requires that anyone in a position to influence or control the content of CME disclose any relevant financial relationship WITH COMMERCIAL INTERESTS which they or their spouse/partner
CLINICAL VIGNETTE Sarcoidosis: A Case Study Gloria Kim, M.D.
CLINICAL VIGNETTE Sarcoidosis: A Case Study Gloria Kim, M.D. Case Report A 56-year-old female presented to her primary care physician with complaints of dyspnea on exertion and increasing cough. She reported
A PARTNERSHIP PLAN FOR IDIOPATHIC PULMONARY FIBROSIS
A PARTNERSHIP PLAN FOR IDIOPATHIC PULMONARY FIBROSIS A STRATEGY FOR DEVELOPING AN IPF MANAGEMENT PLAN BASED ON REALISTIC PATIENT GOALS Indication Esbriet (pirfenidone) is indicated for the treatment of
Wiskott-Aldrich Registry Data Collection Form Patient Identification: Patient Name (first, middle, last)
Patient Identification: Patient Name (first, middle, last) Patient s USIDNET Registry Number assigned after online enrollment Date of Birth / / (mm/dd/yyyy) or Year of Birth Gender: male [ ], female [
Drug Induced Liver Disease Role of the Pathologist. Disclosure. DILI can never be excluded. Romil Saxena, MD. Dr. Saxena has nothing to Disclose
Drug Induced Liver Disease Role of the Pathologist Romil Saxena, MD Disclosure Dr. Saxena has nothing to Disclose DILI can never be excluded #1 DILI has no specific pattern of injury it can mimic any and
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded from TCGA and differentially expressed metabolic genes
Autoimmune Hepatobiliary Diseases PROF. DR. SABEHA ALBAYATI CABM,FRCP
Autoimmune Hepatobiliary Diseases PROF. DR. SABEHA ALBAYATI CABM,FRCP Autoimmune hepatobiliary diseases The liver is an important target for immunemediated injury. Three disease phenotypes are recognized:
Supplementary Online Content
Supplementary Online Content Blumenthal SR, Castro VM, Clements CC, et al. An electronic health records study of long-term weight gain following antidepressent use. JAMA Psychiatry. Published online June
I have no disclosures relevant to this presentation LIVER TESTS: WHAT IS INCLUDED? LIVER TESTS: HOW TO UTILIZE THEM OBJECTIVES
LIVER TESTS: HOW TO UTILIZE THEM I have no disclosures relevant to this presentation José Franco, MD Professor of Medicine, Surgery and Pediatrics Medical College of Wisconsin OBJECTIVES Differentiate
A Review of Liver Function Tests. James Gray Gastroenterology Vancouver
A Review of Liver Function Tests James Gray Gastroenterology Vancouver Copyright 2017 by Sea Courses Inc. All rights reserved. No part of this document may be reproduced, copied, stored, or transmitted
CITY AND HACKNEY CCG ABNORMAL LIVER FUNCTION TESTS (LFTs) in ADULTS
CITY AND HACKNEY CCG ABNORMAL LIVER FUNCTION TESTS (LFTs) in ADULTS Interpreting abnormal liver function tests (LFTs) and trying to diagnose any underlying liver disease is a common scenario in Primary
Th17 and Th17/Treg ratio at early HIV infection associate with protective HIV-specific CD8 + T-cell responses and disease progression
Th17 and Th17/Treg ratio at early HIV infection associate with protective HIV-specific CD8 T-cell responses and disease progression Juliana Falivene 1, Yanina Ghiglione 1, Natalia Laufer 1,3, María Eugenia
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
Primary Sclerosing Cholangitis and Cholestatic liver diseases. Ahsan M Bhatti MD, FACP Bhatti Gastroenterology Consultants
Primary Sclerosing Cholangitis and Cholestatic liver diseases Ahsan M Bhatti MD, FACP Bhatti Gastroenterology Consultants I have nothing to disclose Educational Objectives What is PSC? Understand the cholestatic
NAME DATE Page 1. Other. Kidney Removed (Right, Left) Bladder Removed. Ovaries Removed for Endometriosis Breast Biopsy
NAME DATE Page 1 Past Medical History: (please circle ALL that apply) Anxiety Hepatitis Arthritis Hypertension Artificial joints HIV/AIDS Asthma Hypercholesterolemia Atrial fibrillation Hyperthyroidism
Disorders of the Liver and Pancreas
Disorders of the Liver and Pancreas Liver Lobule Hexagonal plates Sinusoids Triads Bile duct branch Arteriole Venuole Blood flows from periphery to Central vein Space of Dissé Lobular Microanatomy Hepatocytes
Laboratory Tests and Diagnostic Procedures in Liver Disease: Adventures in Liverland
Laboratory Tests and Diagnostic Procedures in Liver Disease: Adventures in Liverland Sanjiv Chopra, MD, MACP Professor of Medicine Harvard Medical School Editor In Chief Hepatology Section Up To Date Serum
Actimmune. Actimmune (interferon gamma-1b) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.21.01 Subject: Actimmune Page: 1 of 5 Last Review Date: March 18, 2016 Actimmune Description Actimmune
Supplementary Online Content
Supplementary Online Content Powles T, O Donnell PH, Massard C, et al. Efficacy and safety of durvalumab in locally advanced or metastatic urothelial carcinoma: updated results from a phase 1/2 openlabel
Investigating and Referring Incidental Findings of Abnormal Liver Tests
Investigating and Referring Incidental Findings of Abnormal Liver Tests Note on Referral Guidelines: these revised guidelines are presented as a tool to aid appropriate referral and management of common
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
Serologic Markers CONVENTIONAL ANTIBODIES ANTIBODIES UNCONVENTIONAL. AIH Type I
Autoimmune Hepatitis By Thomas Frazier Objective What we need to know about AIH Diagnosis Treatment Difficulties in both Liver transplantation concerns AASLD Guidelines: Hepatology. 2010 Jun;51(6):2193-213.
AUTOIMMUNE DISORDERS IN THE ACUTE SETTING
AUTOIMMUNE DISORDERS IN THE ACUTE SETTING Diagnosis and Treatment Goals Aimee Borazanci, MD BNI Neuroimmunology Objectives Give an update on the causes for admission, clinical features, and outcomes of
Supplementary Table 1 ICD -8 and ICD- 9 codes for liver disease and the three definitions of liver cirrhosis (LC)
Supplementary Table 1 ICD -8 and ICD- 9 codes for liver disease and the three definitions of liver cirrhosis () ICD version Code Description Liver disease 1 2 3 ICD-8 5700 Acute/subacute necrosis of liver
SAMPLE Data Entry Manual for the veds Project
The data entry manual is designed to provide a clear definition for each variable collected and the options for each variable SAMPLE Data Entry Manual for the veds Project Subject ID Each study participant
Nature Medicine: doi: /nm.2109
HIV 1 Infects Multipotent Progenitor Cells Causing Cell Death and Establishing Latent Cellular Reservoirs Christoph C. Carter, Adewunmi Onafuwa Nuga, Lucy A. M c Namara, James Riddell IV, Dale Bixby, Michael
FATTY LIVER DISEASE (NAFLD) (NASH) A GROWING
NON ALCOHOLIC FATTY LIVER DISEASE () & NON ALCOHOLIC S T E ATO H E PAT I T I S () ADDRESSING A GROWING SILENT EPIDEMIC Prevalence of & USA Prevalence in Middle Age Patients San Antonio, Texas (Williams
Good afternoon. Thanks, John, very much for the invitation to be here today. I am delighted to discuss elevated transaminases in the setting of heart
Good afternoon. Thanks, John, very much for the invitation to be here today. I am delighted to discuss elevated transaminases in the setting of heart failure. 1 I have nothing to disclose, and the opinions
BC Cancer Protocol for Treatment of Platinum Resistant Epithelial Ovarian Cancer with Bevacizumab and PACLitaxel
BC Cancer Protocol for Treatment of Platinum Resistant Epithelial Ovarian Cancer with Bevacizumab and PACLitaxel Protocol Code Tumour Group Contact Physician UGOOVBEVP Gynecologic Oncology Dr. Anna Tinker
Azathioprine toxicity criteria and severity descriptors for the listing of biological agents for rheumatoid arthritis on the PBS
Azathioprine toxicity criteria and severity descriptors for the listing of biological agents for rheumatoid arthritis on the PBS Only valid for adult patients Azathioprine must be at a dose of at least
Summary ID#7029. Clinical Study Summary: Study F1D-MC-HGKQ
CT Registry ID# 7029 Page 1 Summary ID#7029 Clinical Study Summary: Study F1D-MC-HGKQ Clinical Study Report: Versus Divalproex and Placebo in the Treatment of Mild to Moderate Mania Associated with Bipolar
NONALCOHOLIC FATTY LIVER DISEASE. Non-Alcoholic Fatty Liver Disease (NAFLD) Primary NAFLD. April 13, 2012
NONALCOHOLIC FATTY LIVER DISEASE Kiran Bambha, MD University of Colorado Denver April 13, 2012 Non-Alcoholic Fatty Liver Disease (NAFLD) Primary NAFLD Simple Steatosis Fatty hepatocytes Intracellular fat
Defective STAT1 activation associated with impaired IFN-g production in NK and T lymphocytes from metastatic melanoma patients treated with IL-2
Defective STAT1 activation associated with impaired IFN-g production in NK and T lymphocytes from metastatic melanoma patients treated with IL-2 SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1:
Supplementary Digital Content
Geissler et al: Sirolimus and Hepatocellular Carcinoma in Liver Transplantation Page 1 of 10 Supplementary Digital Content Supplementary Table 1. Surgical procedures used Total Transplant technique Piggy
ABNORMAL LIVER FUNCTION TESTS. Dr Uthayanan Chelvaratnam Hepatology Consultant North Bristol NHS Trust
ABNORMAL LIVER FUNCTION TESTS Dr Uthayanan Chelvaratnam Hepatology Consultant North Bristol NHS Trust INTRODUCTION Liver function tests Cases Non invasive fibrosis measurement Questions UK MORTALITY RATE
Diagnosing HIV Infection AMNERIS E. LUQUE, M.D. PROFESSOR OF MEDICINE/INFECTIOUS DISEASES MEDICAL DIRECTOR, PARKLAND HIV SERVICES
Diagnosing HIV Infection AMNERIS E. LUQUE, M.D. PROFESSOR OF MEDICINE/INFECTIOUS DISEASES MEDICAL DIRECTOR, PARKLAND HIV SERVICES Disclosures None Objectives 1. Outline the CDC recommendations for HIV
Prognosis of untreated Primary Sclerosing Cholangitis (PSC) Erik Christensen Copenhagen, Denmark
Prognosis of untreated Primary Sclerosing Cholangitis (PSC) Erik Christensen Copenhagen, Denmark Study of Prognosis of PSC Difficulties: Disease is rare The duration of the course of disease may be very
HEALTH SERVICES POLICY & PROCEDURE MANUAL
PAGE 1 of 6 PURPOSE To establish basic understanding of indications and contraindications for transplantation of various organs. POLICY The N.C. Department of Correction, Division of Prisons, Health Services
Comorbidity or medical history Existing diagnoses between 1 January 2007 and 31 December 2011 AF management care AF symptoms Tachycardia
Supplementary Table S1 International Classification of Disease 10 (ICD-10) codes Comorbidity or medical history Existing diagnoses between 1 January 2007 and 31 December 2011 AF management care I48 AF
INFORMED CONSENT FOR ANORECTAL PROCEDURES
516-248-2422 www.crssny.com Locations in Nassau, Suffolk and Queens INFORMED CONSENT FOR ANORECTAL PROCEDURES You may undergo anoscopy or proctosigmoidoscopy as part of your rectal examination. These tests
PREVALENCE OF NAFLD & NASH
- - PREVALENCE OF & USA Prevalence in Middle Age Patients San Antonio, Texas (Williams et al., Gastroenterology 2011; 140:124-31) Dallas Heart Study Prevalence Numbers (Browning et al., Hepatology 2004;40:1387-95)
ENTERIC FEVER LECTURE BY DR. NAJAF MASOOD
ENTERIC FEVER LECTURE BY DR. NAJAF MASOOD DEFINITION Severe systemic disease Caused by salmonella ser typhi Characterized by Prolonge febrile illness Abdominal pain, diarrhea Delirium Rose spot Splenomegally
NEW PATIENT HEALTH HISTORY
Meeks and Zilberfarb Orthopedics 1101 Beacon Street. Brookline, MA 02246 40 Allied Drive, Dedham, MA 02026 Tel: 617-232-2663 Fax: 617-232-6342 Tel:781-326-1561 Fax:781-326-1562 Jeffrey L. Zilberfarb, MD
Patient Information Last Name: First Name: Middle Initial: Address: City: State: Zip Code:
Patient Information Last Name: First Name: Middle Initial: Address: City: State: Zip Code: Date of Birth (MM/DD/YY): Social Security #: Sex: Male Female Home Phone #: Mobile Phone #: Email Address: Marital
Prototypes of autoimmune hepatitis and sclerosing cholangitis in childhood
RIUNIONE MONOTEMATICA AISF 2013 Personalizzazione della Cura in Epatologia 17-19 ottobre 2013, PISA Prototypes of autoimmune hepatitis and sclerosing cholangitis in childhood La sottoscritta dichiara di
Analysis of Sphingosine Kinase Activity in Single Natural Killer Cells from Peripheral Blood
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information: Analysis of Sphingosine Kinase Activity in Single
NON-ALCOHOLIC FATTY LIVER DISEASE (NAFLD) NON-ALCOHOLIC STEATOHEPATITIS (NASH) ADDRESSING A GROWING SILENT EPIDEMIC
NON-ALCOHOLIC FATTY LIVER DISEASE () & NON-ALCOHOLIC STEATOHEPATITIS () ADDRESSING A GROWING SILENT EPIDEMIC PREVALENCE OF / USA Prevalence in Middle Age Patients San Antonio, Texas (Williams et al., Gastroenterology
Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 135091593 Age 25 Years Gender Male 30/8/2017 91600AM 30/8/2017 93946AM 31/8/2017 84826AM Ref By Final COLLAGEN DISEASES ANTIBODY ANEL ANTI NUCLEAR ANTIBODY / FACTOR (ANA/ANF),
Attending Physician s Statement
( Form A A This form is used for claiming the social insurance benefit. This form should be completed and signed by the attending physician outpatient and One form for each month, one form for hospitalization
Hepatitis C: Surveillance, Case Definition, and Investigation
Hepatitis C: Surveillance, Case Definition, and Investigation Tuesday, November 14, 2017 10am 11:30am NJ Department of Health Communicable Disease Service Welcome to the Webinar Today s webinar is being
FLOW CYTOMETRY PRINCIPLES AND PRACTICE. Toby Eyre Consultant Haematologist Oxford University Hospitals NHS Foundation Trust June 2018
FLOW CYTOMETRY PRINCIPLES AND PRACTICE Toby Eyre Consultant Haematologist Oxford University Hospitals NHS Foundation Trust June 2018 Aims and Objectives Principles of flow cytometry Preparation Steps involved
NON-ALCOHOLIC FATTY LIVER DISEASE (NAFLD) NON-ALCOHOLIC STEATOHEPATITIS (NASH) ADDRESSING A GROWING SILENT EPIDEMIC
NON-ALCOHOLIC FATTY LIVER DISEASE () & NON-ALCOHOLIC STEATOHEPATITIS () ADDRESSING A GROWING SILENT EPIDEMIC PREVALENCE OF / USA Prevalence in Middle Age Patients San Antonio, Texas (Williams et al., Gastroenterology
Community Acquired Pneumonia
April 2014 References: 1. Bradley JS, Byington CL, Shah SS, Alverson B, Carter ER, Harrison C, Kaplan SL Mace SE, McCracken Jr. GH, Moor MR, St. Peter SD, Stockwell JA, and Swanson JT. The Management of
Jaundice. Agnieszka Dobrowolska- Zachwieja, MD, PhD
Jaundice Agnieszka Dobrowolska- Zachwieja, MD, PhD Jaundice definition Jaundice, as in the French jaune, refers to the yellow discoloration of the skin. It arises from the abnormal accumulation of bilirubin
Rhinosinusitis. John Ramey, MD Joseph Russell, MD
Rhinosinusitis John Ramey, MD Joseph Russell, MD Disclosure Statement RSFH as a continuing medical education provider, accredited by the South Carolina Medical Association, it is the policy of RSFH to
SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
INFECTION/ INFLAMMATION
HAEMATOLOGY OCTOBER 2017* WHITE PAPER INFECTION/ INFLAMMATION Novel haematological parameters for rapidly monitoring the immune system response Patients with inflammatory disease are common on hospital
SUSTAIN BASELINE DATA COLLECTION FORM. Revised 2/4/2014 (both pediatric and adult data elements) 1. Gestational age at birth ( weeks gestation)
SUSTAIN BASELINE DATA COLLECTION FORM Patient Demographics Revised 2/4/2014 (both pediatric and adult data elements) Did the patient begin Home PN over 90 days ago? Yes No Date began Home PN Patient Number
Study No.: Title: Rationale: Phase: Study Period: Study Design: Centers: Indication: Treatment: Objectives: Primary Outcome/Efficacy Variable:
The study listed may include approved and non-approved uses, formulations or treatment regimens. The results reported in any single study may not reflect the overall results obtained on studies of a product.
Objectives. Challenging Case Studies in Laboratory Diagnosis: A Focus on WBC and Hepatic Testing
Challenging Case Studies in Laboratory Diagnosis: A Focus on WBC and Hepatic Testing Margaret A. Fitzgerald, DNP, FNP-BC, NP-C, FAANP, CSP President, Fitzgerald Health Education Associates, Inc. North
PATIENT DEMOGRAPHICS. Surname. Given name. Pacific Islander (non-maori) ADMISSION DETAILS
Reviewer / hospital Date review started PATIENT DEMOGRAPHICS MRN DOB Sex Patient sticky label if available, else enter details here Surname Post-code Given name Australian Aborigine / TSI Middle Eastern
Please submit supporting medical documentation, notes and test results.
Pharmacy Prior Authorization AETA BETTER HEALTH FLORIDA Valcyte (Medicaid) This fax machine is located in a secure location as required by HIPAA regulations. Complete/review information, sign and date.
Patient Name: First MI Last Preferred Name. DOB: Sex: MALE FEMALE SSN: Address: City: State: Zip Code:
PATIENT DEMOGRAPHICS: Patient Name: First MI Last Preferred Name DOB: Sex: MALE FEMALE SSN: Address: City: State: Zip Code: Home Phone: _( ) Marital Status: Married Single Divorced Widowed Cell Phone:
Autoimmune Hepatitis. Dr. Stefania Casu Hepatology, UVCM, Inselspital Bern. November 14th, 2018
Autoimmune Hepatitis Dr. Stefania Casu Hepatology, UVCM, Inselspital Bern November 14th, 2018 AIH - Definition Manns MP J Hepatol 2015, vol 62, P 100-111 AIH - Definition Autoimmune hepatitis (AIH) is
10/30/2015. XN Case Studies: Every Picture Tells a Story
XN Case Studies: Every Picture Tells a Story Jill Crist MT(ASCP)Field Product Specialist OBJECTIVES Explain how scattergrams and histogram pictures can provide great insight into abnormal hematology samples
Nature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
PRODUCT MONOGRAPH GEMCITABINE INJECTION
PRODUCT MONOGRAPH Pr GEMCITABINE INJECTION Concentrate Sterile Solution for Injection Gemcitabine (as Gemcitabine Hydrochloride) 40 mg gemcitabine per ml 200 mg/5 ml, 1 g/25 ml, 2 g/50 ml Antineoplastic