Prince of Wales Hospital, Shatin, New Territories, Hong Kong, China

Transcription

1 REPRODUCTIVE BIOLOGY FERTILITY AND STERILITY VOL. 75, NO. 5, MAY 2001 Copyright 2001 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Regulation of human oviductin mrna expression in vivo Christine Briton-Jones, B.Sc., a,b Ingrid Hung Lok, M.R.C.O.G., a,c Pong Mo Yuen, M.R.C.O.G., a,c Tony Tak Yu Chiu, M.Sc., a,c Lai Ping Cheung, M.R.C.O.G., a,c and Christopher Haines, M.D. a,b Prince of Wales Hospital, Shatin, New Territories, Hong Kong, China Received September 21, 2000; revised and accepted November 28, Presented in part at the annual meeting of the American Society for Reproductive Medicine, San Diego, California, October 21 26, Reprint requests: Christine Briton-Jones, B.Sc., Department of Obstetrics and Gynecology, Prince of Wales Hospital, Shatin, New Territories, Hong Kong, SAR China (FAX: ; a Department of Obstetrics and Gynaecology, Prince of Wales Hospital. b Department of Obstetrics and Gynaecology, Chinese University of Hong Kong. c Department of Obstetrics and Gynaecology, Hospital Authority of Hong Kong /01/$20.00 PII S (01)01696-X Objective: To examine changes in oviductin mrna expression in oviductal mucosal tissue from fertile women throughout an ovulatory cycle. Design: Semiquantitative reverse-transcriptase polymerase chain reaction (RT-PCR) analysis of oviductin mrna. Setting: University-based obstetrics and gynecology department. Subject(s): Twenty women undergoing laparoscopy for tubal sterilization or hysterectomy for uterine fibroids. Intervention(s): The mucosal layer was isolated from the oviduct tissue, and semiquantitative RT-PCR was performed. Main Outcome Measure(s): The relationship between serum estradiol, luteinizing hormone, and progesterone concentrations and the expression of oviductin mrna. Result(s): There was a significant positive correlation between serum estradiol and luteinizing hormone concentrations and oviductin mrna expression. There was a significant inverse correlation between serum progesterone concentrations and oviductin mrna expression. Conclusion(s): Little is known about the regulation of human oviductin. This study was the first to examine the relationship between oviductin mrna expression and serum estradiol and luteinizing hormone and progesterone concentrations in fertile women. Estradiol and luteinizing hormone both have a stimulatory effect on oviductin mrna in humans, however, it is difficult to determine whether the effects are independent of one another, as the luteinizing hormone surge is dependent on the estradiol increase. Progesterone shows a clear inhibitory effect on oviductin mrna. (Fertil Steril 2001;75: by American Society for Reproductive Medicine.) Key Words: Fallopian tube, oviduct, oviductin, mrna, RT-PCR While technical advances in assisted reproductive medicine have widened its application so that more infertile couples may benefit from it, overall pregnancy rates remain disappointingly low. Pregnancy rates from in vitro fertilization (IVF) have increased only slightly in the past decade, from 15% 20% in 1985 (1) to 16% 22% in 1997 (2). In vivo fertilization studies using animal models have shown that fertilization occurs faster and with fewer sperm in the oviduct than in cell culture (3). One explanation for this phenomenon is that a factor (or factors) are produced by the oviduct that either facilitates binding of sperm to the zona pellucida (ZP) or encourages sperm entry into the ooplasm (3). The oviduct environment appears to encourage the union of gametes and facilitate early embryo cleavage. A number of chemical constituents have been shown to modulate gametes and affect early embryo development (4). Of particular interest is a heavily glycosylated, high molecular weight oviduct-specific glycoprotein termed oviductin. Early studies used the term oviductin to include any protein(s) isolated from oviductal fluid, including proteins not specific to the oviduct, such as alpha feto-protein (5). More recently, however, the term oviductin has been used to describe an oviduct-specific glycoprotein, the unique sequence of which has been highly conserved throughout evolution (4). Studies of fertilization and early embryo 942

2 development in vitro have shown that oviductin binds to both bovine and hamster sperm (6, 7) but not to ovine or human sperm (8, 9). Oviductin also binds to the ZP and has been found in the perivitelline space of baboon and human oocytes (10, 11). However, oocytes collected directly from the ovary, as is the case with in vitro fertilization, do not show the presence of oviductin (9). The detection of oviductin inside blastomeres suggests that oviductin may play an important role in early embryo development (10). In the golden hamster, oviductin production is regulated by estrogen as well as progesterone (12). In primates, oviductin production is activated by estrogen and is turned off by progesterone (13, 14). The production of oviductin in humans was first identified in oviduct fluid and mucosal cells in tissue culture (15), but it was only detectable in the midcycle (15). However, the cycle staging in that study relied on the dating of the last menstrual period and histological examination of the oviduct mucosal cells, and there was no measurement of concentrations of estradiol or progesterone (15). The human oviductin gene is a single-copy gene, with four alleles of differing lengths, all of which correspond to chromosome 1p13 (16). Cloning of the cdna of human oviductin has been described by Arias et al. (17). This has allowed the study of oviductin gene expression and its regulation. Oviductin mrna expression has been studied by slot-blot analysis in the follicular phase and in early pregnancy in humans and has been found at high levels in the late follicular phase of the ovulatory cycle but not at all in early pregnancy (17). The level of oviductin mrna has also been examined by Northern blot analysis in baboons (18). While oviductin mrna was detectable in the early follicular phase, it was highest in the late follicular phase and after ovulation. With the rise in progesterone concentration, the oviductin mrna level dropped and it could not be detected in the late luteal phase (18). In summary, oviductin is secreted specifically in the oviduct, with a maximal response at the time of ovulation, with the oocyte and embryo as its target (9, 10, 18). This implies a putative role of oviductin in facilitating fertilization, embryo cleavage, and implantation. While oviductin mrna levels throughout the ovulatory cycle have been determined in baboons, changes in human oviductin mrna during the ovulatory cycle have not been examined. The relationship between ovarian hormone production and oviductin expression has also not been investigated in humans. This study examines the expression of oviductin mrna in oviductal mucosal cells from fertile women throughout the ovulatory cycle. MATERIALS AND METHODS Collection of Oviduct Tissue Oviduct tissue (n 20) was obtained from normally cycling, parous women who were undergoing a laparoscopy for tubal sterilization or a hysterectomy for uterine fibroids. The stage of the cycle was determined by the date of commencement of the last menstrual period and was confirmed by appropriate serum concentrations of luteinizing hormone (LH), progesterone (P), and estradiol (E 2 ). This study was approved by the Clinical Research Ethics Committee of the Chinese University of Hong Kong, project number FM/C/13. Excised oviduct tissue was immediately placed in 20 ml of Hepes buffered Quinn s Human Tubal Fluid (Irvine Scientific, Santa Ana, CA). This medium was used for all tissue manipulation. The oviduct was rinsed to minimize blood cell contamination. The lumen of the oviduct was exposed by incising along the antimesenteric border, and the mucosal folds were dissected off macroscopically. The samples were taken from the ampullary region of the tube, as this is the site of fertilization and early embryo cleavage. Only two of the investigators performed the tissue dissection, and the technique was closely monitored to ensure accurate replication. Semiquantitative RT-PCR Analysis We extracted mrna from the oviduct mucosal tissue using the Oligotex direct mrna kit (Qiagen, Hilden, Germany). All mrna samples were treated with 1UofDNAse (Boehringer Mannheim/Hoffman-La Roche, Basel, Switzerland). The DNAse was inactivated by incubating for 5 min at 90 C; 100 ng of mrna was used for cdna synthesis with Multiscribe reverse transcriptase (PE Biosystems, Foster City, CA). All the resultant cdna was then used for PCR with Amplitaq Gold DNA polymerase (PE Biosystems). Each PCR cycle consisted of denaturation at 94 C for 1 min, annealing at 55 C for 1 min, and extension at 72 C for 1 min. Thirty-five cycles were performed, followed by a final extension at 72 C for 4 min. Forward and reverse primers specific to human oviductin cdna were designed from the published cdna sequence (17). The sequences of the oligonucleotide primers were forward, TAGGTACCAAGGAGAGGAACAGAGAG, and reverse, TAGGTACCCCTTTCCCAACTTCCATG. -actin was coamplified with oviductin to provide a semiquantitative internal control for RNA quantity and PCR reaction efficiency. -actin is commonly used as a standard when comparing samples under different hormonal conditions, as it is constitutively expressed (19). Forward and reverse primers specific to -actin were derived from published primer sequences (19). The sequences of the -actin primers were forward, ATCGTGGGGCGCCCCAGGCAC, and reverse, CTCCTTAATGTCACGCACGATTTC (Mwgag Biotech, Ebersberg Germany). Twenty percent of each PCR reaction was separated by gel electrophoresis on a 2% agarose gel with 0.5 g/ml ethidium bromide in tris-borate ethylenediaminetetraacetic acid (TBE) buffer. The separated PCR products were visualized under ultraviolet light. A video camera sent the UV- FERTILITY & STERILITY 943

3 illuminated gel image to a computer, where the software package Gel Doc enabled an image of the gel to be recorded. The integrated optical density (IOD) was determined for each PCR product by the image analyzer, the Gel Doc System. The IOD ratio between the PCR-amplified oviductin product with its simultaneously amplified control, -actin, was obtained for each sample. The PCR product generated by the oviductin primers was digested with the restriction enzyme Sac 1 (Boehringer Mannheim/Hoffman-La Roche) to confirm that it was oviductin. This restriction enzyme cuts the PCR-derived oviductin product once, resulting in two bands, one at 235 bp and the other at 175 bp. Statistics The nonparametric Spearman rank test (r S ) was used to determine whether significant correlations were present between serum hormone concentrations and oviductin mrna expression. A correlation was considered significant when P.05. FIGURE 1 (A), RT-PCR oviductin product. The 410-bp oviductin band (a). The Sac 1 restriction digest of the oviductin RT-PCR product showing two bands, 235 bp and 174 bp; mw, 50-bp ladder molecular weight marker (b). (B), RT-PCR products for the control gene -actin (543 bp) and for oviductin (410 bp). mrna from oviductal cells obtained during the early follicular phase with low circulating concentrations of E 2, LH, and P (a). mrna from oviductal cells obtained during the late follicular phase with high circulating concentrations of E 2 and LH and low concentration of P (b). mrna from oviductal cells obtained during the luteal phase with low circulating concentrations of E 2 and LH and high concentrations of P (c). RESULTS A PCR product of the appropriate size (410 bp) for the oviductin PCR primers was obtained from all oviduct mucosal cell samples examined. The PCR product was confirmed as oviductin by enzyme digestion, which resulted in the two predicted bands: 235 bp and 174 bp (Fig. 1A). The Effect of Serum E 2 Concentration on There was no significant correlation between the relative intensity of the oviductin PCR product and the -actin control and serum E 2 concentrations, r S However, when samples that were collected at a time of P dominance (above a baseline P of 5 nmol/l) were excluded from the analysis, there was a significant positive correlation between the relative intensity of the oviductin PCR product and the serum E 2 concentration (n 13), r S 0.74, P.01 (Fig. 2A). Therefore, in samples derived from patients with a low serum concentration of P, oviductin mrna expression increased relative to the expression of the -actin control with increasing serum concentrations of E 2 (Fig. 1B). The Effect of Serum LH Concentration on There was a significant positive correlation between the relative intensity of the oviductin PCR product and the -actin control and serum LH concentrations, r S 0.66, P.01 (Fig. 2B). When samples that were collected at a time of P dominance were excluded from the analysis, the correlation remained significant (n 13), r S 0.66, P.01. Therefore, in all samples, the oviductin mrna expression increased relative to the expression of the -actin control with increasing serum LH concentrations (Fig. 1B). Briton-Jones. Regulation of human oviductin in vivo. Fertil Steril The Effect of Serum P Concentration on There was a significant negative correlation between the relative intensity of the oviductin PCR product and the -actin control and serum P concentrations r S 0.63, P.01 (Fig. 2C). Therefore, in all samples the oviductin mrna expression decreased relative to the expression of the -actin control with increasing serum P concentrations (Fig. 1B). DISCUSSION Oviductin mrna was detected in all samples examined. Three of these samples were derived from subjects with serum E 2, LH, and P that conformed to the standard range for the early luteal phase of the ovulatory cycle (20), and four samples corresponded to the late luteal phase. Nine samples corresponded to the early follicular phase, and four to the late follicular phase. There were similarities between our results and those reported in previous studies on baboons (18). The highest level in both studies was seen in the late 944 Briton-Jones et al. Regulation of human oviductin in vivo Vol. 75, No. 5, May 2001

4 FIGURE 2 (A), Scatterplot showing the correlation between serum E 2 concentration and relative oviductin mrna expression, excluding samples obtained in the luteal phase, where P 5 nmol/l. (B), Scatterplot showing the correlation between serum LH concentration and the relative oviductin mrna expression. (C), Scatterplot showing the correlation between serum P concentration and the relative oviductin mrna expression. Briton-Jones. Regulation of human oviductin in vivo. Fertil Steril FERTILITY & STERILITY 945

5 follicular phase, but in contrast to our findings, oviductin mrna was not detected in the late luteal phase in baboons. This discrepancy may be due to species difference or it may have resulted from the different methods used to analyze the mrna. The Northern blot method (18) is generally regarded as less sensitive than RT-PCR (21). Increasing serum E 2 concentrations were positively correlated with increasing oviductin mrna expression relative to the control -actin in the presence of low concentrations of P. This result suggests that the stimulatory effect of E 2 is blocked or is less potent than the inhibitory effect of P. These results are similar to those seen in studies on the oviductin protein in ovariectomized baboons treated with unopposed E 2 or with E 2 for 14 days followed by E 2 plus P (13). Serum LH concentrations were also positively correlated with oviductin mrna expression, including those samples with elevated P. At first glance, these results appear to indicate that LH may play a more important role than E 2 in regulating oviductin mrna expression. This would support the in vitro findings in bovine oviductal mucosal cells where hcg was used as a substitute for LH-stimulated oviductin mrna expression. These findings show that E 2 had no effect (22). However, our result probably reflects the narrow timing of the LH surge in the ovulatory cycle (20). In our subjects, no raised LH concentrations were found in samples with elevated P. Oviduct mrna expression showed a significant negative correlation with increasing serum P concentration. This result supports the findings of Verhage and Fazleabas (13) on the oviductin protein in ovarectomized baboons primed with E 2 followed by E 2 and P. Therefore, in humans, P has a strong inhibitory effect on oviductin mrna expression. These results are consistent with the proposed supportive role of oviductin in fertilization as well as its embryotropic function (4). The highest levels of oviductin mrna expression were seen around the time of ovulation. Lower levels of oviductin mrna were seen in the luteal phase, when the embryo is no longer in the oviduct. Our results indicate that E 2 and LH have a stimulatory effect on oviductin mrna expression. However, it was not possible to determine whether the effects of E 2 and LH occur individually or are interdependent. Evidence for a stimulatory effect of LH was demonstrated by Sun et al. (22), and none of the studies that have examined the effect of E 2 could exclude an effect of LH (13, 15, 23). We are now analyzing the regulatory effects of E 2 and LH in human oviductal mucosal cells in vitro, to enable the effects of these hormones to be studied independently. References 1. Wood C, Trounson A. Current state and future of IVF. Clin Obstet Gynaecol 1985;12(4): Cowan BD, Seifer DB, eds. Clinical reproductive medicine. Philadelphia: Lippincott-Raven, Boatman DE. Oviductal modulators of sperm fertilizing ability. In: Bavister BD, Cummins JM, Roldan E, eds., Fertilization in mammals. Norwell, MA: Serono Symposia USA, 1990: Boatman DE. Responses of gametes to the oviductal environment. Hum Reprod 1997;12: Wagh PV, Lippes J. Human oviductal fluid proteins. V. Identification of human oviductin-i as alpha-fetoprotein. Fertil Steril 1993;59: Anderson SH, Killian GJ. Effect of macromolecules from oviductal conditioned medium on bovine sperm motion and capacitation. Biol Reprod 1994;51: King RS, Killian GJ. Purification of bovine estrus-associated protein and localization of binding on sperm. Biol Reprod 1994;51: Nancarrow CD, Hill JL. Co-culture, oviduct secretion and the function of the oviduct-specific glycoproteins. Biol Int 1994;18: O Day-Bowman MB, Mavrogianis PA, Reuter LM, Verhage HG. Association of oviduct-specific glycoproteins with human and baboon (Papio anubis) ovarian oocytes and enhancement of human sperm binding to human hemizonae following in vitro incubation. Biol Reprod 1996;54: Boice ML, McCarthy TJ, Mavrogianis PA, Fazleabas AT, Verhage HG. Localisation of oviductal glycoproteins within the zona pellucida and perivitelline space of ovulated ova and early embryos in baboons (Papio anubis). Biol Reprod 1990;43: O Day-Bowman MB, Mavrogianis PA, Reuter LM, Verhage HG. Localization of human and baboon oviduct specific glycoproteins (hogp/ bogp) in the zona pellucida (ZP) and perivitelline space (PVS) of human and baboon ovarian oocytes following in vitro incubation. In: The 26th annual meeting of the Society for the Study of Reproduction. Fort Collins, CO, 1993:Abstract Malette B, Paquette Y, Merlen Y, Bleau G. Oviductins possess chitinase- and mucin-like domains: a lead in the search for the biological function of these oviduct-specific ZP-associating glycoproteins. Mol Reprod Dev 1995;41: Verhage HG, Fazleabas AT. The in-vitro synthesis of estrogen-dependent proteins by the baboon (Papio anubis) oviduct. Endocrinology 1988;123: Verhage HG, Boice ML, Mavrogianis P, Donnelly K, Fazleabas AT. Immunological characterisation and immunocytochemical localization of oviduct-specific glycoproteins in the baboon (Papio anubis). Endocrinology 1989;124: Verhage HG, Fazleabas AT, Donnelly K. The in vitro synthesis and release of proteins by the human oviduct. Endocrinology 1988;122: Lapensee L, Paquette Y, Bleau G. Allelic polymorphism and chromosomal localization of the human oviductin gene (MUC 9). Fertil Steril 1997;68: Arias EB, Verhage HG, Jaffe RC. Complementary deoxyribonucleic acid cloning and molecular characterization of an estrogen-dependent human oviductal glycoprotein. Biol Reprod 1994;51: Jaffe RC, Arias EB, O Day-Bowman MB, Donnelly KM, Mavrogianis PA, and Verhage HG. Regional distribution and hormonal control of estrogen-dependent oviduct-specific glycoprotein messenger ribonucleic acid in the baboon (Papio anubis). Biol Reprod 1996;55: Soutar RL, Dillon J, Ralston SH. Control genes for reverse-transcription-polymerase chain reaction: a comparison of beta-actin and glyceraldehyde phosphate dehydrogenase. Br J Haematol 1997;97: Wu CH. Monitoring of ovulation induction. Fertil Steril 1978;30: Sambrook J, Fritsch EF, Maniatis T. Molecular cloning. A laboratory manual. 2d ed. New York: Cold Spring Harbor Laboratory Press, Sun T, Lei ZM, Rao CV. A novel regulation of the oviductal glycoprotein gene expression by luteinizing hormone in bovine tubal epithelial cells. Molec Cell Endocrin 1997;131: Verhage HG, Fazleabas AT, Mavrogianis PA, O Day-Bowman MB, Donnelly KM, Arias EB, et al. The baboon oviduct: characteristics of an oestradiol-dependent oviduct-specific glycoprotein. Hum Reprod Up 1997;3: Briton-Jones et al. Regulation of human oviductin in vivo Vol. 75, No. 5, May 2001