Unexplained Sudden Cardiac Death in Saudi Arabia. Klinische Genetica
|
|
|
- Jodie Casey
- 5 years ago
- Views:
Transcription
1 Unexplained Sudden Cardiac Death in Saudi Arabia
2
3 Sudden Unexplained Death Boy: 1 year Girl: 1 and ½ year Girl: 16 year Boy: 26 year Boy: 16 year
4 Family A and B: Referred by Dr. Tarek Momenah, PSCC Family A Family B I:1 I:2 II:1 II:2 II:3 II:4 I:1 I:2 III:1 III:2 III:3 III:4 III:5 III:6 II:1 II:2 II:3 II:4 II:5 II:6 IV:1 IV:2 Family A: V: 1 V: 2 V: 3 V: 4 VI:1: Sudden Death at 10 yrs, drowning VI:2: Sudden death at 5 yrs. VI:4: 3yrs, Aborted Sudden Cardiac Arrest VI:5: Sudden death at 12 yrs Family B: VI:1 VI:2 VI:3 VI:4 VI:5 II:1: Sudden Death at 2 yrs with Convulsion II:4: 14 yrs, Aborted Sudden Cardiac Arrest
5 Heart Function at the of Cellular the Heart Level Sino-atrial node Atrio-ventricular node Left atrium JUP DSC2 DSG2 PKP2 DSP PKP2 Right atrium DSG2 DSC2 JUP DSP Right Ventricle Left Ventricle R P T Q S
6 Heart at the Cellular Level: Ion Channels
7 Cardiac Arrhythmia Syndromes Long QT Syndrome Brugada Syndrome Catecholamine-induced PMVT/VF Short QT Syndrome Isolated Cardiac Conduction Disorders Familial Atrial Fibrillation Sinus Node Disease, Atrial Standstill Arrhythmogenic Right Ventricular Dysplasia/ Cardiomypathy
8 Family A and B: Referred by Dr. Tarek Momenah, PSCC Family A Family B I:1 I:2 II:1 II:2 II:3 II:4 I:1 I:2 III:1 III:2 III:3 III:4 III:5 III:6 II:1 II:2 II:3 II:4 II:5 II:6 IV:1 IV:2 Family A: V: 1 V: 2 V: 3 V: 4 VI:1: Sudden Death at 10 yrs, drowning VI:2: Sudden death at 5 yrs. VI:4: 3yrs, Aborted Sudden Cardiac Arrest VI:5: Sudden death at 12 yrs Family B: VI:1 VI:2 VI:3 VI:4 VI:5 II:1: Sudden Death at 2 yrs with Convulsion II:4: 14 yrs, Aborted Sudden Cardiac Arrest
9 Investigation of Familial Cardiac Arrhythmia Syndromes Clinical Phenotypes Triggering Factor Family History ECG Phenotypes
10 ECG of Family Members with History of Sudden Unexplained Death Father Mother Healthy Son Child with History of Unconsciousness
11 ECG of Family Members with History of Sudden Unexplained Death Father Mother Healthy Son Child with History of Unconsciousness
12 DNA Analysis: KCNQ1 Gene T>A (homozygous) Exon 2 T>A (heterozygous) Exon 2 GTCTAGCAGCTTCCT Patients GTCT T GCAGCTTCCT Heterozygous carriers
13 DNA Analysis: KCNQ1 Gene -5 T>A intron 1 E1a E1b E2 E3 E4 E5 E15
14 Arrhythmia Causing Founder Mutation in Assir Family A Family B I: 1 I: 2 I:1 I:2 II:1 II:2 II:3 II:4 III: 1 IV: 1 III: 2 IV: 2 III: 3 III: 4 III: 5 III: 6 II:1 II:2 II:3 II:4 II:5 II:6 1 1 g g c c D11S4046 (KCNQ1) Exon 13 (KCNQ1) Exon 16 D11S1338 D11S902 V:1 2 1 V:2 3 1 V: 3 a g a g c c c t V:4 D11S4046 (KCNQ1) Exon 13 (KCNQ1) Exon 16 D11S1338 D11S902 VI: 1 VI: 2 VI: 32 1 a g c t VI: 41 1 g g c t VI: 5
15 Arrhythmia Causing Founder Mutation in Assir N. N. H H Courtesy of Dr. Safar Al-Shahrani, Khamis Mashayt Military Hospital
16 c.387-5t>a in KCNQ1 gene is an Ancestral Founder Mutation in Assir Region of Saudi Arabia: Responsible for Cardiac Arrhythmia Quite significant number of people from Assir region Carry this mutation.
17 Gene Mutation Aberrant Protein Structure/Function Pathology Disease (Arrhythmia)
18 Mutation affects the Conduction Property of the Heart
19
20 ECG ECG-Patient from the Patient
21 ECG ECG-Father from Father
22 ECG ECG-Mother from Mother
23 ECG from the Brother
24 ECG ECG-Sister from the Sister
25 Genetic Analysis Control Patient AAGGGGAGACTCTGCTGACACCC AAGGGGAGACTGCTGACACCC Father Mother AAGGGGAGACT AAGGGGAGACT
26 Genetic Analysis Control Patient AAGGGGAGACTCTGCTGACACCC AAGGGGAGACTGCTGACACCC Father Mother AAGGGGAGACT AAGGGGAGACT
27 c.1486_1487delct in KCNQ1 gene is MOST LIKELY an Ancestral Founder Mutation in Al Baha region of Saudi Arabia: Responsible for Cardiac Arrhythmia
28 Disease Transmission from Both Parents
29 What About Madinah
30 Patient from Madinah 2 yr old girl: Arrhythmia & Deaf
31 Patient from Madinah Father: NO symptom
32 Patient from Madinah Mother with occasional palpitation
33 Patient from Madinah
34 Patient from Madinah Control Patient TGGGCCTCATCTTCTCCTCGTAC TGGGCCTC Control Patient TGTGGTGGTGATGAGCCCAC TGTGGTGGTGATGAGCCCAC
35 Disease Transmission: De Novo Origin
36 Sudden Unexplained Death Boy: 1 year Girl: 1 and ½ year Girl: 16 year Boy: 26 year Boy: 16 year
37 ECG of the 6 yr old girl QTc= 453 ms
38 Screening of the KCNQ1 Gene 1168-TCCACCTGGAAGATCTACATC 390- S T W K I Y I 1168-TCCACCTGGAATATCTACATC 390- S T W N I Y I
39 Screening of the KCNQ1 Gene Heterozygous G>T Homozygous G>T 1168-TCCACCTGGAAGATCTACATC 390- S T W K I Y I 1168-TCCACCTGGAATATCTACATC 390- S T W N I Y I
40 Neonatal Arrhythmia
41 Patient from Assir I:1 I:2 D7S661 D7S636 D7S798 D7S miscarriage, 8th week II:1 II:2 II:3 II:4 II:5 II:6 II:7 Miscarriage, 10th week Still birth, 29th week D7S661 D7S636 D7S798 D7S nd week: bradycardia th week: bradycardia/ tachyarrhythmia still birth: 29th week nd week: bradycardia 24th week: bradycardia/ tachyarrhythmia
42 ECG: First day
43 ECG: Father, Mother, Brother Father Mother Brother
44 New Family from Assir
45 ECG of the Neonate
46 Screening the KCNH2 Gene
47 c.3208 C>T in KCNH2 gene is an Ancestral Founder Mutation in Assir Region of Saudi Arabia: Responsible for Cardiac Arrhythmia
48
49 Conclusions from the Study Role of Genetics is Sudden Cardiac Death. Crucial in Cardiac Arrhythmia and/or We have identified several ancestral founder mutations in Saudi Arabia, which are NOT UNCOMMON. Timely identification of the Genetic Aetiology will lead to proper preventive and as well curative measures. Genetic Investigation should always be considered in patient management.
50 Clinical Genetic Investigation of Arrhythmia Princess Al-Jawhara Center of Excellence in Research of Hereditary Disorders King Abdulaziz University, Medical School, Jeddah Tel: Ext# or Fax: Ext # or E. mail: pachd@kau.edu.sa or : Z.A.Bhuiyan@CHUV.CH
51 Acknowledgments Dr. Tarek Momenah, PSCC, Riyadh Prof. Dr. Arthur Wilde, Amsterdam University Dr. Saleh Al-Ghamdi, PSCC, Riyadh Dr. Jumana Al-Aama, PACER-HD, Jeddah Dr. Safar Al-Shahrani, Khamis Mashayt Military Hospital Ms. Khalda Nasser, Ms. Alaa Qarawi, PACER-HD, Jeddah. King Abdulaziz City for Science & Technology
52 Merci beaucoup
53 Cellular Localization Control Patients
54 Electrical Property of the Mutant KCNQ1
55 Disease Transmission from One Parent
56 Disease Transmission: De Novo Origin
57 Conclusions from the Study c T>A (KCNQ1) is a LQT, type 1 causing Founder mutation in Saudi Arabia. Biallelic/Homozygous carriers are highly susceptible to Fatal Arrhythmias and Sudden Death (but no Deafness). Monoallelic carriers for this mutation are unlikely to suffer from LQT1 mediated arrhythmia. Cascade screening is strongly recommended in this community for this mutation as β blockers could effectively protect the carriers from unexpected sudden deaths.
58 Family-C: Homozygosity Mapping
59 Family-D
Inherited Arrhythmia Syndromes
Inherited Arrhythmia Syndromes When to perform Genetic testing? Arthur AM Wilde February 4, 2017 Which pts should undergo genetic testing? SCD victims with a likely diagnosis Pts diagnosed with an inherited
Pearls of the ESC/ERS Guidelines 2015 Channelopathies
Pearls of the ESC/ERS Guidelines 2015 Channelopathies Carina Blomstrom Lundqvist Dept Cardiology, Uppsala, Sweden Content 2015 ESC Guidelines for the Management of Patients with Ventricular Arrhythmias
CONGENITAL LONG QT SYNDROME(CLQTS) ASSOCIATED WITH COMPLETE ATRIOVENTRICULAR BLOCK. A CASE REPORT.
CONGENITAL LONG QT SYNDROME(CLQTS) ASSOCIATED WITH COMPLETE ATRIOVENTRICULAR BLOCK. A CASE REPORT. SAHA Annual Congress 2017. Samkelo Jiyana, Adele Greyling, Andile Nxele, ZM,Makrexeni,L.Pepeta. BACKGROUND
Rhythm and Blues Drugs and QT Prolongation
Rhythm and Blues Drugs and QT Prolongation Dr Martin Quinn St Vincents University Hospital Irish Medication Safety Network conference Farmleigh 18 Oct 2013 Drugs and QT Prolongation Anti-psychotic, antidepressant,
Interpretation and Consequences of Repolarisation Changes in Athletes
Interpretation and Consequences of Repolarisation Changes in Athletes Professor Sanjay Sharma E-mail sasharma@sgul.ac.uk @SSharmacardio Disclosures: None Athlete s ECG Vagotonia Sinus bradycardia Sinus
Prolonged QT Syndromes: Congenital and Acquired
Prolonged QT Syndromes: Congenital and Acquired April 30, 2014 Elizabeth S. Kaufman, MD I have no financial disclosures. MetroHealth Campus, Case Western Reserve University Prolonged QT Syndromes Congenital
Hereditary Cardiovascular Conditions. genetic testing for undiagnosed diseases
Hereditary Cardiovascular Conditions genetic testing for undiagnosed diseases What is Hypertrophic Cardiomyopathy (HCM)? normal heart heart with hcm Extra or thick heart muscle Typically in the left ventricle
State of the Molecular Autopsy
State of the Molecular Autopsy Michael J. Ackerman, MD, PhD Windland Smith Rice Cardiovascular Genomics Research Professor Professor of Medicine, Pediatrics, and Pharmacology Director, Long QT Syndrome/Genetic
The Role of Defibrillator Therapy in Genetic Arrhythmia Syndromes
The Role of Defibrillator Therapy in Genetic Arrhythmia Syndromes RHEA C. PIMENTEL, MD, FACC, FHRS UNIVERSITY OF KANSAS HOSPITAL MID AMERICA CARDIOLOGY AUGUST 19, 2012 Monogenic Arrhythmia Syndromes Mendelian
Case-Based Practical ECG Interpretation for the Generalist
Case-Based Practical ECG Interpretation for the Generalist Paul D. Varosy, MD, FACC, FAHA, FHRS Director of Cardiac Electrophysiology VA Eastern Colorado Health Care System Associate Professor of Medicine
FANS Long QT Syndrome Investigation Protocol (including suspected mutation carriers)
Clinical Features FANS Long QT Syndrome Investigation Protocol (including suspected mutation carriers) History Syncope or presyncope compatible with ventricular tachyarrhythmia, especially relating to
Drugs Controlling Myocyte Excitability and Conduction at the AV node Singh and Vaughan-Williams Classification
Drugs Controlling Myocyte Excitability and Conduction at the AV node Singh and Vaughan-Williams Classification Class I Na Channel Blockers Flecainide Propafenone Class III K channel Blockers Dofetilide,
Left cardiac sympathectomy to manage beta-blocker resistant LQT patients
Left cardiac sympathectomy to manage beta-blocker resistant LQT patients Lexin Wang, M.D., Ph.D. Introduction Congenital long QT syndrome (LQTS) is a disorder of prolonged cardiac repolarization, manifested
Sudden cardiac death: Primary and secondary prevention
Sudden cardiac death: Primary and secondary prevention By Kai Chi Chan Penultimate Year Medical Student St George s University of London at UNic Sheba Medical Centre Definition Sudden cardiac arrest (SCA)
Is There a Genomic Basis to Acquired Channelopathic disease
Is There a Genomic Basis to Acquired Channelopathic disease Yaniv Bar-Cohen, M.D. Associate Professor of Pediatrics Division of Cardiology / Electrophysiology Children s Hospital Los Angeles Keck School
CHANNELOPATHIES IS GENETIC TESTING ESSENTIAL IN PTS MANAGEMENT
CHANNELOPATHIES IS GENETIC TESTING ESSENTIAL IN PTS MANAGEMENT Inherited and Rare Cardiac Diseases Unit Heart Center for the Young and Athletes ONASSIS CARDIAC SURGERY CENTRE DIAGNOSIS ION CHANNEL DISEASE
ICD in a young patient with syncope
ICD in a young patient with syncope Konstantinos P. Letsas, MD, FESC Second Department of Cardiology Evangelismos General Hospital of Athens Athens, Greece Case presentation A 17-year-old apparently healthy
Investigating the family after a sudden cardiac death. Dr Catherine Mercer Consultant Clinical Geneticist, Wessex
Investigating the family after a sudden cardiac death Dr Catherine Mercer Consultant Clinical Geneticist, Wessex Sudden adult deaths subdivided Sudden Adult Death Sudden Cardiac Death Sudden Arrhythmic
Patient Resources: Cardiac Channelopathies
Patient Resources: Cardiac Channelopathies Overview of Cardiac Channelopathies: CPVT, Long QT Syndrome and Brugada Syndrome Heart muscle cells contract because of movement of certain molecules (called
SEMINAIRES IRIS. Sudden cardiac death in the adult. Gian Battista Chierchia. Heart Rhythm Management Center, UZ Brussel. 20% 25% Cancers !
Sudden cardiac death in the adult Gian Battista Chierchia. Heart Rhythm Management Center, UZ Brussel.! " # $ % Cancers National Vital Statistics Report, Vol 49 (11), Oct. 12, 2001. 20% 25% State-specific
Diploma in Electrocardiography
The Society for Cardiological Science and Technology Diploma in Electrocardiography The Society makes this award to candidates who can demonstrate the ability to accurately record a resting 12-lead electrocardiogram
Ion channel dysfunction and diseases of the heart
Basisvorlesung (BVO) Zelluläre Signaltransduktion- Krankheitsbilder Sommersemester 2015 902.384 PhD- Programm Molecular Signal Transduction Ion channel dysfunction and diseases of the heart H. Todt Dpt.
Exercise guidelines in athletes with isolated repolarisation abnormalities and structurally normal heart.
Exercise guidelines in athletes with isolated repolarisation abnormalities and structurally normal heart. Hanne Rasmusen Consultant cardiologist, PhD Dept. of Cardiology Bispebjerg University Hospital
Genetic testing in Cardiomyopathies
Genetic testing in Cardiomyopathies Silvia Giuliana Priori Cardiovascular Genetics, Langone Medical Center, New York University School of Medicine, New York, USA and Molecular Cardiology, IRCCS Fondazione
Genetics of Sudden Cardiac Death. Geoffrey Pitt Ion Channel Research Unit Duke University. Disclosures: Grant funding from Medtronic.
Genetics of Sudden Cardiac Death Geoffrey Pitt Ion Channel Research Unit Duke University Disclosures: Grant funding from Medtronic Duke U N I V E R S I T Y Sudden Cardiac Death High incidence 50-100 per
Wojciech Szczepański, MD, PhD Department of Pediatrics, Endocrinology, Diabetology with Cardiology Division Medical University of Bialystok
Channelopathies: - Long QT syndrome - Short QT syndrome - Brugada syndrome - Early repolarization syndrome - Catecholaminergic polymorphic ventricular tachycardia Wojciech Szczepański, MD, PhD Department
Tailored therapy in long QT syndrome
Tailored therapy in long QT syndrome Dominic Abrams St. Bartholomew s & Great Ormond Street Hospitals London, UK Disclosures None Tailored therapy in long QTS Which patients should have tailored therapy...?...
Case studies in Channelopathies
Case studies in Channelopathies FABRICE CHOUTY, MD MEDICAL DIRECTOR HANNOVER-LIFE RE, PARIS (F) INTRODUCTION Thanks to the invasive electrophysiology and the progress of imaging techniques as well as the
The Genetics and Prevention of Sudden Cardiac Death
The Genetics and Prevention of Sudden Cardiac Death Sudden cardiac death (SCD), a serious public health problem Every day, between 1,600 and 2,000 people die worldwide from genetically caused SCD. 1 SCD
Congenital long QT syndrome of particularly malignant course connected with so far unknown mutation in the sodium channel SCN5A gene
CASE REPORT Cardiology Journal 2013, Vol. 20, No. 1, pp. 78 82 10.5603/CJ.2013.0012 Copyright 2013 Via Medica ISSN 1897 5593 Congenital long QT syndrome of particularly malignant course connected with
Modeling of Anatomy, Electrophysiology and Tension Development in the Human Heart
European Functional Cardiac Modeling Meeting Modeling of Anatomy, Electrophysiology and Tension Development in the Human Heart Dr.-Ing. Gunnar Seemann Overview Electrophysiology Tension development Anatomy
Implications of the new diagnostic criteria for ARVC
EUROECHO 2010 Echocardiographic assessment of cardiomyopathies Implications of the new diagnostic criteria for ARVC Barbara Bauce, MD, PhD Department of Cardiac, Thoracic and Vascular Sciences University
WINDLAND SMITH RICE SUDDEN DEATH GENOMICS LABORATORY
Learning Objectives to Disclose: To CRITIQUE the ICD and its role in the treatment of BrS, CPVT, and LQTS WINDLAND SMITH RICE SUDDEN DEATH GENOMICS LABORATORY Conflicts of Interest to Disclose: Consultant
Emergency Medical Training Services Emergency Medical Technician Paramedic Program Outlines Outline Topic: WPW Revised: 11/2013
Emergency Medical Training Services Emergency Medical Technician Paramedic Program Outlines Outline Topic: WPW Revised: 11/2013 Wolff-Parkinson-White syndrome (WPW) is a syndrome of pre-excitation of the
Chapter 16: Arrhythmias and Conduction Disturbances
Complete the following. Chapter 16: Arrhythmias and Conduction Disturbances 1. Cardiac arrhythmias result from abnormal impulse, abnormal impulse, or both mechanisms together. 2. is the ability of certain
Long Q. Long QT Syndrome. A Guide for
Long Q Long QT Syndrome A Guide for Introduction Long QT syndrome (LQTS) is a genetic heart disorder due to the malfunction of cardiac ion channels that results in 4,000 deaths annually in the United States
QUESTION: In a patient with different QT intervals, which one will give the highest prognostic accuracy? REPLY:
QUESTION: In a patient with different QT intervals, which one will give the highest prognostic accuracy? REPLY: First, there are two possibilities: I) It is not known, if the patient (subject) presented
Basics of Structure/Function of Sodium and Potassium Channels Barry London, MD PhD
Basics of Structure/Function of Sodium and Potassium Channels Barry London, MD PhD University of Pittsburgh Medical Center Pittsburgh, PA International Symposium of Inherited Arrhythmia Disorders and Hypertrophic
NATIONAL INSTITUTE FOR HEALTH AND CLINICAL EXCELLENCE
NATIONAL INSTITUTE FOR HEALTH AND CLINICAL EXCELLENCE Implantable cardioverter defibrillators for the treatment of arrhythmias and cardiac resynchronisation therapy for the treatment of heart failure (review
Risk for Life-Threatening Cardiac Events in Patients With Genotype-Confirmed Long-QT Syndrome and Normal-Range Corrected QT Intervals
Journal of the American College of Cardiology Vol. 57, No. 1, 2011 2011 by the American College of Cardiology Foundation ISSN 0735-1097/$36.00 Published by Elsevier Inc. doi:10.1016/j.jacc.2010.07.038
Management of Arrhythmia Syndromes in the Newborn and Very Young Child: Unique Risks & Barriers in this Age Population
Management of Arrhythmia Syndromes in the Newborn and Very Young Child: Unique Risks & Barriers in this Age Population Mitchell Cohen, MD FACC FHRS Co-Director Heart Center Chief of Pediatric Cardiology
Idiopathic Ventricular Tachycardia Need for an Update in EHRA/HRS Consensus?
Idiopathic Ventricular Tachycardia Need for an Update in EHRA/HRS Consensus? Arash Arya, M.D. Department of Interventional Electrophysiology Heart Center University of Leipzig Disclosures: NONE Idiopathic
Case Demonstrations in Congenital and Acquired Long QT Syndrome
Case Demonstrations in Congenital and Acquired Long QT Syndrome Can You Make A Correct ECG Interpretation? Li Zhang, MD; 1-2 G. Michael Vincent, MD 1 1. LQTS Studies, Department t of Medicine i LDS Hospital,
Ventricular fibrillation is the main mechanism involved in
Short QT Syndrome A Familial Cause of Sudden Death Fiorenzo Gaita, MD; Carla Giustetto, MD; Francesca Bianchi, MD; Christian Wolpert, MD; Rainer Schimpf, MD; Riccardo Riccardi, MD; Stefano Grossi, MD;
Clinical phenotypes associated with Desmosome gene mutations
Clinical phenotypes associated with Desmosome gene mutations Serio A, Serafini E, Pilotto A, Pasotti M, Gambarin F, Grasso M, Disabella E, Diegoli M, Tagliani M, Arbustini E Centre for Inherited Cardiovascular
Antiarrhythmic Drugs. Munir Gharaibeh MD, PhD, MHPE School of Medicine, The University of Jordan November 2017
Antiarrhythmic Drugs Munir Gharaibeh MD, PhD, MHPE School of Medicine, The University of Jordan November 2017 Types of Cardiac Arrhythmias Abnormalities of Impulse Formation: Rate disturbances. Triggered
Antiarrhythmic Drugs. Munir Gharaibeh MD, PhD, MHPE School of Medicine, The University of Jordan November 2018
Antiarrhythmic Drugs Munir Gharaibeh MD, PhD, MHPE School of Medicine, The University of Jordan November 2018 2 Ion Permeability Changes Potential Changes Genes and Proteins 3 Cardiac Na+ channels 5 6
Silvia G Priori MD PhD
The approach to the cardiac arrest survivor Silvia G Priori MD PhD Molecular Cardiology, IRCCS Fondazione Salvatore Maugeri Pavia, Italy AND Leon Charney Division of Cardiology, Cardiovascular Genetics
Name of Presenter: Marwan Refaat, MD
NAAMA s 24 th International Medical Convention Medicine in the Next Decade: Challenges and Opportunities Beirut, Lebanon June 26 July 2, 2010 I have no actual or potential conflict of interest in relation
Syncope in patients with inherited arrhythmogenic syndromes. Is it enough to justify ICD implantation?
Innovations in Interventional Cardiology and Electrophysiology Thessaloniki 2014 Syncope in patients with inherited arrhythmogenic syndromes. Is it enough to justify ICD implantation? K. Letsas, MD, FESC
Family Medicine for English language students of Medical University of Lodz ECG. Jakub Dorożyński
Family Medicine for English language students of Medical University of Lodz ECG Jakub Dorożyński Parts of an ECG The standard ECG has 12 leads: six of them are considered limb leads because they are placed
Strength and weakness of genetic testing in clinical routine.
Strength and weakness of genetic testing in clinical routine. Silvia G Priori MD PhD Molecular Cardiology, IRCCS Fondazione Maugeri Pavia, Italy AND Leon Charney Division of Cardiology, Cardiovascular
FANS Paediatric Pathway for Inherited Arrhythmias*
FANS Paediatric Pathway for Inherited Arrhythmias* The pathway is based on the HRS/EHRA/APHRS Expert Consensus Statement on the Diagnosis and Management of Patients with Inherited Primary Arrhythmia Syndromes
Clinical Cardiac Electrophysiology
Clinical Cardiac Electrophysiology Certification Examination Blueprint Purpose of the exam The exam is designed to evaluate the knowledge, diagnostic reasoning, and clinical judgment skills expected of
The State of the Molecular Autopsy for Sudden Death in the Young
The State of the Molecular Autopsy for Sudden Death in the Young Michael J. Ackerman, MD, PhD Windland Smith Rice Cardiovascular Genomics Research Professor Professor of Medicine, Pediatrics, and Pharmacology
Adult Complexities of the Channelopathies
Adult Complexities of the Channelopathies Andrew Krahn MD FHRS Sauder Family and Heart and Stroke Foundation Chair in Cardiology Paul Brunes Chair in Heart Rhythm Disorders University of British Columbia
Pre-Participation Athletic Cardiac Screening
Pre-Participation Athletic Cardiac Screening Kimberly A Krabill, MD Pediatric and Fetal Cardiologist Northwest Congenital Heart Care, Division of MedNax Cardiology Update for Primary Care Symposium July
Paroxysmal Supraventricular Tachycardia PSVT.
Atrial Tachycardia; is the name for an arrhythmia caused by a disorder of the impulse generation in the atrium or the AV node. An area in the atrium sends out rapid signals, which are faster than those
Antony French Consultant Cardiologist & Electrophysiologist
Antony French Consultant Cardiologist & Electrophysiologist Palpitations Unpleasant awareness of rapid or forceful heart beat Not all tachycardias cause palpitations, and not all palpitations are due to
Heart Rhythm Disorders. How do you quantify risk?
Heart Rhythm Disorders How do you quantify risk? Heart Rhythm Disorders Scale of the Problem 1/2 population will have an episode of transient loss of consciousness (T-LOC) at some stage in their life.
What is New in CPVT? Diagnosis Genetics Arrhythmia Mechanism Treatment. Andreas Pflaumer
What is New in CPVT? Diagnosis Genetics Arrhythmia Mechanism Treatment Andreas Pflaumer Diagnosis of CPVT Induction of different types of VES or VT by exercise or catecholamines AND exclusion of of other
Dr. Schroeder has no financial relationships to disclose
Valerie A Schroeder MD MS Assistant Professor University of Kansas Medical Center READING THE WAVES- THE HEART S ELECTRICAL MESSAGE FINANCIAL DISCLOSURE Dr. Schroeder has no financial relationships to
2017 BDKA Review. Regularity Rate P waves PRI QRS Interpretation. Regularity Rate P waves PRI QRS Interpretation 1/1/2017
1. 2017 BDKA Review 2. 3. 4. Interpretation 5. QT 6. 7. 8. 9. 10. QT 11. 12. 13. 14. 15. 16. 17. 18. QT 19. 20. QT 21. 22. QT 23. 24. Where are pacer spikes? Before the P wave or before the QRS complex?
Asaad Khoury 2,3 MD, Monther Boulos 1,3 MD, Mahmoud Suleiman 1,3 MD, Miry Blich 1,3 MD, Michael Eldar 4 MD, Ibrahim Marai 1,3 MD,
Flecainide therapy suppresses exercise induced ventricular arrhythmias in patients with CASQ2 associated catecholaminergic polymorphic ventricular tachycardia Asaad Khoury 2,3 MD, Monther Boulos 1,3 MD,
When VF is the endpoint, wait and see is not always the best option.
Being free of symptoms does not necessarily mean free of arrhythmias. This Holter is from a asymptomatic 48 years old female with LQT2 When VF is the endpoint, wait and see is not always the best option.
Genetic Testing for Cardiac Ion Channelopathies
Applies to all products administered or underwritten by Blue Cross and Blue Shield of Louisiana and its subsidiary, HMO Louisiana, Inc.(collectively referred to as the Company ), unless otherwise provided
Basic Dysrhythmia Interpretation
Basic Dysrhythmia Interpretation Objectives 2 To understand the Basic ECG To understand the meaning of Dysrhythmia To describe the normal heart conduction system. To describe the normal impulse pathways.
HA Convention 2010 Dr Liz YP Yuen Department of Chemical Pathology Prince of Wales Hospital
HA Convention 2010 Dr Liz YP Yuen Department of Chemical Pathology Prince of Wales Hospital 1 2 Sudden death an unexpected natural death within a short time period, generally 1 hour or less from the onset
La valutazione dell atleta: è una strategia salva-vita e costo-efficace?
La valutazione dell atleta: è una strategia salva-vita e costo-efficace? Primo trattato di Medicina Wilson and Jungner s criteria In the 1960s the World Health Organization adopted the Wilson and Jungner
1 Cardiology Acute Care Day 22 April 2013 Arrhythmia Tutorial Course Material
1 Cardiology Acute Care Day 22 April 2013 Arrhythmia Tutorial Course Material Arrhythmia recognition This tutorial builds on the ECG lecture and provides a framework for approaching any ECG to allow the
Medical Policy An Independent Licensee of the Blue Cross and Blue Shield Association
Genetic Testing for Page 1 of 23 Medical Policy An Independent Licensee of the Blue Cross and Blue Shield Association Title: Genetic Testing for Professional Institutional Original Effective Date: August
University of Groningen
University of Groningen Low rate of cardiac events in first-degree relatives of diagnosis-negative young sudden unexplained death syndrome victims during follow-up van der Werf, Christian; Stiekema, Lotte;
La strategia diagnostica: il monitoraggio ecg prolungato. Michele Brignole
La strategia diagnostica: il monitoraggio ecg prolungato Michele Brignole ECG monitoring and syncope In-hospital monitoring Holter Monitoring External loop recorder Remote (at home) telemetry Implantable
ECG interpretation basics
ECG interpretation basics Michał Walczewski, MD Krzysztof Ozierański, MD 21.03.18 Electrical conduction system of the heart Limb leads Precordial leads 21.03.18 Precordial leads Precordial leads 21.03.18
Dr.Binoy Skaria 13/07/15
Dr.Binoy Skaria binoyskaria@hotmail.com binoy.skaria@heartofengland.nhs.uk 13/07/15 Acknowledgement Medtronic, Google images & Elsevier for slides Natalie Ryan, Events Manager, HEFT- for organising the
Preventing Sudden Death in Young Athletes. Outline. Scope of the Problem. Causes of SCD in Young Athletes. Sudden death in the young athlete
Preventing Sudden Death in Young Athletes Ronn E. Tanel, MD Director, Pediatric Arrhythmia Service UCSF Children s Hospital Associate Professor of Pediatrics UCSF School of Medicine Outline Sudden death
How to manage a patient with short QT syndrome?
How to manage a patient with short QT syndrome? Torino, 27 ottobre2012 Carla Giustetto Division of Cardiology University of Torino QT 280 ms QTc 260 ms Narrow, tall and peaked T waves High incidence of
ΜΥΟΚΑΡΔΙΟΠΑΘΕΙΕΣ. Ανεξήγητη βραδυκαρδία µε ή χωρίς διαταραχές κολποκοιλιακής αγωγής: τι µπορεί να κρύβει? ΕΦΗ Ι. ΠΡΑΠΠΑ Καρδιολόγος
ΜΥΟΚΑΡΔΙΟΠΑΘΕΙΕΣ Ανεξήγητη βραδυκαρδία µε ή χωρίς διαταραχές κολποκοιλιακής αγωγής: τι µπορεί να κρύβει? ΕΦΗ Ι. ΠΡΑΠΠΑ Καρδιολόγος Β Καρδιολογική Κλινική, ΠΓΝΑ «Ο ΕΥΑΓΓΕΛΙΣΜΟΣ» CONFLICT of INTEREST : none
V4, V5 and V6 follow the 5 th intercostal space and are NOT horizontal as indicated in the image. Page 1 of 7
V4, V5 and V6 follow the 5 th intercostal space and are NOT horizontal as indicated in the image. Page 1 of 7 "Is it correct to place the electrodes under the female breasts?" Placement of electrodes directly
Syncope: Evaluation of the Weak and Dizzy
Syncope: Evaluation of the Weak and Dizzy William M. Miles, MD, FACC, FHRS Professor of Medicine Silverstein Chair for Cardiovascular Education University of Florida College of Medicine Disclosures Medtronic,
Index. cardiacep.theclinics.com. Note: Page numbers of article titles are in boldface type.
Note: Page numbers of article titles are in boldface type. A AEDs. See Automated external defibrillators (AEDs) AF. See Atrial fibrillation (AF) Age as factor in SD in marathon runners, 45 Antiarrhythmic
A Lessening In the Cardiac Electrical Systole and a Wolff-Parkinson-White Pattern Together in the same Electrocardiographic Tracing
Cronicon OPEN ACCESS CARDIOLOGY Case Report A Lessening In the Cardiac Electrical Systole and a Wolff-Parkinson-White Pattern Together in the same Electrocardiographic Francisco R. Breijo-Marquez* Department
Long QT Syndrome in Neonates Conduction Disorders Associated With HERG Mutations and Sinus Bradycardia With KCNQ1 Mutations
Journal of the American College of Cardiology Vol. 43, No. 5, 2004 2004 by the American College of Cardiology Foundation ISSN 0735-1097/04/$30.00 Published by Elsevier Inc. doi:10.1016/j.jacc.2003.09.049
Arrhythmia Management Joshua M. Cooper, MD, FHRS, FACC
Arrhythmia Management Joshua M. Cooper, MD, FHRS, FACC Professor of Medicine Director of Cardiac Electrophysiology Temple University Health System Plumbing Electrical System Bradyarrhythmias Sinus Node
Description. Page: 1 of 31. Genetic Testing for Cardiac Ion Channelopathies. Last Review Status/Date: December 2015
Genetic Testing for Cardiac Ion Last Review Status/Date: December 2015 Genetic Testing for Cardiac Ion Description Page: 1 of 31 Genetic testing is available for patients suspected of having cardiac ion
CLINICAL CARDIAC ELECTROPHYSIOLOGY Maintenance of Certification (MOC) Examination Blueprint
CLINICAL CARDIAC ELECTROPHYSIOLOGY Maintenance of Certification (MOC) Examination Blueprint ABIM invites diplomates to help develop the Clinical Cardiac Electrophysiology MOC exam blueprint Based on feedback
Agro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17
Agro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17 INTRODUCTION - Our genes underlie every aspect of human health, both in function and
a lecture series by SWESEMJR
Electrolyte disturbances Hypokalaemia Decreased extracellular potassium increases excitability in the myocardial cells and consequently the effect of very severe hypokalaemia is ventricular arrhythmia.
EHRA Accreditation Exam - Sample MCQs Invasive cardiac electrophysiology
EHRA Accreditation Exam - Sample MCQs Invasive cardiac electrophysiology Dear EHRA Member, Dear Colleague, As you know, the EHRA Accreditation Process is becoming increasingly recognised as an important
Cardiac arrest after ibogaine intoxication
1 of 6 10/28/2018 8:18 PM J Arrhythm. 2018 Aug; 34(4): 455 457. Published online 2018 Jun 12. doi: [10.1002/joa3.12061] PMCID: PMC6111465 PMID: 30167018 Cardiac arrest after ibogaine intoxication Christian
Medical Policy An independent licensee of the Blue Cross Blue Shield Association
Genetic Testing for Page 1 of 29 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: Genetic Testing for Professional Institutional Original Effective Date: August 12,
Professor Eric Schulze-Bahr
No CoI. Professor Eric Schulze-Bahr Institute for Genetics of Heart Diseases Department of Cardiology and Angiology University Hospital Münster / Germany ICD therapy in asymptomatic or borderline LQTS
Syncope: Evaluation of the Weak and Dizzy
Syncope: Evaluation of the Weak and Dizzy William M. Miles, MD, FACC, FHRS Professor of Medicine Silverstein Chair for Cardiovascular Education University of Florida College of Medicine Disclosures Medtronic,
The Electrocardiogram
The Electrocardiogram Chapters 11 and 13 AUTUMN WEDAN AND NATASHA MCDOUGAL The Normal Electrocardiogram P-wave Generated when the atria depolarizes QRS-Complex Ventricles depolarizing before a contraction
PAEDIATRIC ECG Dimosthenis Avramidis, MD.
PAEDIATRIC ECG Dimosthenis Avramidis, MD. Consultant Mitera Children s Hospital Athens Greece S. Associate 1st Cardiology Dpt Evangelismos Hospital Athens Greece 5 y/o with sinus tach Background ECG changes
Arrhythmias (II) Ventricular Arrhythmias. Disclosures
Arrhythmias (II) Ventricular Arrhythmias Amy Leigh Miller, MD, PhD Cardiovascular Electrophysiology, Brigham & Women s Hospital Disclosures None Rhythms and Mortality Implantable loop recorder post-mi
Sudden Cardiac Death and Asians Disclosures
Sudden Cardiac Death and Asians Disclosures 7 February 2009 Asian Heart and Vascular Symposium None Zian H. Tseng, M.D., M.A.S. Assistant Professor of Medicine Cardiac Electrophysiology Section University
Risk for Life-Threatening Cardiac Events in Patients With Genotype-Confirmed LongQT Syndrome and Normal-Range Corrected QT Intervals
Risk for Life-Threatening Cardiac Events in Patients With Genotype-Confirmed LongQT Syndrome and Normal-Range Corrected QT Intervals Goldenberg, Ilan; Horr, Samuel; Moss, Arthur J.; Lopes, Coeli M.; Barsheshet,
Red flags for clinical practice - guidance on indicators that your patient may have a genetic condition
Red flags for clinical practice - guidance on indicators that your patient may have a genetic condition General red flags for clinical practice One or more of these red flags that may indicate a high genetic
Antiarrhythmic Drugs
Antiarrhythmic Drugs DR ATIF ALQUBBANY A S S I S T A N T P R O F E S S O R O F M E D I C I N E / C A R D I O L O G Y C O N S U L T A N T C A R D I O L O G Y & I N T E R V E N T I O N A L E P A C H D /