Selective binding and internalisation by truncated receptors restrict the availability of BDNF during development

Transcription

1 Development 121, (1995) Printed in Great Britain The Company of Biologists Limited Selective binding and internalisation by truncated receptors restrict the availability of BDNF during development Stefano Biffo 1, *, Nina Offenhäuser 2, Bruce D. Carter 1 and Yves-Alain Barde 1 Max-Planck Institute for Psychiatry, Departments of 1 Neurobiochemistry and 2 Neurochemistry, Planegg-Martinsried, Germany *Author for correspondence at present address: Lab. Istologia Molecolare 2A1, DIBIT, San Raffaele, V. Olgettina 58, Milano, Italy SUMMARY The tyrosine kinase receptor trkb is thought to mediate the biological actions of brain-derived neurotrophic factor. This receptor is expressed by a large variety of neurons during development. Truncated trkb molecules lacking the tyrosine kinase domain have also been described, but their functions remain elusive. In order to gain insight into their role, we studied the pattern of expression and properties of these truncated receptors in the chick embryo. mrna coding for truncated trkb was detected already early during neurogenesis and in situ hybridisation experiments indicated that the expression was in non-neuronal cells, as previously observed in the brain of adult rodents. Ependymal and leptomeningeal cells expressing high levels of truncated trkb were found to completely surround the developing brain and the spinal cord throughout development. In the otic vesicle, mesenchymal cells expressing truncated trkb surround cells producing brain-derived neurotrophic factor, as well as neurons expressing trkb with its tyrosine kinase domain. Non-neuronal cells were found not to express trkb mrna coding for the tyrosine kinase domain. Studies with radioiodinated brain-derived neurotrophic factor performed on frozen sections of the chick embryo revealed that non-neuronal cells expressing truncated trkb bind brain-derived neurotrophic factor with high affinity and selectivity. In addition, experiments with dissociated leptomeningeal cells revealed that binding is rapidly followed by selective internalisation of the ligand. These results suggest that truncated trkb molecules form an efficient and selective barrier preventing the diffusion of brain-derived neurotrophic factor and eliminating it by internalisation. This barrier is in place early during neurogenesis and might be necessitated by the multiplicity of developing structures producing brain-derived neurotrophic factor, as well as by the large number of different neuronal populations responding to brain-derived neurotrophic factor. Key words: tyrosine kinase receptor, neurotrophins, alternative splicing, leptomeningi, sensory ganglia, chick INTRODUCTION Nerve growth factor (NGF), brain derived neurotrophic factor (BDNF), neurotrophin 3 (NT-3) and neurotrophin 4/5 (NT-4/5) form a family of small, secretory proteins that are structurally related. Members of the neurotrophin gene family are known to regulate several aspects of neuronal differentiation like fiber outgrowth, neurotransmitter content and neuronal survival (for a recent review, see Davies, 1994). Recent studies have demonstrated that three members of the trk family of tyrosine kinase receptors act as receptors for the neurotrophins. The functional importance of neurotrophins during neurogenesis has been demonstrated using specific neutralising antibodies, as well as targeted deletions of the neurotrophin genes (for reviews, see Davies, 1994 and Snider, 1994). Also, the functional relevance of the trk receptors has been documented by the deletion of exons coding for the tyrosine kinase domain of all 3 trk receptors (for review, see Barbacid, 1994 and Snider, 1994). The discovery that members of trk family of tyrosine kinase receptors are functional and specific receptors mediating the biological actions of the neurotrophins has permitted the characterisation of several neuronal populations responding to neurotrophins. In particular, in situ hybridisation experiments have revealed that two of them, the BDNF receptor trkb, as well as the NT-3 receptor trkc are expressed in many neuronal populations both in the central and the peripheral nervous system, and that this expression can be observed substantially before the period of neuronal death known to be regulated by the neurotrophins (see for example Klein et al., 1990b; Schecterson and Bothwell, 1992; Tessarolo et al., 1993; Dechant et al., 1993; Williams et al., 1993). By comparison, the functional NGF receptor trka has a very restricted, and comparatively late, pattern of expression in the central nervous system (Martin- Zanca et al., 1990). Quantitative, as well as qualitative data are also available regarding the expression the BDNF and NT-3 genes and both have been found to be expressed early and in a variety of structures (for review, see Davies, 1994). In the chick embryo, in particular, BDNF mrna is expressed in the developing optic tectum at embryonic day (E4), substantially before

2 2462 S. Biffo and others the innervation of this structure by the retinal ganglion cells (Herzog et al., 1994). Also in the chick, BDNF mrna has been detected by in situ hybridisation in the auditory system of the same species already at E 3.5, as well as in numerous other structures (Hallböök et al., 1993). Indeed, an early responsiveness of several avian neuronal populations to BDNF has been observed in a series of in vitro studies. For example, BDNF can stimulate differentiation of neural crest cells into sensory neurons (Kalcheim and Gendreau, 1988; Sieber-Blum, 1991) and promote the maturation of sensory neurons before they become dependent on neurotrophins for survival (Wright et al., 1992). In addition, many sensory ganglia explanted from the chick embryo respond with profuse neurite outgrowth to BDNF before the period of normally occurring neuronal death (Davies et al., 1986). The early responsiveness of chick neurons to BDNF is accompanied by the expression of tyrosine kinase trkb (Dechant et al., 1993). These data thus indicate that several BDNF-responsive neuronal populations develop in close proximity early during neurogenesis. Previous work in rodents has indicated that trkb, as well as trkc, also exist as splice variants lacking the tyrosine kinase domain, which is replaced by a short cytoplasmic sequence (Klein et al., 1990a; Middlemas et al., 1991; Tsoulfas et al., 1993; Valenzuela et al., 1993), but such variants have not been described for trka. These truncated trkb receptors have been shown to be expressed in non-neuronal cells in adult rodent brain (Klein et al., 1990a; Frisen et al., 1993; Funakoshi et al., 1993) and to be markedly up-regulated in astrocytes after combined lesions of the fimbria fornix and of the perforant path (Beck et al., 1993). So far, very little is known about the role of truncated trkb. In the present study, we show that truncated trkb is expressed very early during the development of the chick nervous system and that the non-neuronal cells expressing this truncated receptor are located in the proximity of the sites of BDNF production. As the expression of truncated trkb correlates with specific binding and internalisation of BDNF, we suggest that a function of this receptor might be to create boundaries restricting BDNF availability, allowing many BDNF responsive systems to develop independently even though they are separated by only short distances. MATERIALS AND METHODS In situ hybridisation 35- S-labelled riboprobes were obtained by in vitro transcription using T7 or T3 polymerase and their specific activity was consistently in the range of cts/minute/µg. One riboprobe was complementary to the extracellular sequence of chick trkb (nucleotides 587 to 1298, Dechant et al., 1993), thus detecting both full-length and truncated forms of chick trkb, and the other to a 600 bp sequence of the 3 untranslated region, specifically recognising transcripts containing tyrosine kinase sequences (Dechant et al., 1993). For BDNF in situ hybridisation, a riboprobe spanning the open reading frame of chick BDNF was used. Sense riboprobes were used as controls. To detect specifically truncated trkb variants, an oligonucleotide spanning the last 20 nucleotides of the open reading frame of truncated trkb was used (nucleotide ). It recognises all 3 forms of the truncated receptor (T1/TS/TL, see results) and was tailed by terminal transferase and purified as previously described (Biffo et al., 1992). The specific activity was in the range of cts/minute/µg. Excess of unlabelled oligonucleotides were used as controls. The embryos were staged (Hamburger and Hamilton, 1951) and either fixed by immersion (until E7) or tissues were dissected out and fixed overnight at 4 C in 4% paraformaldehyde in 0.1 M sodium phosphate buffer (ph 7.4). The tissues were subsequently cryoprotected in sucrose solutions, frozen in liquid nitrogen-cooled isopentane, cut and placed onto polylysine-coated slides. Labelled riboprobes were used according to Wilkinson et al. (1987) with minor modifications. Following washes and proteinase K digestion (0.3 µg/ml), sections were dehydrated and the riboprobe added to a final concentration of cpm per slide (in 100 µl). Hybridisation was performed overnight at 62 C. Stringency washes were performed as previously described (Dechant et al., 1993). The labelled oligonucleotides were hybridised at 42 C, with washes at 45 C in 1 SSC for a total of 40 minutes (Biffo et al., 1992). Following dehydration, sections were exposed to NTB2 (Kodak) emulsion at 4 C for up to 2 weeks, developed, counterstained with hematoxylin, dehydrated and mounted. RNA extraction and reverse transcription-polymerase chain reaction Total RNA was extracted from embryonic chick tissues according to a commercial variation (RNAzolB, Cinna-Biotecx Lab, Friendwood) of the guanidium thiocyanate phenol-chloroform method (Chomczynski and Sacchi 1987). Poly (A) + mrna was subsequently purified through passage on oligo(dt) columns (Sambrook et al., 1989). The amount of RNA obtained was checked by spectrophotometry. The quality of the RNA was controlled by northern blot analysis with a probe spanning the extracellular domain of chick trkb (Dechant et al., 1993). Reverse transcription (primed with oligo(dt)) was performed for 30 minutes at 42 C followed by 15 minutes at 50 C with 200 ng of poly(a) + RNA in the presence of 6 Units of AMV reverse transcriptase in a final volume of 20 µl. The efficiency of reverse transcription estimated by adding radioactive d-ctp was around 60%. The cdna was diluted to 100 µl with sterile water and aliquots of 5 µl were used for PCR. TrkB sequences were amplified using primers corresponding to the following sequences (Dechant et al., 1993; for the sequence of truncated trkb, see Vinh et al., 1994, GenEmbl Accession number X77252): and for the extracellular domain, and for the tyrosine kinase domain, and and for truncated trkb. PCR was performed for 30 cycles with annealing at 55 C, extension at 72 C and denaturation at 94 C. Each segment was run for 40 seconds, the products separated on 6% acrylamide gels and stained with ethidium bromide. Selected PCR products were sequenced. For analysis of the tyrosine kinase form of trkb in leptomeningeal cells, up to 30 ng of poly(a) + RNA were used without obtaining any amplification product. In contrast, as little as 1 ng of poly(a) + RNA isolated from the brain resulted in a specific and strong signal. Sequencing of splice variants of truncated trkb The amplification of the truncated form of trkb revealed several amplification products, which were isolated and sequenced as follows. To obtain complete 3 ends, reverse transcription was performed with 200 ng of poly(a) + RNA using an adapter oligo(dt) primer (GACTTCGAGTCGACATCGAT 17). PCR was then performed using the extracellular primer ( ) in combination with the adapter primer used for reverse transcription (without the T tail). Nested PCR (30 cycles at 53 C, 94 C, 72 C 40 seconds each except the extension time: 2 minutes) was subsequently performed by using the primer (containing in addition a HindIII restriction site) together with the primer adapter. Aliquots of the reaction were run on acrylamide gels, single bands excised, reamplified and purified for sequencing by removal of the primers with Centricon ultrafiltration. The recovered bands were sequenced with Taq-Polymerase on an automated sequencer (373A, Applied Biosystems).

3 Truncated trkb in the developing chick 2463 Iodination 10 µg of Vaccinia virus BDNF were iodinated by the lactoperoxidase method as previously described (Dechant et al., 1993). The incorporation was in the range of 91-94%, the specific activity around cts/minute/pg protein and radioiodinated BDNF was used within 4 days. Binding on sections Tissues were snap frozen in isopentane cooled in liquid nitrogen at a temperature not lower than 40 C. 10 µm sections were placed onto gelatine-coated slides and stored at 80 C up to 2 weeks (the intensity of binding decreased with longer storage time). Before binding, sections were equilibrated 10 minutes at room temperature. Subsequently, they were preincubated in binding buffer for 30 minutes at 4 C (Hepes binding buffer ph 7.4 containing 10% horse serum, 80 ng/ml NaI, 1 mg/ml cytochrome C, 1 mg/ml BSA, 4 µg/ml leupeptin, 0.5 mm PMSF). After incubations for 90 minutes at room temperature with 7-60 pm of 125 I-BDNF, sections were washed 4 times for a total of 8 minutes in cold binding buffer, twice for 15 seconds in ice cold water and fixed in 2% glutaraldehyde, 4% paraformaldehyde in PBS for 5 minutes at 4 C. Sections were briefly washed in water, air dried and exposed. Exposure to X-ray films was performed with Hyperfilm 3M 3 H films, for 3-5 days. To achieve cellular resolution sections were also exposed to NTB-2 emulsion (Kodak) for up to 8 days. Competition studies were performed by co-incubating 125 I-BDNF with increasing concentrations of either NGF, BDNF or NT-3 (15 pm, 60 pm, 240 pm, 560 pm, 2 nm, 10 nm, 30 nm). Off-rate studies were performed by washing the slides following binding for 8, 13, 18, 28 and 38 minutes in cold binding buffer. Sections were exposed for 3-5 days to Hyperfilm 3M 3 H films together with autoradiographic 125 I- microstrips (Amersham). Film development was for 4 minutes in D- 19 developer at 18 C, 30 seconds in stop solution and 8 minutes fixation in Unifix (all from Kodak). Cell preparation for cross-linking and internalisation experiments Leptomeningeal cells from embryonic day 6-12 chicks were dissected free from the brain in cold PBS and incubated for 10 minutes with 0.1 mg/ml trypsin (Worthington) in PBS at 37 C. After trypsin treatment, the reaction was stopped by adding 0.2 mg/ml of soybean trypsin inhibitor and cells were mildly dissociated with a large bore Pasteur pipette. Cell suspensions were filtered on a 70 µm nylon mesh, spun at 700 revs/minute for 3 minutes and resuspended in Krebs Ringer buffer containing 5 mg/ml BSA, 0.1 mg/ml cytochrome C. Approximately cells could be obtained from one E8 chick brain. The cells were immediately used. Internalisation Leptomeningeal cells, A293 cells and A293 cells transfected with fulllength chick trkb were harvested and resuspended in DMEM/10% FCS to a concentration of cells/ml. 125 I-BDNF was added to a final concentration of 100 pm. Incubation was carried out for 2 hours at 4 C in a water bath with gentle shaking in the absence or presence of 10 nm cold NGF or BDNF. Internalisation was initiated by transferring 200 µl samples to prewarmed Eppendorf tubes (1.5 ml) at 37 C. At various time points, samples were put on ice and 500 µl of ice-cold binding buffer were added to stop internalisation. The cells were pelleted and washed once more with 500 µl binding buffer. Surface-bound ligand was removed by washing once with 1 ml acid wash (500 mm NaCl, 200 mm acetic acid, ph 2.4) for 5 minutes (Jing et al., 1992). Cells were pelleted and rinsed with 100 µl PBS, before resuspension and counting of internalised 125 I-BDNF. Western blot analysis leptomeningeal cells were lysed in ice-cold TBS containing 1% NP-40, 10% glycerol and protease inhibitors (1 mm PMSF, 10 mg/ml aprotinin, 1 µg/ml leupeptin). Lysates were cleared by centrifugation (50,000 g, 15 minutes, 4 C) and incubated for 2 hours at 4 C with 50 µl wheat germ agglutinin suspension (WGA, Sigma). WGA precipitates were washed twice in lysis buffer, twice in cold water, mixed with Laemmli sample buffer, boiled 3 minutes and loaded on denaturing 7% acrylamide gels (Laemmli, 1970). After electrophoresis, the samples were electrotransferred onto Immobilon-P membranes (Millipore). The membranes were washed in PBS, blocked 1 hour at room temperature with PVP solution (50 mm Tris, 150 mm NaCl, 2.2% Polyvinylpyrrodilon M r 25,000) and incubated overnight at 4 C with antiserum solutions (1:1,000 in 50 mm Tris, 150 mm NaCl, 1%Tween 20, 0.2% PVP). After overnight incubation, the filters were washed, incubated with phosphatase alkaline-conjugated anti-rabbit antibodies and developed with the ECL chemoluminescence technique (Amersham, UK). The antiserum used was a rabbit antiserum raised against a synthetic peptide in the extracellular sequence of chick trkb (aminoacids ). Crosslinking 300,000 leptomeningeal cells dissociated as above were incubated in the presence of 7 pm iodinated BDNF in Krebs Ringer buffer (containing 5 mg/ml BSA and cytochrome C) with gentle shaking for 60 minutes at 4 C. EDC [1-Ethyl 3-(3 Dimethyl aminopropyl) carbodiimide Hydrochloride] was subsequently added to a final concentration of 10 mm and incubated for 15 minutes. The reaction was stopped with 10 mm Tris ph 8.0, the cells were centrifuged and lysed in Laemmli lysis buffer. Lysates were boiled, separated on 7% acrylamide gels and exposed to Kodak X-Ar5 films for 2 weeks at 70 C. Competition studies were performed by co-incubation with unlabelled neurotrophins (NGF, NT-3 and BDNF) at 100-fold higher concentrations (700 pm). RESULTS Truncated trkb is expressed in non-neuronal cells The sites of trkb expression in the chick embryo were examined using three different probes: one complementary to the extracellular sequence of chick trkb labelling both fulllength and truncated trkb (EC probe), one recognising the tyrosine kinase domain of trkb (TK + probe) and one specifically detecting truncated trkb (TK probe). The EC probe labels specific groups of neurons, as well as a variety of nonneuronal cells (see Fig. 1A-D), including in particular the leptomeningeal cells or leptomeningeal precursors surrounding the developing nervous system. The leptomeningi were found to be labelled throughout the developmental period studied from E 3.5 until E 16 and at all levels of the CNS, rostrally from the olfactory bulb to caudally in the lumbar spinal cord, both dorsally as well as ventrally. Examples of this pattern of localisation in non-neuronal cells are shown in Fig. 1A-D. The levels of trkb mrna in leptomeningi were generally high, although in the spinal cord the ventral part was somewhat less labelled. Other non-neuronal cell types also expressed trkb mrna: ependymal cells lining almost all the ventricles (Fig. 1C-D), mesenchymal-like cells in the developing dermis in the neck, a layer of cells below the developing pigmented epithelium corresponding to scleral cells (not shown) and some mesenchymal cells in the auditory system (Fig. 2). No labelling was seen with control sense probes (not shown). Non-neuronal cells labelled with the EC probe were also

4 2464 S. Biffo and others positive with the TK oligoprobe. Two specific examples are shown for the ependymal (Fig. 1E) and leptomeningeal cells of the spinal cord (Fig. 1F). Conversely, at the early developmental points studied and within the detection limit of the oligoprobe, the TK probe did not label any neurons (Fig. 1E,F and not shown). Neurons negative for the TK probe were however positive for a TK + probe (see for instance sensory neurons in the inset of 1F, 2D).

5 Truncated trkb in the developing chick 2465 Fig. 1. Truncated trkb mrna is expressed in leptomeningi surrounding the brain. In situ hybridisation with a probe specific for the extracellular sequence of trkb (A-D) and with a probe specific for the cytoplasmic, truncated sequence of trkb (E,F). (A,B) Brightand dark-field images through the telencephalon at E4. High levels of trkb mrna are dected in the meningeal precursors and mesenchymal cells surrounding the developing neuroepithelium (n). The neuroepithelium itself is devoid of labelling; v, first ventricle. The dark-field photo in B has been printed to high contrast to show the striking absence of trkb expression from the neuroepithelium as compared to the high levels of trkb m-rna present in non-neuronal structures. (C,D) Bright- and dark-field images through the ventrolateral optic tectum at E6.5. TrkB mrna is present in the leptomeningi (m) surrounding the optic lobe (o) and in the ependymal layer (e); sk, skin. Note that the ependymal cells are not uniformly labelled. In the optic tectum, clusters of positive neurons are also trkb positive (arrows). (E,F) A specific probe for the cytoplasmic sequence of truncated trkb labels ependymal cells (E, left side: bright field, right side: dark field). Note that this is the same anatomical region shown in C,D). In F, truncated trkb mrna is detected in the leptomeningi (arrow) surrounding the developing spinal cord (s), but does not label sensory neurons in the dorsal root ganglia (inside the dashed area). However, sensory neurons are labelled with trkb TK + probe (F, upper inset). The weaker signal in E, F (as compared to A-D) is likely due to the lower specific activity of the oligoprobe as compared to the riboprobes used for A-D. Scale bar is 180 µm for A-E, and 210 µm for F. By in situ hybridisation, leptomeningeal and other nonneuronal cells were never found to show any specific signals with the TK + probe (Fig. 2). In order to rule out the presence of low levels of tyrosine kinase trkb receptors in leptomeningeal cells, poly(a) + RNA was prepared from freshly dissected meningi and RT-PCR was performed using this template (see Methods). Bands of the expected size could only be observed using primers located in the extracellular or juxtamembrane region of trkb, but never with primers corresponding to sequences of the tyrosine kinase domain. In contrast, a tyrosine kinase-specific band was always seen using poly(a) + RNA prepared from the brain. Taken together, these data indicate that non-neuronal cells that are in close proximity with developing nervous structures express truncated trkb mrna, but no full-length trkb mrna. Conversely, early neurons express tyrosine kinase trkb mrna but not truncated trkb mrna. Truncated trkb is expressed close to the site of BDNF synthesis We then examined the spatial relationships between mesenchymal cells expressing truncated trkb, BDNF-expressing cells and BDNF-responsive neurons. The developing acoustic system offers a particularly convenient system to study this question, as the acoustic and vestibular neurons are located close to their target, and are known to be dependent on BDNF for their survival (Davies et al., 1986; Ernfors et al., 1994; Jones et al., 1994). Serial sections of the developing acoustic system were made between E5 and E9 and hybridised with the EC trkb probe, the TK + probe and a BDNF probe. As illustrated in Fig. 2, the TK + probe labelled exclusively the acoustic ganglion neurons and not the adjacent non-neuronal cells (Fig. 2D). BDNF mrna was specifically detected in the sensory epithelium of the developing primordium acoustis, the target of acoustic neurons (Fig. 2C). Strikingly, the EC trkb probe labelled cells completely surrounding this developing structure (Fig. 2). Spatial reconstruction of truncated trkb mrna expression in non-neuronal cells indicated that they form a tubular, 3-dimensional structure delimiting both the sites of BDNF and trkb TK + expression. Thus, in vivo, truncated trkb receptors are expressed by non-neuronal cells close to the site of BDNF synthesis and of BDNF-responsive neurons. Fig. 2. The developing acoustic system (E7): cells expressing truncated trkb mrna surround the sensory epithelium expressing BDNF. (A, bright field, B, dark field). A probe recognising the extracellular domain of trkb labels neurons in the cochlear ganglion (a), as well mesenchymal cells located all around the developing area (large arrow) and several cells at the border of the developing primordium acoustis (pa, small arrow). (C) The localisation of BDNF mrna in the primordium acoustis. It is confined to the sensory epithelium, immediately adjacent with sites of truncated trkb expression. (D) A probe specifically recognising the tyrosine kinase domain of trkb (TK + ) exclusively labels neurons located in the acoustic ganglion. Scale bar is 70 µm.

6 2466 S. Biffo and others Fig. 3. Cytoplasmic sequences of truncated trkb. The first aminoacid immediately follows the transmembrane domain and the boxed area delineates the sequence identities. The aminoacid sequence of the mammalian truncated trkb T1 is shown for comparison. The TS and TL forms contain a splice insert of 47 and 24 aminoacid respectively. The TL form sequence is deposited in the GenEMBL database (Vinh et al., 1994; GenEmbl Accession number X77252). Several spliced forms of truncated trkb receptors are expressed early in development We were interested to learn when truncated trkb receptors are first expressed during development. Total RNA was extracted and RT-PCR was performed using primers specific for the TK receptors (see Methods). Specific amplification products were observed with embryos at stage 18 (approx. E 2.5) and sequenced. Three different carboxy terminal tails were obtained (Fig. 3). All three diverge from the TK + sequence at the same site and the last 11 carboxy-terminal amino acids were found to be identical in all 3 forms. The longest variant (TL) contains 59 amino acid, the second (TS) contains the last 35 amino acids of the TL form and the third (T1) only the last 11 C-terminal amino acids common to all 3 forms. These 11 amino acids are 100% identical to the T1-specific form of rodents and human (Fig. 3). During development, the most abundant form appears to be TS (data not shown). Thus, truncated trkb is expressed at early stages of chick development and its molecular structure reveals a strong homology to the mammalian T1 form. Non-neuronal cells bind BDNF throughout development We next wanted to determine if the sites of expression of truncated trkb mrna can be correlated with the presence of specific BDNF-binding sites. Frozen sections were prepared between E5 and E9 and incubated with 15 pm of iodinated BDNF, known to preferentially occupy BDNF high affinity binding sites (see Rodríguez-Tébar and Barde, 1988; Rodríguez-Tébar et al., 1990). The autoradiographic results indicate that only the structures expressing trkb mrna bind BDNF in the high-affinity range (Fig. 4). BDNF binding to non-neuronal cells could also be detected with concentrations as low as 5 pm. As previously observed with high-affinity binding sites on neurons, BDNF binding was highly specific and while it could be efficiently displaced by 100-fold excess of unlabelled BDNF, such was not the case with NT-3 or NGF (Fig. 4). Some reduction of BDNF binding was observed with a 1,000-fold excess of NT-3, but not with NGF. Off-rate experiments indicated that most of the binding was maintained for Fig. 4. Binding of 125 I- BDNF to leptomeningeal cells and neurons. (A-D) Sections through the lumbar region of the E6 spinal cord (s) incubated with 15 pm BDNF (A), in the presence of 100-fold excess unlabelled NT-3 (B), NGF (C) or BDNF (D). Binding can be observed on leptomeningeal cells (A-C, arrow). Note that 125 I- BDNF binding in presence of NT-3 or NGF decreases the background. 125 I- BDNF binding can also be observed on to the developing ventral horn (dashed lines in A) and dorsal root ganglia (d, in B). ( E,F) Transverse section through the head of an E7.5 chick at the level of the posterior optic tectum incubated with 15 pm BDNF in the presence (F) or absence of 100-fold excess unlabelled BDNF (E). Detectable binding is seen over the meningi (arrow, m), as well as over several other structures of the developing brain; r, rhombencephalon; ol, optic lobe. Scale bar is 250 µm.

7 Truncated trkb in the developing chick 2467 Fig. 5. Binding of 125 I- BDNF to the E8 spinal cord and to the developing acoustic system. (A) 125 I- BDNF binding (used at 60 pm) is detected over leptomeningeal cells around the spinal cord and at lower levels, over the spinal cord itself (s). At this concentration, 125 I-BDNF binding is also observed over the presumptive myotomes (A, arrows). (B,C) Bright-field (B) and dark-field (C) pictures of the developing acoustic region. 125 I-BDNF binding (at 5 pm) is seen over and around the cochlear ganglion (a) and the sensory epithelium (pa). Abbreviations as in Fig. 2. The scale bar is 180 µm in A and 90 µm in B,C. The sections were exposed to a film emulsion. 30 minutes following removal of unbound BDNF (not shown). Leptomeningeal cells were found to bind BDNF throughout the embryo, both in the brain and in the spinal cord (Figs 4, 5), and throughout the developmental period studied. Binding was also observed in the developing acoustic region (E5-E8), and closely matched the localisation of trkb mrna (Fig. 5). As expected, in addition to non-neuronal cells, neurons were also found to bind BDNF; for example, in the dorsal root ganglia, in the acoustic-vestibular ganglia and, although weakly, in the ventral spinal cord (Figs 4, 5, and not shown). Intense and specific binding could also be observed in the developing brain, but the limited resolution of the technique did not allow the identification of specific neuronal nuclei. Some detectable binding was also seen along nerve tracts, in the eye and in mesenchyma (not shown). At BDNF concentrations higher than 60 pm, some structures not expressing trkb mrna were also found to bind BDNF, for example the myotomes (Fig. 5). However, this binding was not efficiently displaced by 100-fold of BDNF, but was equally well displaced by 1000-fold excess of either NGF, BDNF or NT-3 (not shown). These characteristics suggest that the molecular entity responsible for the binding of BDNF in the myotomes is the low-affinity neurotrophin receptor p75, that is expressed in this structure at high levels (Hallböök et al., 1990). Truncated trkb in leptomeningeal cells binds BDNF To demonstrate directly the involvement of truncated trkb in the binding of BDNF to leptomeningeal cells, cross-linking studies were then performed with 125 I-BDNF on freshly dissociated cells. 125 I-BDNF was used at 7 pm, cross-linked with EDC and the cell lysate separated on polyacrylamide gels. A M r band was observed (Fig. 6, left). This band completely disappeared when cross-linking was performed in the presence of 100-fold unlabelled BDNF, but only partially with 100-fold NT-3 and not with NGF (Fig. 6, left). A relative molecular mass of is compatible with the expected size of truncated trkb cross-linked with BDNF (BDNF M r around ). Indeed, a Western blot analysis using an antiserum directed against the extracellular sequence of chick trkb revealed a specific band with a M r of that was obtained after precipitation of leptomeningeal cell extracts with wheat germ agglutinin. The staining was abolished by preincubating the antibodies with trkb peptide used to raise the antiserum (Fig. 6, right). In the brain, but not in the leptomeningi, a M r band, presumably corresponding to full-length trkb receptors, was also observed (not shown). Thus, the cross-linking data combined with western blot Fig. 6. Truncated trkb in leptomenigeal cells: cross-linking with 125 I- BDNF binding and Western blot analysis. Left panel: following 125 I- BDNF binding (at 7 pm) and cross-linking with EDC, a diffuse radioactive band can be observed at about M r. The apparent diffusion of the crosslinked products is probably due to the simultaneous presence in leptomeningeal cells of all the three forms of truncated trkb (T1, TS and TL) and to glycosylation. This band is not observed when incubation is performed in the presence 100-fold excess of unlabelled BDNF, is of somewhat reduced intensity with 100-fold excess NT-3, but not with NGF. Right panel: Western blot analysis of truncated trkb in leptomeningeal cells. Cells extracts were precipitated with WGA, run on acrylamide gels and transferred onto Immobilon-P membranes. The blots were reacted with an antibody directed against an extracellular sequence of chick trkb. In addition to a non-specific band with a molecular weight of about M r, a specific M r band can be detected.

8 2468 S. Biffo and others A B Fig. 7. Internalisation of 125 I-BDNF by leptomeningeal cells. Duplicate determinations were made for each time point and the variation of the mean was less than 10%. (A) Time course shows that iodinated BDNF (100 pm) is efficiently internalised by dissociated leptomeningeal cells (black circles). The kinetics of the internalisation are similar to the one observed by a cell line expressing fulllength trkb (A293chtrkB.Fl, open squares). No 125 I-BDNF is internalised by the parental A293 cell line (open triangles). (B) Specificity of the internalisation was assessed by competing with cold neurotrophins. Competition of binding by an 100-fold excess of cold BDNF prevents internalisation, whereas competition with an 100-fold excess of cold NGF does not. Similar results were obtained in three independent experiments. analysis indicate that truncated trkb is involved in the high affinity, specific binding of BDNF observed in sections over non-neuronal cells expressing truncated trkb mrna. Internalisation of BDNF by leptomeningeal cells To follow the fate of BDNF bound to leptomeningeal cells, experiments were performed with freshly dissociated cells. Incubation of 125 I-BDNF (100 pm) at 37 C was found to be rapidly followed by its internalisation by the leptomeningeal cells (Fig. 7A). Interestingly, the kinetics of this process were similar to those observed with a cell line expressing full-length trkb (Fig. 7A). In both cases, saturation of internalisation was reached within few minutes. No internalisation of BDNF was observed with a parental cell line not expressing trkb (Fig. 7A). The specificity of the internalisation was assessed by incubating the cells in the presence of 100-fold unlabelled NGF or BDNF (Fig. 7B). Quantification of the internalisation process indicated that as much as 30% of total bound BDNF was internalised by leptomeningeal cells within minutes. Unspecifically bound BDNF did not contribute to the internalisation process observed at 37 C (not shown). DISCUSSION Previous studies have established the presence of high affinity receptors for BDNF on neurons (Rodríguez-Tébar and Barde, 1988; Rodríguez-Tébar et al., 1990). In general, a good correlation exists between the presence of such sites and the biological action of BDNF on these neurons, typically documented by a survival response. Recently, evidence has accumulated for the involvement of trkb as a crucial functional component of the BDNF receptors on neurons: not only does trkb bind BDNF and is expressed in BDNF-responsive neurons but, also, the phenotype of mice with targeted deletions of the trkb or of the BDNF loci show strikingly similar deficits (for review, see Snider, 1994). The trkb locus is known in mammals to code also for truncated receptors lacking the tyrosine kinase domain and, in rodents, two forms of truncated trkb receptors have been identified and designated T1 and T2 (Middlemas et al., 1991). In this study, we show that truncated forms of trkb are expressed very early during chick development, that they are confined to non-neuronal cells and that they are involved in the formation of specific binding sites for BDNF that share many characteristics with those found on neurons. The distribution of these sites, together with their ability to rapidly and selectively internalise BDNF, suggest that they form a selective barrier and removal system allowing several BDNF-responsive systems to develop independently in close proximity. Truncated trkb participates in the formation of nonneuronal, selective BDNF-binding sites Expression of trkb was analysed during development by in situ hybridisation using probes specific either for TK trkb or for TK + trkb. A comparison with the staining pattern obtained with a probe recognising both forms leads to the conclusion that truncated trkb is expressed predominantly in non-neuronal cells, thus having an expression pattern complementary to that revealed by the TK + probe expressed exclusively in neurons. This conclusion is reinforced by PCR results obtained using selected tissues and primers specific for each form. It thus appears that the pattern of truncated trkb previously observed in adult rodent brain and spinal cord (Klein et al., 1990b; Frísen et al., 1993) is already observed very early in development: the 2 forms of trkb are predominantly expressed in different cell types. However, our analysis of truncated trkb expression in vivo was limited to early developmental stages and we cannot rule out the presence of truncated trkb in chick neurons at later stages or in some neuronal populations not analyzed in this study. The present study also indicates that BDNF binds in the pm range to sites of truncated trkb expression on non-neuronal cells. As previously documented with neurons (Rodríguez- Tébar et al., 1990 and Dechant et al., 1993), the binding of BDNF to these sites is specific for BDNF when challenged with NGF or NT-3 and the dissociation rate of BDNF appears to be slow. Binding studies performed with dissociated leptomeningeal cells revealed a dissociation constant for BDNF of M and truncated trkb is clearly involved in the formation of these binding sites as indicated by the crosslinking data using 125 I-BDNF at 7 pm and western blot analysis using trkb-specific antibodies. It thus seems that truncated trkb expressed in leptomeningeal cells can participate in the formation of BDNF-binding sites resembling more those previously described on neurons (Rodríguez-Tébar et al., 1990) than those formed by TK + trkb in cell lines (Soppet et al., 1991; Dechant et al., 1993).

9 Truncated trkb in the developing chick 2469 Fig. 8. Truncated trkb creates borders separating BDNF-responsive systems. BDNF is produced in the brain and in the mesenchyme (black dots). Both areas are separated by less than 100 µm early in development. Full-length trkb-expressing neurons are found both within the optic tectum and the trigeminal ganglion, and these two populations of BDNF-responsive neurons need to interact with BDNF produced by the respective targets. Truncated trkb receptors expressed in the meningi prevent the diffusion of BDNF produced in the optic tectum to the overlying mesenchyme. Possible function of truncated trkb early in development An unexpected result of this study is the early onset of expression of truncated trkb and of BDNF binding to nonneuronal cells in the CNS. Indeed, a previous study investigating the developmental appearance of BDNF-binding sites (both in mouse and chick) suggested that the expression of truncated trkb is a late developmental event that follows the expression of full-length trkb (Escandon et al., 1994). We feel that this discrepancy is only apparent and can simply be explained by the different techniques used (cross-linking as opposed to in situ hybridisation). The early developmental expression of truncated trkb in subsets of non-neuronal cells, together with the demonstration that such cells rapidly and selectively internalise BDNF points to a role for the truncated receptors as a means to restrict the diffusion of BDNF. This role might be important already at early developmental stages as it is now apparent that a number of different groups of neurons respond to BDNF. For example at E5 in the chick, the optic tectum and the skin are separated by a distance of only µm (see Fig. 8) and the BDNF gene has been shown to be expressed at that time in the skin and in the underlying mesenchyme (Hallböök et al., 1993), as well as in the optic tectum (Herzog et al., 1994). While the first BDNF-responsive retinal ganglion cell axons arrive at E6 in the tectum, trigeminal neurons have been shown to respond to BDNF as early as E4 (Davies et al., 1986). BDNF-responsive axons from the trigeminal ganglia innervate the skin right above the tectum. In addition, tecto-bulbar neurons within the optic tectum also express tyrosine kinase trkb receptors (Biffo et al., 1994). Thus, leptomeningeal cells expressing truncated trkb form an efficient and selective barrier preventing the diffusion of BDNF between these 2 distinct developing networks that might both need confined sources of BDNF. A similar idea has been suggested for the role of truncated trkb in the developing visual system of the ferret (see Discussion in Allendoerfer et al., 1994) and our demonstration that leptomeningeal cells expressing truncated trkb rapidly remove BDNF by internalisation provides further support for this view. Likewise in the developing acoustic system, the vestibular neurons depend on BDNF for survival (Ernfors et al., 1994; Jones et al., 1994) and it has been observed that, in the absence of BDNF, no axons from the vestibular ganglion innervate the vestibular sensory epithelia. Relatively high levels of BDNF mrna are expressed by the sensory epithelia contacted by the vestibulo-acoustic ganglion in the chick (see Fig. 2). Nonneuronal cells surrounding the developing acoustic system express high level of truncated trkb receptor, thus restricting the availability of BDNF exclusively to the area to be innervated by the neurons of the vestibulo-acoustic ganglion. In the context of truncated trkb representing a selective, high affinity sink for BDNF necessitated by the multiplicity of BDNF-responsive systems, it is interesting to note the differences in the expression patterns of the related molecules trka and NGF. Indeed, far fewer neurons express trka in the CNS compared with trkb and no truncated forms of trka have been described. Significantly, when BDNF is administered directly into the brain of adult rats, its diffusion is much less extensive than that of NGF (Yan et al., 1994). Regulation of neurotrophin availability by differential expression of truncated receptors may not be limited to BDNF: truncated forms of the NT-3 receptor trkc are present both in mammals (Valenzuela et al., 1993) and in chick (Garner and Large, 1994) and, like with BDNF, NT-3 and tyrosine kinase containing trkc are also expressed at early developmental stages and in multiple locations (see for example Hallböök et al., 1993; Williams et al., 1993). Also, multiple groups of neurons are known to be responsive to NT-3 at very early stages of development (for review, see Davies, 1994). So far however, no data are available on the distribution of truncated trkc during development. More generally, the necessity to selectively confine diffusible factors might have evolved as a result of the use by vertebrates of such factors to control important developmental processes. In the early Xenopus embryo, for example, growth factors like the mesodermal inducer activin can diffuse as far as 300 µm within a few hours (Gurdon et al., 1994). Selective barriers and removal mechanisms might become a necessity when many different systems responding to the same diffusible factor develop in close proximity. We gratefully acknowledge the assistance of Mrs Claudia Cap, as well as the comments and help of several colleagues in the laboratory. Dr Alfredo Rodríguez-Tébar from the Cajal Institute is also thanked for his valuable suggestions. REFERENCES Allendoerfer, K. L., Cabelli, R. J., Escandon, E., Kaplan, D. R., Nikolics, K. and Shatz, C. (1994) Regulation of neurotrophin receptors during the maturation of the mammalian visual system. J. Neurosci. 14, Barbacid, M. (1994) The trk family of neurotrophin receptor. J. Neurobiol. 25, Beck, K. D., Lamballe, F., Klein, R., Barbacid, M., Schauwecker, P. E., McNeill, T. H., Hefti, F. and Day, J. R. (1993). Induction of noncatalytic TrkB neurotrophin receptors during axonal sprouting in the adult hippocampus. J. Neurosci. 13, Biffo, S., Marti, E. and Fasolo, A. (1992) NGF receptor, carnosine and TH m- RNA ontogeny in the olfactory bulb: evidence for different developmental patterns and cellular localisation. J. Chem. Neuroan.5, Biffo, S., Dechant, G. and Barde, Y-A (1994) Molecular control of neuronal survival in the chick embryo. In Toward a Molecular Basis of Alcohol Use

10 2470 S. Biffo and others and Abuse (ed. B. Jansson, H. Jörnvall, U. Rydberg, L. Terenius and B. Vallee) pp Basel, Switzerland: Birkauser Verlag. Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, Davies, A. M., Thoenen, H. and Barde, Y-A. (1986). The response of chick sensory neurons to brain-derived neurotrophic factor. J. Neurosci. 6, Davies, A. M. (1994) The role of neurotrophins in the developing nervous system. J. Neurobiol. 25, Dechant, G., Biffo, S., Okazawa, H., Kolbeck, R., Pottgiesser, J. and Barde, Y. A. (1993). Expression and binding characteristics of the BDNF receptor chick trkb. Development 119, Ernfors, P., Lee, K. and Jaenisch, R. (1994). Mice lacking brain-derived neurotrophic factor develop with sensory deficits. Nature 368, Escandon, E., Soppet, D., Rosenthal, A., Mendoza-Ramirez, J. L., Szonyi, E., Henderson, C. E., Parada, L. F. and Nikolics, K. (1994). Regulation of neurotrophin receptor expression during embryonic and postnatal development. J. Neurosci. 14, Frisen, J., Verge, V. M., Fried, K., Risling, M., Persson, H., Trotter, J. and Lindholm, D. (1993). Characterization of glial trkb receptors: differential response to injury in the central and peripheral nervous systems. Proc. Natl. Acad. Sci. USA 90, Funakoshi, H., Frisen, J., Barbany, G., Timmusk, T., Zachrisson, O. and Verge, V. M. (1993). Differential expression of mrnas for neurotrophins and their receptors after axotomy of the sciatic nerve. J. Cell Biol. 123, Garner, A. and Large, T. (1994). Isoforms of the avian trkc receptor: a novel kinase insertion dissociates transformation and process outgrowth from survival. Neuron 13, Gurdon, J. B., Harger, P., Mitchell, A. and Lemaire, P. (1994) Activin signalling and response to a morphogen gradient. Nature 371, Hallböök, F., Ayer-Lelievre, C., Ebendal, T. and Persson, H. (1990). Expression of nerve growth factor receptor mrna during early development of the chicken embryo: emphasis on cranial ganglia. Development 108, Hallböök, F., Ibáñez, C. F., Ebendal, T. and Persson, H. (1993). Cellular localization of brain-derived neurotrophic factor and neurotrophin-3 mrna expression in the early chicken embryo. Eurr. J. Neurosci. 5, Hamburger, V. and Hamilton, L. (1951). A series of normal stages in the development of the chick embryo. J. Morph. 88, Herzog, K., Bailey, K. and Barde, Y. (1994). Expression of the BDNF gene in the developing visual system of the chick. Development 120, Jing, S., Tapley, P. and Barbacid, M. (1992). Nerve growth factor mediates signal transduction through trk homodimer receptors. Neuron 9, Jones, K. R., Farinas, I., Backus, C. and Reichardt, L. F. (1994). Targeted disruption of the BDNF gene perturbs brain and sensory neuron development but not motor neuron development. Cell 76, Kalcheim, C. and Gendreau, M. (1988). Brain-derived neurotrophic factor stimulates survival and neuronal differentiation in cultured avian neural crest. Devl. Brain Res. 41, Klein, R., Conway, D., Parada, L.F. and Barbacid, M. (1990a). The trkb tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell 61, Klein, R., Martin-Zanca, D., Barbacid, M. and Parada, L. F. (1990b). Expression of the tyrosine kinase receptor gene trkb is confined to the murine embryonic and adult nervous system. Development 109, Laemmli, U. (1970). Cleavage of structural protein during the assembly of bacteriophage T4. Nature 227, Martin-Zanca, D., Barbacid, M. and Parada, L. F. (1990) Expression of the trk proto-oncogene is restricted to the sensory cranial and spinal ganglia of neural crest origin in the mouse development. Genes Dev. 4, Middlemas, D. S., Lindberg, R. A. and Hunter, T. (1991). trkb, a neural receptor protein-tyrosine kinase: evidence for a full-length and two truncated receptors. Mol. Cell. Biol. 11, Rodríguez-Tébar, A. and Barde, Y-A. (1988) Binding characteristics of brain-derived neurotrophic factor to its receptors on neurons from the chick embryo. J. Neurosci. 8, Rodríguez-Tébar, A., Dechant, G. and Barde, Y.A. (1990). Binding of brainderived neurotrophic factor to the nerve growth factor receptor. Neuron 4, Sambrook, J., Frisch, E. F. and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press. Schecterson, L. C. and Bothwell, M. (1992). Novel roles for neurotrophins are suggested by BDNF and NT-3 mrna expression in developing neurons. Neuron 9, Sieber-Blum, M. (1991). Role of the neurotrophic factors BDNF and NGF in the commitment of pluripotent neural crest cells. Neuron 6, Snider, W. D. (1994). Functions of the neurotrophins during nervous system development: what the knockouts are teaching us. [Review]. Cell 77, Soppet, D., Escandon, E., Maragos, J., Middlemas, D. S., Reid, S.W., Blair, J., Burton, L., Stanton, B. R., Kaplan, D. R., Hunter, T., Nicolics, K. and Parada, L. F. (1991) The neurotrophic factors brain-derived neurotrophic factor and neurotrophin-3 are ligands for the tyrosine kinase trkb receptor. Cell 65, Tessarollo, L., Tsoulfas, P., Martin-Zanca, D., Gilbert, D., Jenkins, N., Copeland, N. and Parada, L.F. (1993) TrkC a receptor for neurotrophin-3 is widely expressed in the developing nervous system and in non-neuronal tissues. Development 118, Tsoulfas, P., Soppet, D., Escandon, E., Tessarollo, L., Mendoza-Ramirez, J.-L., Rosenthal, A., Nikolics, K. and Parada, L. F. (1993) The rat trkc locus encodes multiple neurogenic receptors that exhibit differential response to neurotrophin-3 In PC12 cells. Neuron 10, Valenzuela, D. M., Maisonpierre, P. C., Glass, D. J., Rojas, E., Nunez, L., Kong, Y., Stitt, T.N., Ip, N. Y. and Yancopoulos, G. D. (1993). Alternative forms of rat TrkC with different functional capabilities. Neuron 10, Vinh, N. Q., Erdmann, K. S. and Heumann, R. (1994) Cloning and sequence analysis of a cdna encoding a novel truncated form of the chicken TrkB receptor. Gene 149, Williams, R., Backstrom, A., Ebendal, T. and Hallböök, F (1993) Molecular cloning and cellular localisation of trkc in the chicken embryo. Devl. Brain Res. 75, Wilkinson, D. G., Bailes, J. A., Champion, J. E. and McMahon, A. P. (1987). A molecular analysis of mouse development from 8 to 10 days post coitum detects changes only in embryonic globin expression. Development 99, Wright, E. M., Vogel, K. S. and Davies, A. (1992). Neurotrophic factors promote the maturation of developing sensory neurons before they become dependent on these factors for survival. Neuron 9, Yan, Q., Matheson, C., Sun, J., Radeke, M. J., Feinstein, S. C. and Miller, J. A. (1994). Distribution of intracerebral ventricularly administered neurotrophins in rat brain and its correlation with trk receptor expression. Exp. Neurol.127, (Accepted 24 April 1995)