SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION

Size: px
Start display at page:

Download "SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION"

Transcription

1 SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION

2 CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information about these cases is presented in the form of images, videos, and data. Visual information will be projected on the screens. Data and text will be given in your exam binder. Information given on the screen is not shown on the question page. OBSERVE ALL INFORMATION PRESENTED ON THE SCREEN PRIOR TO ANSWERING QUESTIONS IN YOUR EXAM BINDER. On the front cover of your binder is a sticker that shows your candidate ID number. Please confirm at this time that the ID number on the cover of the binder is your ID number. If it is not your ID number, let a proctor know immediately. The examination binder consists of XX pages of questions, each related to a corresponding screen image. Each image presented on the screen will correspond with one page of the exam. The screen image will show the corresponding page number in your examination binder. For some images, particularly radiographs and ultrasounds, the lights will be dimmed for approximately one minute after you have had a chance to read the question. You will have approximately 30 seconds to read the question before the lights are dimmed. If a question asks for a specific number of responses, you will be graded on only the requested number of answers. Additional responses beyond the number requested will not be graded. For instance, if we ask you for one diagnosis, and you give us two, we will grade only the first answer. Minimize the use of abbreviations to make sure your answer is clearly understood. Commonly used medical abbreviations may be used; however, if you are concerned that the grader may not understand the abbreviation, you should define it. You will have two minutes, four minutes, six minutes or eight minutes to respond to the questions on each page. The time allotted for each page will be indicated on the top of the page, as well as the top of the corresponding screen image. A one-minute warning will be issued prior to moving to the next page. If we experience technical difficulties while showing an image, the time will be stopped and will resume after the problem has been corrected. You will still receive the full amount of time for that question. When the allotted time is up for each question, you will be instructed to turn the page in your binder to the colored plastic divider that follows. Once you turn to the plastic divider, you may NOT go further in the exam until instructed to do so. Therefore, when instructed to do so at the end of each question, you will turn the page to the plastic divider and wait for instructions before turning the plastic divider to the next test question.

3 UNDER NO CIRCUMSTANCES ARE YOU ALLOWED TO MOVE FORWARD IN THE EXAMINATION UNTIL INSTRUCTED. FURTHERMORE, YOU MAY NOT RETURN TO A PREVIOUS PAGE OF QUESTIONS AT ANY TIME DURING THE EXAM. FAILURE TO FOLLOW THESE INSTRUCTIONS WILL RESULT IN DISQUALIFICATION FROM THE EXAM. Scrap paper has been supplied for you to take notes during the exam. You are encouraged to use the scrap paper throughout the exam. You can refer to the notes on your scrap paper for the entire duration of the exam. Your scrap paper will not be scored. Raise your hand if you need additional pencils, have a question, or if you need to leave the room for any reason. We highly recommend that you do not leave the examination for any reason since questions cannot be revisited once they have been shown. Are there any questions before we begin the exam?

4 PAGE 1 (4 minutes) A 15 kg, 8 month old, male, Labrador retriever dog is presented with a history of intermittent circling, ataxia, and occasional vomiting. Physical examination reveals a thin dog with no other abnormalities noted. Laboratory work (complete blood count, chemistry profile with electrolytes, and urinalysis) is performed. Results of a complete blood count and reference ranges are listed below. Abnormal values are in bold font. The image is from the blood smear. Complete blood count Patient Values Reference Range RBC (x 10 6 /μl) Hemoglobin (g/dl) PCV (%) MCV (fl) MCHC (g/dl) WBC (x 10 3 /μl) Neutrophils (x 10 3 /μl) Bands (x 10 3 /μl) Lymphocytes (x 10 3 /μl) Monocytes (x 10 3 /μl) Eosinophils (x 10 3 /μl) Platelets (x 10 3 /μl) Cell morphology: see projected image 1. List three abnormalities visible on the image of the blood smear. C. 2. Interpret the results of the complete blood count.

5 PAGE 2 (4 minutes) Results of the chemistry profile with electrolytes and reference ranges are listed below. Abnormal values are in bold font. Chemistry profile with electrolytes Patient Values Reference Range Total protein (g/dl) Albumin (g/dl) Globulin (g/dl) Alkaline phosphatase (U/L) ALT (U/L) Bilirubin (mg/dl) CK (U/L) BUN (U/L) Creatinine (mg/dl) Calcium (mg/dl) Phosphorus (mg/dl) Magnesium (mg/dl) Glucose (mg/dl) Cholesterol (mg/dl) Bicarbonate (mmol/l) Sodium (meq/l) Potassium (meq/l) Chloride (meq/l) Interpret the results of the chemistry profile.

6 PAGE 3 (2 minutes) Results of the urinalysis are listed below. The image is from the urine sediment. Urinalysis Patient Values Color Yellow Turbidity Clear Specific Gravity ph 8.5 Protein Negative Glucose Negative Ketones Negative Blood Negative Bilirubin 1+ Urobilinogen Trace Urine sediment exam: see projected image 1. Identify the material on the image indicated by the arrow. 2. Based on the results of the urinalysis and blood work presented, list two other clinicopathologic tests that would further characterize this dog s problem.

7 PAGE 4 (2 minutes) Results of serum bile acid analysis and reference ranges are listed below. Abnormal values are in bold font. Serum bile acids Patient Values Reference Range Fasting (µmol/l) 98 < 10 Post-prandial ( µmol/l ) 260 < What do these results indicate? 2. What is the most likely clinical diagnosis? 3. Other than abdominal radiography, list two noninvasive imaging procedures that would be appropriate to perform in this dog. A. B.

8 PAGE 5 (4 minutes) Lateral and ventrodorsal abdominal radiographs of this dog are shown. 1. List two radiographic abnormalities visible on these radiographs. 2. What is the radiographic diagnosis? 3. List four findings on abdominal ultrasonography that would be supportive of your clinical diagnosis. A. B. C. D.

9 PAGE 6 (4 minutes) This image is a composite view of transcolonic scintigraphy from this dog. Cranial (Cr) and caudal (Ca) are indicated. The arrow indicates the location of the xiphoid process. 1. Describe and interpret the results. 2. List two diagnostic limitations to transcolonic scintigraphy other than radiation safety issues. A. B. 3. What is the significance of a shunt fraction of 78% in this dog?

10 PAGE 7 (4 minutes) Portography is performed, and the image is projected. 1. Identify the type of portography that has been performed. 2. Describe the abnormality demonstrated by this image. Be specific. 3. List three advantages of this type of portography compared to other methods of contrast portography. C.

11 PAGE 8 (4 minutes) The diagnosis of a right division intrahepatic portocaval shunt is confirmed. The dog is anesthetized and prepared for abdominal surgery. 1. Other than direct visualization, list three methods for intra-operatively confirming the location of the shunting vessel. A. B. C. 2. List five different procedures for attenuating this right division intrahepatic portocaval shunt at surgery. C. D.. E.

12 PAGE 9 (4 minutes) Partial attenuation of the shunting vessel is achieved with suture, a liver biopsy is obtained, and the dog recovers uneventfully. On the third postoperative day, the dog is normal on physical examination, except for mild abdominal distention. 1. List two complications, other than hemorrhage, hypothermia, or those due to acute portal hypertension, which have been reported as acute complications of portosystemic shunt attenuation. 2. What is the most likely mechanism for the abdominal distention in this dog? 3. Is treatment of the abdominal distention in this dog necessary? Yes No 4. If yes, list the treatment. 5. Make short-term postoperative dietary recommendations for this dog. 6. Make short-term postoperative treatment recommendations for this dog.

13 PAGE 10 (4 minutes) 1. List four prognostic factors relating to survival which have been identified by Papazoglou, et al. (Vet Surg 31: , 2002) in dogs with intrahepatic portosystemic shunts. C. D. 2. List which hepatic lobe(s) or process(es) undergo(es) atrophy after ligation of the right branch of the portal vein as reported by Tobias, et al. (Vet Surg 33:32-39, 2004). This Concludes the Small Animal Soft Tissue Case-Based Examination

SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION

SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information

More information

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. 1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61

More information

COMPANY OR UNIVERSITY

COMPANY OR UNIVERSITY CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota

More information

HYPERCALCEMIC GOLDEN RETRIEVER

HYPERCALCEMIC GOLDEN RETRIEVER Presenter: Laura Martínez 1, 2 HYPERCALCEMIC GOLDEN RETRIEVER Contributors: Laia Solano-Gallego 2, Josep Pastor 2, Alberto J. Marco 3, María Cuvertoret-Sanz 3, Rosa Novellas 1,2, Anna Vila 1, 2, Xavier

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer

More information

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310) 8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)

More information

ENROLLMENT CONFIRMATION

ENROLLMENT CONFIRMATION Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer

More information

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

Supplementary materials

Supplementary materials Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma

More information

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase

Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Presented by: Dr. Giuseppe Molinaro Dr. Davide De Biase Dog Spayed Female LABRADOR RETRIEVER 3 Years old VACCINATIONS ANTIPARASITIC COMMERCIAL DIET VOMITING FOR A MONTH DULLNESS WEIGHT LOSS INAPPETANCE

More information

Inspector's Accreditation Unit Activity Menu

Inspector's Accreditation Unit Activity Menu 01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Purdue Veterinary Clinical Pathology Laboratory

Purdue Veterinary Clinical Pathology Laboratory Order Comments: 8/1/2017 2:27 PM OSA? rinalysis Final - Approved 8/1/2017 2:27 PM Color Turbidity Specific Gravity p Protein Glucose Ketones Bilirubin Blood robilinogen WBC RBC Epithelial Cells Bacteria

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of

What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such

More information

Hematology TOONYA TURNER. IDEXX Services: Senior Profile with Heartworm -Standard CBC. RBC M/µL. Hematocrit

Hematology TOONYA TURNER. IDEXX Services: Senior Profile with Heartworm -Standard CBC. RBC M/µL. Hematocrit TOONYA TURNER PET OWNER: TURNER SPECIES: Cnine BREED: GENDER: Femle AGE: 1 Yers PATIENT ID: 17047 Fmily Pet Helth Cre 3623 Indin Hills Rod Dectur, Albm 35603 256-341-0200 ACCOUNT #: 87040 ATTENDING VET:

More information

Test Result Reference Range Flag

Test Result Reference Range Flag Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

10 Essential Blood Tests PART 1

10 Essential Blood Tests PART 1 Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

Australian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1

Australian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1 Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after

More information

Results Report. Welcome to Your ABT Report!

Results Report. Welcome to Your ABT Report! Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

WHAT IS YOUR DIAGNOSIS?

WHAT IS YOUR DIAGNOSIS? WHAT IS YOUR DIAGNOSIS? A 12 year old, female neutered domestic shorthaired cat was presented to the R(D)SVS Feline Clinic with a 6 week history of polydipsia and polyuria, which was not quantified. The

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

The Blood Chemistry Panel Explained

The Blood Chemistry Panel Explained The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems

More information

Date Time By Code Description Qty (Variance) Photo

Date Time By Code Description Qty (Variance) Photo Adobe Animal Hospital 6331 Haven Ave., Suite 4 Rancho Cucamonga, CA 91737 909-483-3535 Patient Chart Printed: 03-16-17 at 9:44a CLIENT INFORMATION Name Ms. Amanda Barber (1394) Address 10850 Church St.

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Delta Check Calculation Guide

Delta Check Calculation Guide Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2

More information

Age: 14 Houston TX 77007

Age: 14 Houston TX 77007 Patient Medical History HEIGHTS HOSPITAL FOR ANIMALS Bernie Rogers Patient: JACK DOB: 08/26/1999 720 Courtlandt St. Species: FELINE Age: 14 Houston TX 77007 Breed: Domestic Shorthair Sex: MN Color: Black

More information

Routine Clinic Lab Studies

Routine Clinic Lab Studies Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection

More information

LabDriver Audit Trail Example

LabDriver Audit Trail Example LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: 0902168 Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009

More information

Documentation Dissection

Documentation Dissection History of Present Illness: Documentation Dissection The patient is a 50-year-old male c/o symptoms for past 4 months 1, severe 2 bloating and stomach cramps, some nausea, vomiting, diarrhea. In last 3

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Pathology Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Pathology Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2014 Veterinary Pathology Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer

More information

BC Biomedical Laboratories Adult Reference Ranges

BC Biomedical Laboratories Adult Reference Ranges BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100

More information

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

SAFETY ASPECTS OF MIDAZOLAM

SAFETY ASPECTS OF MIDAZOLAM Br. J. clin. Pharmac. (1983), 16, 37S-41S Biological Pharmaceutical Research Department, F. Hoffmann-La Roche & Co Ltd, CH-4002 Basle, Switzerland 1 The LD50 in the rat and the mouse is about 1600 mg/kg

More information

(7) VITAL SIGNS (8) LEVEL OF CONSCIOUSNESS (9) MENTAL STATUS (10) SPEECH (11) VISION (12) FUNDUS (PAPILLEDEMA)

(7) VITAL SIGNS (8) LEVEL OF CONSCIOUSNESS (9) MENTAL STATUS (10) SPEECH (11) VISION (12) FUNDUS (PAPILLEDEMA) Radiation Therapy Oncology Group Phase II CNS Lymphoma Follow-Up Form RTOG Study No. 1114 Case # Amended Data Yes INSTRUCTIONS: Submit this form as indicated in the protocol. All dates need to be recorded

More information

Multiphasic Blood Analysis

Multiphasic Blood Analysis Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary

More information

Gastrointestinal Markers

Gastrointestinal Markers Gastrointestinal Markers Session 2 Gastrointestinal System Reference Ranges Optimal Range Ttl Total Protein ti 69 6.9 74 7.4 Globulin 2.4 2.8 BUN 10 16 Creatinine 0.8 1.1 Phosphorous 3.0 4.0 Eosinophils

More information

B. PANITUMUMAB DOSE LEVEL 0 No dose reduction 1 Level -1 2 Level Other, specify in comments for this cycle

B. PANITUMUMAB DOSE LEVEL 0 No dose reduction 1 Level -1 2 Level Other, specify in comments for this cycle Radiation Therapy Oncology Group Phase II Study Pre-operative Chemo- Radiation + Panitumumab for Potentially Operable Lung Cancer Concurrent Summary Form AMENDED DATA YES INSTRUCTIONS: Submit all pages

More information

MHD I SESSION X. Renal Disease

MHD I SESSION X. Renal Disease MHD I, Session X, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD I SESSION X Renal Disease Monday, November 11, 2013 MHD I, Session X, Student Copy Page 2 Case #1 Cc: I have had weeks of diarrhea

More information

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0. LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

GRADING CRITERIA for CMS Regulated Analytes

GRADING CRITERIA for CMS Regulated Analytes CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers

More information

Definition : Stages : ( RIFLE vs. AKIN ) Causes and classification : Pre-renal Renal Post- renal Clinical manifestations and Complication Management

Definition : Stages : ( RIFLE vs. AKIN ) Causes and classification : Pre-renal Renal Post- renal Clinical manifestations and Complication Management AKI Definition : Stages : ( RIFLE vs. AKIN ) Causes and classification : Pre-renal Renal Post- renal Clinical manifestations and Complication Management and indications for RRT Etiology prerenal causes

More information

ROUTINE LAB STUDIES. Routine Clinic Lab Studies

ROUTINE LAB STUDIES. Routine Clinic Lab Studies ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not

More information

EXAMPLE REPORT ONLY Contact AMS Biotechnology for current donor specific information

EXAMPLE REPORT ONLY Contact AMS Biotechnology for current donor specific information EXAMPLE REPORT ONLY Contact AMS Biotechnology for current donor specific information NAME DIAGNOSIS PROTOCOL OF EVALUATION for Chronic Lymphatic Leukemia (CLL) GENERAL INFORMATION (ALL information required!!)

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Chen CL, Lin GA, Bardach NS, et al. Preoperative medical testing

More information

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150. Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,

More information

Slide # 23 peripheral blood smear from a dog

Slide # 23 peripheral blood smear from a dog Slide # 23 peripheral blood smear from a dog Cinzia Mastrorilli 1, Elizabeth Welles 1, Lauren Reid 2 1 Department of Pathobiology, 2 Department of Clinical Science College of Veterinary Medicine, Auburn

More information

Glossary of terms used in College examinations. The Royal College of Emergency Medicine

Glossary of terms used in College examinations. The Royal College of Emergency Medicine Glossary of terms used in College examinations The Royal College of Emergency Medicine The CEM uses several terms in examinations that may cause confusion. The following definitions are intended as a guide

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Veterinary Emergency and Critical Care Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours

More information

HEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE

HEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE HEALTH SCREEN CARE VIGNE Healthcare provides a comprehensive Health Screening Package of Silver Gold Platinum Cancer EXCLUSIVE HEALTH SCREENING EXPERIENCE Meet & Greet Medical Review with Doctor Appointment

More information

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation

More information

Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test.

Color: BROWN/WHITE. Protein test is performed and confirmed by the sulfosalicylic acid test. 5/8/2014 L 29 UA/Microscopy results from IDEXX Reference GLUCOSE NEGATIVE BILIRUBIN NEGATIVE KETONES NEGATIVE BLOOD NEGATIVE PH 6.5 SP GRAVITY 1.031 PROTEIN NEGATIVE UROB NORMAL WBC NONE SEEN HPF 0-5 RBC

More information

Fullerton Healthcare Screening Centres

Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday

More information

Get to know yourself better. Attend our health screening event.

Get to know yourself better. Attend our health screening event. Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION

More information

ADPedKD: detailed description of data which will be collected in this registry

ADPedKD: detailed description of data which will be collected in this registry ADPedKD: detailed description of data which will be collected in this registry I. Basic data 1. Patient ID: will be given automatically 2. Personal information - Date of informed consent: DD/MM/YYYY -

More information

Results Report. Welcome to Your ABT Report! Introduction to the ABT Report

Results Report. Welcome to Your ABT Report! Introduction to the ABT Report Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Dec 08, 2017 Panel: ABT Gold Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be a

More information

Get to know yourself better. Attend our health screening event.

Get to know yourself better. Attend our health screening event. Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening

More information

Online catalog

Online catalog This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)

More information

CRRT Fundamentals Pre-Test. AKI & CRRT 2017 Practice Based Learning in CRRT

CRRT Fundamentals Pre-Test. AKI & CRRT 2017 Practice Based Learning in CRRT CRRT Fundamentals Pre-Test AKI & CRRT 2017 Practice Based Learning in CRRT Question 1 A 72-year-old man with HTN presents to the ED with slurred speech, headache and weakness after falling at home. He

More information

i. Where is the participant seen?

i. Where is the participant seen? PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant

More information

Blood Test Results Report

Blood Test Results Report Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or

More information

MHD I Session VIII Renal Disease November 6, 2013 STUDENT COPY

MHD I Session VIII Renal Disease November 6, 2013 STUDENT COPY MHD I, Session VIII, Student Copy Page 1 MHD I Session VIII Renal Disease November 6, 2013 STUDENT COPY MHD I, Session VIII, Student Copy Page 2 Case #1 Chief Complaint: I have been feeling just lousy

More information

2010 Miniboard Exam- Clinical Pathology

2010 Miniboard Exam- Clinical Pathology 2010 Miniboard Exam- Clinical Pathology 1. All of the following findings are noted in cats with hyperthyroidism EXCEPT: A. Anemia B. Increased creatinine C. Hyperglycemia D. Elevated ALP (bone isoenzyme)

More information

Electrolytes by case examples. Graham Bilbrough, European Medical Affairs Manager

Electrolytes by case examples. Graham Bilbrough, European Medical Affairs Manager Electrolytes by case examples Graham Bilbrough, European Medical Affairs Manager 1 Acid-bases disturbances Generally result from one of the following: 1. damage to an organ such as the kidneys or lungs

More information

M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017

M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory

More information

Chapter 4. M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University.

Chapter 4. M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University. Chapter 4 M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University. RBC (Erythrocytes): RBC COUNT: NORMAL VALUES: For men: 4.3-5.9 millions/mm 3 of blood. For women: 3.5-5.0

More information

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range 5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN

More information

What s Your Diagnosis? Allison Crow, Class of 2014

What s Your Diagnosis? Allison Crow, Class of 2014 What s Your Diagnosis? Allison Crow, Class of 2014 Signalment: 13 year old male castrated mixed breed dog History: The patient presented to the rdvm for pain in the hind end, weakness and neck stretching

More information

WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL

WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used

More information

POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO

POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the

More information

URINANLYSIS. Pre-Lab Guide

URINANLYSIS. Pre-Lab Guide URINANLYSIS Pre-Lab Guide NOTE: A very useful Study Guide! This Pre-lab guide takes you through the important concepts that where discussed in the lab videos. There will be some conceptual questions on

More information

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar

More information

Cirrhosis and Portal Hypertension Gastroenterology Teaching Project American Gastroenterological Association

Cirrhosis and Portal Hypertension Gastroenterology Teaching Project American Gastroenterological Association CIRRHOSIS AND PORTAL HYPERTENSION Cirrhosis and Portal Hypertension Gastroenterology Teaching Project American Gastroenterological Association WHAT IS CIRRHOSIS? What is Cirrhosis? DEFINITION OF CIRRHOSIS

More information

BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L

BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test

More information

VOICE Screening Part 1 Visit. Operational Walkthrough Johannesburg, South Africa November 2008

VOICE Screening Part 1 Visit. Operational Walkthrough Johannesburg, South Africa November 2008 VOICE Screening Part 1 Visit Operational Walkthrough Johannesburg, South Africa November 2008 Protocol Requirements Administrative, Behavioral, and Regulatory Procedures Informed consent for screening

More information

PET CARE VETERINARY CARE CENTER 2009 W SLAUSON AVE ACCOUNT #: ATTENDING VET: ANDERSON, DVM, JOY

PET CARE VETERINARY CARE CENTER 2009 W SLAUSON AVE ACCOUNT #: ATTENDING VET: ANDERSON, DVM, JOY Text KISMET EVENTOFF PET OWNER: EVENTOFF SPECIES: Feline BREED: GENDER: Female AGE: 2 Months PATIENT ID: PET CARE VETERINARY CARE CENTER 2009 W SLAUSON AVE 323-294-4030 ACCOUNT #: 93530 ATTENDING VET:

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Veterinary Emergency and Critical Care Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours

More information

Variable Included. Excluded. Included. Excluded

Variable Included. Excluded. Included. Excluded Table S1. Baseline characteristics of patients included in the analysis and those excluded patients because of missing baseline serumj bicarbonate levels, stratified by dialysis modality. Variable HD patients

More information

WHAT IS YOUR DIAGNOSIS?

WHAT IS YOUR DIAGNOSIS? WHAT IS YOUR DIAGNOSIS? A 1.5 year, male neuter, domestic shorthair cat was presented to the R(D)SVS Internal Medicine Service with a three month history of pica (ingestion of cat litter and licking concrete)

More information

SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units

SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test

More information

M Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES

M Series. Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES M Series Health Screening Just Got A Whole Lot Easier EARLY DETECTION BETTER MANAGEMENT IMPROVED OUTCOMES ABOUT MINMED We are a progressive medical group that enlarges organically by growing constantly,

More information

Clinical Laboratory Science: Urinalysis

Clinical Laboratory Science: Urinalysis Clinical Laboratory Science: Urinalysis Urine is produced by the kidney to maintain constant plasma osmotic concentration; to regulate ph, electrolyte and fluid balances and to excrete some 50 grams of

More information

Miniboard Exam 2011 Veterinary Pathology - Clinical Pathology

Miniboard Exam 2011 Veterinary Pathology - Clinical Pathology Miniboard Exam 2011 Veterinary Pathology - Clinical Pathology 1. The following information is given for an 8 year old felid: Na+ - 138 mmol/l Cl - 102 mmol/l Mg+- 2.4 mmol/l Phos- 11.2 mg/dl Ca²+- 10.1

More information

*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:

*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible: Rick Gold, Certified FDN Practitioner Gold Functional Wellness, Inc. Web: http://goldfunctionalwellness.com/ Phone: (561)270-6364 Email: Rick@goldfunctionalwellness.com Schedule a consultation: https://snapappointments.com/listing/38c

More information