( neural progeni2 tor cell), ,,,, , (neural crest) (radial glial cell) mrna [2 ]
|
|
- Derick James
- 5 years ago
- Views:
Transcription
1 246, , 51 (3), Acta Physiologica Sinica 3 P (, ;, ) (nestin),, RA P19,, (neural precursor cell) BMP4, (NF160), ( neural progeni2 tor cell),, : ; P19 ; BMP4 ; : Q71,,,, (nestin), [1 ], 7175 d, mrna, 915 d, mrna 1015 d,, (neural crest) ( somite) 1515 d, mrna (telencephalon ventricular) (subventricular zone) (radial glial cell) (cerebellar primordium), (choroid plexus) mrna [2 ],,,,, [3,4 ],,, (No , ) 3 3
2 3 : P [5, ],, [6,7 ], P19,, 10-6 mol/ L (retinoic acid, RA),,, P19 [8 ] P19 RA, P19 ; RA, 4, [9, ] P19 RA, P19 ( PFA) RA D (poly2d2lysine) N 2 Sigma PVDF EDTA SDS 160 kd (neurofilament, NF160) Amersham [7 ] Superscript TM Taq DNA DMEM/ F12 MEM ( FBS) (normal goat serum, NGS) Proteinase K Trypsin2EDTA Fibronectin (BSA) GIBCO BRL dntp Boehringer Mannheim Corning (petri dish) Fisher FITC2 IgG Dianova FITC2 IgG Tago (acrylammide) N,N 2 (N,N 2methylene2bis2acrylamide,BIS) (sodium dodecy sulfate, SDS) Bio2Rad PCR DNA 112 P19 10 % FBS DMEM/ F12, % CO 2 [9 113 P19 ] 114 PCR P19 RA 4 d N 2 [10 2, 4, 6, 8 d, ] RNA, Super2 script TM, RNA 5 g : 5 : 5 GAATCAGATCGCTCAGATCC 3 ; 3 : 5 GCACGACAC2 CAGTAGAACTG 3 PCR : 12 ng/ l, 115 mmol/ L MgCl 2, 200 mol/ L dntp, 20 mmol/ L Tris2HCl (ph 814), 50 mmol/ L KCl, pmol/ l, Taq 0105 U/ l, 0137 kbq/ l 2 32 P2dATP : s, s, 72 1 min 28 PCR, 5 %,
3 248 51, X BMP4 : 5 : 5 TGCCGCAGCTTCTCTGAGCC 3 ; 3 : 5 GACTGCCTGAT2 CTCAGCGGC 3 : 64 ; 25 ; 115 RA P19, N 2 2, 4, 6, 8 d, 4 % 1 h, PBS, CMA( = 1 2 1) min PBS, 1 % BSA 015 % (normal goat serum, NGS) PBS 30 min, 115 h, kd PBS, FITC2 IgG FITC2 IgG, 30 min, PBS, [7, (western blot) ] P19, RT - PCR mrna RA P19 RA P19, mrna( 1, Lane 1), RA 4 d, ( 1, Lane 2), 4 ( 1, Lane 3, 4), ( 1, Lane 5, 6) (actin) PCR, mrna, actin ( ) 1 P19, mrna Fig. 1 RT2PCR results of nestin ex2 pression during RA induced P19 cell neuronal differentiation RNA samples were extracted from non2induced P19 cells (Lane 1), P19 cell aggregates in2 duced by RA for 4 d (Lane 2), P19 cell neu2 ronal differentiation for 2 d (Lane 3), 4 d (Lane 4), 6 d (Lane 5) and 8 d (Lane 6), respectively. 212 ( NF160) P19 (NF160), RA P19 2A NF160 Western blot, P19 ( 2A Lane 2, ), NF160 ; 2 ( 2A Lane 3, ), NF160 ; ( 2A Lane 4 7, ), NF160, NF160, 8,,,
4 3 : P NF160 ( 2B, ), NF160,, 213 BMP4 P19 RT2PCR, BMP4 P19, RA RA 4 d P19, BMP4 ( 3, Lane 1, 2) RA, N 2 2 d, BMP4 ( 3, Lane 3),, 6 ( 3, Lane 5) BMP4, ( 3, Lane 6) BMP4, RA P19 2 6,, 6,, BMP4, 3 BMP4 RA P19 Fig. 3 RT2PCR results of BMP4 ex2 pression during RA induced P19 cell neuronal differentiation RNA samples were extracted from non2induced P19 cells (Lane 1), P19 cell aggregates in2 duced by RA for 4 d (Lane 2), P19 cell neu2 ronal differentiation for 2 d (Lane 3), 4 d (Lane 4), 6 d (Lane 5) and 8 d (Lane 6), respectively. 214, P , RA P ( 1, Lane 4, 5, 6),,, RA P19, ( 4A, ) RA,,, P19 :,,,, ( 4B, ),,,, ( 4C, ),,, ( 4D, ),,,, ( 4E, )
5 250 51,, ( 4F, ), 3 311,, [11, Notch MASH ], [12 BMP4 ] [13, NF160 ],,, P19, 1 2A 3 RT2PCR Western blots, 5 5, P19, 4, RA P , RA 8 10 NF160 P19, BMP4 6 5 BMP4 NF160 RA P19 Fig. 5 Schematic diagram of the ex2 pression pattern of nestin, BMP4, NF160 during P19 neuron differentiation, RA P19, [14 4 ( 1, 5), MASH21 ],, BMP4 ( 3, 5) BMP4, BMP4,,, (desmin) (keratin) ( GFAP) ( neurofila2 ment, NF) [13 ],,,,, BMP4 NF160, RA P19 : RA, P19, 6, BMP4,
6 3 : P NF160, 6 4, 312, RA P19, 6 8,,,, RA P19 ( 1, 5), :, ;,,,,,, ( 4, ),,,,,,,,,, (NF),,,,, ;, P19,,,, [1 ] Lendahl U, Zimmerman LB, McKay RDG. CNS stem cells express a new class of intermediate filament protein. Cell, 1990, 60 : [2 ] Dahlstrand J, Lardelli M, Lendahl U. Nestin mrna expression correlates with the central nervous system pro2 genitor cell state in many, but not all, regions of developing central nervous system. Dev Brain Res, 1995, 84 : [3 ] Zerlin M, Levison SW, Goldman J E. Early patterns of migration, morphogenesis, and intermediate filament ex2 pression of subventricular zone cells in the postnatal rat forebrain. J Neurosci, 1995, 15 : [4 ] Frisen J, Johansson CB, Torok C, et al. Rapid, widspread, and longlasting induction of nestin contributes to the generation of glial scar tissue after CNS injury. J Cell Biol, 1995, 131 : [5 ] Gallo V, Armstrong RC. Developmental and growth factor2induced regulation of nestin in oligodendrocyte lineage cells. J Neurosci, 1995, 15 : [6 ] Yang J ( ), Bian W ( ), Jing NH ( ). Nestin mrna expression during the development of mouse central nervous system. Acta Physiol Sin ( ), 1997, 49 (6) : (in Chinese with Eng2 lish abstract). [7 ] Jing NH, Kitani H, Morio I, et al. Expression of intermediate filament nestin during mouse brain development. Chin J Physiol Sci, 1996, 12 : 1 9. [8 ] Bain G, Ray WJ, Yao M, et al. From embryonal carcinoma cells to neurons : the P19 pathway. BioEssays,
7 , 16 : [9 ] Sun H, Zhang X, Kitani H, et al. Neuronal induction of embryonic carcinoma cell and nestin expression. Chin J Physiol Sci, 1996, 12 : [10 ] Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning. 2 ed. New York : Cold Spring Harbor Laboratory Press, 1989, [11 ] Lewis J. Neurogenic genes and vertebrate neurogenesis. Curr Opin Neuro, 1996, 6 : [12 ] Tanabe Y, Jesell TM. Diversity and pattern in the developing spinal cord. Science, 1996, 274 : [13 ] Steinert PM, Roop DR. Molecular and cellular biology of intermediate filaments. Ann Rev Biochem, 1988, 57 : [14 ] Jonhsen J E, Zimmerman K, Saito T, et al. Induction and repression of mammalian achaete2scute homologue (MASH) gene expression during neuronal differentiation of P19 embryonal carcinoma cells. Development, 1992, 114 : NESTIN EXPRESSION D URING P19 NEURON DIFFERNTIATION 3 Acta Physiologica Sinica Jun. 1999, 51 (3), BIAN WEI, YANG J ING, TANG KE, J ING NAI2HE 3 3 ( Shanghai Institute of Biochemistry, Chinese Academy of Science; Shanghai Research Center of Life Sciences, Shanghai ) ABSTRACT Mouse nestin, an intermediate filament gene, is transiently expressed during the de2 velopment of the central nervous system. In order to find the clue of its function during neural development, we tried to find out the gene expression pattern during the neuronal differentiation of P19 EC cells induced RA. RT2PCR showed that nestin was transiently expressed during P19 neuron differentiation, with a peak at day 4 of this process. Howev2 er, BMP4, a neural precursor cell marker, was transiently expressed with its highest level at day 6, while NF160 kd a terminal differentiated neuronal marker, was increasingly ex2 pressed during the whole process. These results implied that nestin might play some roles during the process of neural progenitor cells differentiating into neural precursor cells. Moreover, immunostaining showed that nestin was located in the neurite and the growth cone of the P19 neuron, suggesting that nestin might be also involved in the process of the establishment of neural connection. Key words : nestin ; P19 neuron ; BMP4 ; neural filament 3 Supported by the National Natural Science Foundation of China (No , ) 3 3 To whom correspondence should be addressed.
NSCs), broblast growth factor, bfgf) ( Peprotech ) ; NSCs
Chinese Journal of Pathophysiology 2003,19 (3) :289-292 289 [ ] 1000-4718 (2003) 03-0289 - 04 3 1, 1, 2, 1, 1, 1, 1, 2 ( 1, 2, 510060) [ ] :( ESCs) (NSCs) : ESCs, m ller,nscs 7 d,, RT - PCR nestin glutaminase
More informationNeurodevelopment II Structure Formation. Reading: BCP Chapter 23
Neurodevelopment II Structure Formation Reading: BCP Chapter 23 Phases of Development Ovum + Sperm = Zygote Cell division (multiplication) Neurogenesis Induction of the neural plate Neural proliferation
More informationChapter 5. Summary and Future directions
95 Chapter 5 Summary and Future directions 96 Much of our knowledge about glial development in the vertebrate CNS comes from studies of purified oligodendrocyte precursor cells (Raff 1989; Pfeiffer et
More informationSUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
More informationNeuroepithelial Cells and Neural Differentiation
Neuroepithelial Cells and Neural Differentiation Neurulation The cells of the neural tube are NEUROEPITHELIAL CELLS Neural crest cells migrate out of neural tube Neuroepithelial cells are embryonic stem
More informationDevelopment of the Nervous System 1 st month
Development of the Nervous System 1 st month day 1 - fertilization of egg day 6 - uterine implantation day 18 - trilaminar (3-layered) disc (blastoderm, embryo) ectoderm (dorsal) - nervous system and skin
More informationA new role for meninges as a niche for stem/precursor cells with neural differentiation potential during development up to adulthood
A new role for meninges as a niche for stem/precursor cells with neural differentiation potential during development up to adulthood Francesco Bifari, MD, PhD Mauro Krampera, MD, PhD Ilaria Decimo, PhD
More information,,, Acta Physiologica Sinica Tsinghua Tongfang Optical Disc Co., Ltd. All rights reserved. , , 51 (6),
, 1999 12, 51 (6), 60 608 60 Acta Physiologica Sinica SK2N2SH (, 2004) SK2N2SH, SK2N2SH : SK2N2SH Na + Cl -,, 10-9 10-6 mol/ L, Ca 2 + SK2N2SH : ; SK2N2SH ; ; ; : Q46,, [1 ],,, [2, ],, SK2N2SH, SK2N2SH,,
More informationSpinal motor neurons from neonatal rats: purification, culture and identification doi: /j.issn
19 42 2015 10 08 Chinese Journal of Tissue Engineering Research October 8, 2015 Vol.19, No.42 (/ 116024), (2013023035)(2013E15SF171) Hoechst 85.8% 71.6% 7.8% NF200 6.4% 1987 116024 :R318 :B :2095-4344
More informationEffect of Chronic Aluminum Exposure on PKC, CaMK and Neurogranin in Hippocampus of Rat
ISSN 100727626 CN 1123870ΠQ 2007 5 Chinese Journal of Biochemistry and Molecular Biology 23 (5) :410 414 PKC CaMK Ng 3,,,,,, (, 110001) (long2term potentiation, LTP) C (protein kinase c, PKC) Ca 2 + 2
More informationHuntington s Disease & MARY ET BOYLE, PH.D. DEPARTMENT OF COGNITIVE SCIENCE
Huntington s Disease & Early Nervous System Development MARY ET BOYLE, PH.D. DEPARTMENT OF COGNITIVE SCIENCE UCSD The cups fell to the floor with a crash. Was this the alarm signal? Or was it forgetting
More informationOlfactory ensheathing glia
Olfactory ensheathing glia From Wikipedia, the free encyclopedia Neuroglia of the brain shown by Golgi's method. Olfactory ensheathing glia (OEG), also known as olfactory ensheathing cells (OECs) or olfactory
More informationCellular components of CNS
Cellular components of CNS Cellular components of CNS Neurons Glial cells: Astrocytes (including radial glia), oligodendrocytes, microglia, ependymal cells Epithelial cells of choroid plexus Endothelial
More informationhttp / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA
ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2015 8 31 8 836 ~ 842 DOI 10 13865 /j cnki cjbmb 2015 08 09 FUT4-siRNA 5-aza-dC 1 3 * 1 1 3
More informationCell Type Nervous System I. Developmental Readout. Foundations. Stem cells. Organ formation. Human issues.
7.72 10.11.06 Cell Type Nervous System I Human issues Organ formation Stem cells Developmental Readout Axes Cell type Axon guidance 3D structure Analysis Model + + organisms Foundations Principles 1 What
More informationSambucus williamsii induced embryonic stem cells differentiated into neurons
DOI 10.7603/s40681-015-0003-z BioMedicine (ISSN 2211-8039) March 2015, Vol. 5, No. 1, Article 3, Pages 19-23 Original article Sambucus williamsii induced embryonic stem cells differentiated into neurons
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Human cerebral cortex development from pluripotent stem cells to functional excitatory synapses Yichen Shi 1,2, Peter Kirwan 1,2, James Smith 1,2, Hugh P.C. Robinson 3 and Frederick
More informationCell Birth and Death. Chapter Three
Cell Birth and Death Chapter Three Neurogenesis All neurons and glial cells begin in the neural tube Differentiated into neurons rather than ectoderm based on factors we have already discussed If these
More informationNeurons vs. glia. Traditionally, glia have been viewed as passive cells that help to maintain the function of neurons.
GLIA Neurons vs. glia The defining characteristic of a neuron is its ability to transmit rapid electrical signals in the form of action potentials. All other neural cells that lack this property are broadly
More informationPrimary Mouse Cerebral Cortex Neurons V: 80% TE: 70%
Primary Mouse Cerebral Cortex Neurons V: 80% TE: 70% Pictures: 9 days after electroporation Red: MAP2 Blue: GFAP Green: GFP The cells were from Embryonic Day 14 Mouse Cerebral Cortex Primary Mouse Hippocampal
More informationGenesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.
Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1. Youngsoo Lee, Sachin Katyal, Yang Li, Sherif F. El-Khamisy, Helen R. Russell, Keith W. Caldecott and Peter J. McKinnon.
More informationAchieving The Goals Of Toxicity Testing In the 21st Century: The TestSmart Developmental Neurotoxicology (DNT) Testing Program
Achieving The Goals Of Toxicity Testing In the 21st Century: The TestSmart Developmental Neurotoxicology (DNT) Testing Program Joseph Bressler and Alan Goldberg Center In Alternatives To Animal Testing
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationSox9 is critical for suppression of neurogenesis but not initiation of gliogenesis in the cerebellum. Vong et al.
Sox9 is critical for suppression of neurogenesis but not initiation of gliogenesis in the cerebellum Vong et al. Vong et al. Molecular Brain (2015) 8:25 DOI 10.1186/s13041-015-0115-0 Vong et al. Molecular
More informationActa Physiologica Sinica
, 1999 4, 51 (2), 187 192 187 Acta Physiologica Sinica 3 1998204222 1998206203 3 (No139500052) 3 3, 221002 3 3 3 3 3 (, 200031) ( Ito), 28 d (H28, 6 h/ d), Ito (16118 4161 6132 1135 pa/ pf, P < 0105),
More informationNeocortex Zbtb20 / NFIA / Sox9
Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive
More informationChemokine Regulation of Oligodendrocyte Development in the Spinal Cord. Bob Avino Saint Louis University Senior Honors Thesis April 19, 2011
Chemokine Regulation of Oligodendrocyte Development in the Spinal Cord Bob Avino Saint Louis University Senior Honors Thesis April 19, 2011 Richard J. Miller, PhD Northwestern University Feinberg School
More informationRat Dlx5 is expressed in the subventricular zone and promotes neuronal differentiation
ISSN 0100-879X Volume 43 (02) 124-225 February 2010 BIOMEDICAL SCIENCES AND CLINICAL INVESTIGATION Braz J Med Biol Res, February 2010, Volume 43(2) 176-185 Rat Dlx5 is expressed in the subventricular zone
More informationChemical Modifications of GFAP in Alexander Disease
Chemical Modifications of GFAP in Alexander Disease Natasha T. Snider Assistant Professor Department of Cell Biology and Physiology University of North Carolina at Chapel Hill Alexander Disease Family
More informationTerminology. Terminology. Terminology. Terminology. Terminology. Bromodeoxyuridine
Kateřina Náměstková, Zuzana Šimonová, Eva Syková Behavioural Brain Research Bromodeoxyuridine : Doublecortin : DCX Glial Fibrillary Acidic Protein : GFAP Trace eye blink conditioning 1 Volume 163 : pp.
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationCell Migration II: CNS Cell Migration. Steven McLoon Department of Neuroscience University of Minnesota
Cell Migration II: CNS Cell Migration Steven McLoon Department of Neuroscience University of Minnesota 1 Hey! The major concepts discussed relative to neural crest cell migration apply to cell migration
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationSupplementary Figure 1
Supplementary Figure 1 Kif1a RNAi effect on basal progenitor differentiation Related to Figure 2. Representative confocal images of the VZ and SVZ of rat cortices transfected at E16 with scrambled or Kif1a
More informationmir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons
Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal
More informationReview of Nervous System Anatomy
For the real amazement, if you wish to be amazed, is this process. You start out as a single cell derived from the coupling of a sperm and an egg; this divides in two, then four, then eight, and so on,
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.
Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific
More informationCitation for published version (APA): Martina-Mamber, C. E. (2014). GFAP as an understudy in adult neurogenesis. 's-hertogenbosch: Boxpress.
UvA-DARE (Digital Academic Repository) GFAP as an understudy in adult neurogenesis Mamber, C.E. Link to publication Citation for published version (APA): Martina-Mamber, C. E. (2014). GFAP as an understudy
More informationAstroglia induce neurogenesis from adult neural stem cells
Astroglia induce neurogenesis from adult neural stem cells Hongjun Song*, Charles F. Stevens* & Fred H. Gage * Molecular Neurobiology Laboratory, Howard Hughes Medical Institute at the Salk Institute,
More informationCNS Developmental. Anke van Eekelen, PhD. Telethon Institute for Child Health Research
CNS Developmental Anke van Eekelen, PhD Telethon Institute for Child Health Research (Some slides are modified versions of Prof. Alan Harvey s Neuroscience lecture at ANHB and Dr. Joanne Britto s Dev Neuroscience
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationComparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
More informationRESEARCH ARTICLE. Anjali Shiras*, Arti Bhosale*,2, Varsha Shepal*,2, Ravi Shukla*,2, V.S. Baburao y, K. Prabhakara z and Padma Shastry*
RESEARCH ARTICLE Neoplasia. Vol. 5, No. 6, November/December 2003, pp. 520 532 520 www.neoplasia.com A Unique Model System for Tumor Progression in GBM Comprising Two Developed Human Neuro-Epithelial Cell
More informationVisualization of embryonic neural stem cells using Hes promoters in transgenic mice
www.elsevier.com/locate/ymcne Mol. Cell. Neurosci. 31 (2006) 109 122 Visualization of embryonic neural stem cells using Hes promoters in transgenic mice Toshiyuki Ohtsuka, a,b, * Itaru Imayoshi, b Hiromi
More informationcdna CN E1 WAN G Guang2ping 1,2, TAN G Fa2qing 2, ZHOU Jin2ping 3
BULL HUNAN MED UNIV 2003,28 (4) 347 cdna CN E1 1,2, 2, 3 (1., 410008 ; 2., 410008 ; 3., 410011) [ ] : : CN E1 Balb/ C,, RNA, cdna, cdna 2 ( RT2 PCR) : 30 d,, 29. 5 %, CN E1 147, 102 45 RT2PCR 3, MA D3,
More informationReceptor-interacting Protein Kinases Mediate Necroptosis In Neural Tissue Damage After Spinal Cord Injury
Receptor-interacting Protein Kinases Mediate Necroptosis In Neural Tissue Damage After Spinal Cord Injury Haruo Kanno, M.D., Ph.D., Hiroshi Ozawa, M.D., Ph.D., Satoshi Tateda, M.D., Kenichiro Yahata, M.D.,
More information25/12/50. Delayed Transplantation of Adult Neural Precursor Cells Promotes Remyelination and Functional Neurological Recovery after Spinal Cord Injury
2 Karimi-Abdolrezaee et al. J Neuroscience 26(13):3377-89; (2006) Delayed Transplantation of Adult Neural Precursor Cells Promotes Remyelination and Functional Neurological Recovery after Spinal Cord Injury
More informationRegionalization of the nervous system. Paul Garrity 7.68J/9.013J February 25, 2004
Regionalization of the nervous system Paul Garrity 7.68J/9.013J February 25, 2004 Patterning along: Rostral/Caudal (AP) axis Dorsal/Ventral (DV) axis Start with DV axial patterning in Spinal Cord Dorsal/Ventral
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationReview Article Endogenous Proliferation after Spinal Cord Injury in Animal Models
Stem Cells International Volume 2012, Article ID 387513, 16 pages doi:10.1155/2012/387513 Review Article Endogenous Proliferation after Spinal Cord Injury in Animal Models Ashley McDonough 1, 2, 3 and
More informationTISSUE-SPECIFIC STEM CELLS
TISSUE-SPECIFIC STEM CELLS Early Response of Endogenous Adult Neural Progenitor Cells to Acute Spinal Cord Injury in Mice YAN KE, a,b LIYING CHI, a RENSHI XU, a CHUN LUO, a DAVID GOZAL, b RUGAO LIU a a
More informationMolecular Cell Biology. Intermediate Filaments Cooper
Molecular Cell Biology Intermediate Filaments Cooper Introduc7on Filaments 10 nm wide => intermediate Present in Metazoa / Animals i.e. not Plants or Unicellular Organisms Complex Gene Superfamily 70 in
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationPK15 48 (1) :58 63, (intermediate filament, IF) D ( Traub et al., 1994) IF P K15 D. ( Fuchs et al., 1994), , ( Fuchs et al., 1992) (apoptosis)
48 (1) :58 63, 2002 A cta Zoologica S inica 3 PK15 (, 100871) D P K15 ( Porcrne Kidney215) DNA, DNA ladder ;,,,, P K15 D (intermediate filament, IF) D ( Traub et al., 1994) IF P K15 ( Porcine Kidney215),,
More informationSOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
More informationExpression and clinical significance of nestin in astrocytic tumors
JBUON 2016; 21(1): 191-198 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Expression and clinical significance of nestin in astrocytic tumors
More informationcamp/pka RT-PCR camp (camp response element binding protein, CREB) mrna
Acta Physiologica Sinica, August 25, 2005, 57 (4): 517-522 http://www.actaps.com.cn 517 camp/pka * 210095 : SHZ-88 camp/pka 3 50 µg/ml 15 µg/ml (RIA) camp (adenylate cyclase, AC)(phosphodiesterase, PDE)
More informationSupplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
More informationNeural stem cells and the neurobiology of ageing. Chen Siyun 1, Dawe G.S. 2
ABSTRACT Neural stem cells and the neurobiology of ageing Chen Siyun 1, Dawe G.S. 2 Department of Physics, Faculty of Science, National University of Singapore 10 Kent Ridge Road, Singapore 117546 The
More informationACTIVITY-DEPENDENT INTERACTIONS BETWEEN NEURONS AND MYELINATING GLIA: AN IMMUNOCYTOCHEMICAL APPROACH
ACTIVITY-DEPENDENT INTERACTIONS BETWEEN NEURONS AND MYELINATING GLIA: AN IMMUNOCYTOCHEMICAL APPROACH Matthew C. Caufield Abstract The current investigation examines the relationship between the purinergic
More informationGlia make up 10 20% of the cells in the Drosophila nervous system
REVIEW doi:10.1038/nature09611 Developmental genetics of vertebrate glial-cell specification David H. Rowitch 1,2,3 & Arnold R. Kriegstein 4 Oligodendrocytes and astrocytes are macroglial cells of the
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. Short-term coreceptor and costimulation blockade induces tolerance to pluripotent human ESCs. (A) Schematic diagram showing experimental approaches and
More informationCl - CFTR Cl - 3. (DPC) 52nitro222(32phenylpropylamino)2benzoate (NPPB) [3 ],, , Na + Ca 2 + [2
, 1999 6, 51 (3), 297 302 297 Acta Physiologica Sinica Cl - CFTR Cl - 3 (, 710032), Cl - (CFTR) Cl -, 92AC ( ISO) CFTR Cl -, 52nitro222( 32phenylpropylamino) 2benzoate (NPPB) (DPC) ISO CFTR Cl - NPPB ISO,
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationNervous system is the most complex system in our body. It is formed by a network of more than 100 million nerve cells (neurons) assisted by many more
Nervous system Nervous system is the most complex system in our body. It is formed by a network of more than 100 million nerve cells (neurons) assisted by many more glial cells. Devoid from connective
More informationSupplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids
Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee
More informationApplication of neural stem cells in curing traumatic brain injury(tbi)
20 4 2008 8 Chinese Bulletin of Life Sciences Vol. 20, No.4 Aug., 2008 1004-0374(2008)04-0646-05 1 200092 2 201203 3 200040 (neural stem cells, NSCs) NSCs NSCs NSCs NSCs NSCs Q813 R745.1 A Application
More informationMIDTERM EXAM 1 COGNITIVE SCIENCE 107A
MIDTERM EXAM 1 COGNITIVE SCIENCE 107A FALL 2011 Name: Points: / 100 PID: I. SHORT ANSWERS (6 points each for a total of 30 points) 1. Describe two contributions made by Ramon y Cajal (1852-1934) in terms
More informationMOLECULAR AND CELLULAR NEUROSCIENCE
MOLECULAR AND CELLULAR NEUROSCIENCE BMP-218 November 4, 2014 DIVISIONS OF THE NERVOUS SYSTEM The nervous system is composed of two primary divisions: 1. CNS - Central Nervous System (Brain + Spinal Cord)
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationNeurogenesis in Adult Central Nervous System: Death of a Dogma
Aristotle University of Thessaloniki, Greece, Nov. 2007 Neurogenesis in Adult Central Nervous System: Death of a Dogma Anton B. Tonchev Division of Cell Biology, Varna University of Medicine, Bulgaria
More informationCHAPTER 48: NERVOUS SYSTEMS
CHAPTER 48: NERVOUS SYSTEMS Name I. AN OVERVIEW OF NERVOUS SYSTEMS A. Nervous systems perform the three overlapping functions of sensory input, integration, and motor output B. Networks of neurons with
More informationContact: Course outline: Contact for other times.
Contact: kdelaney@uvic.ca Course outline: http://web.uvic.ca/~kdelaney/b367 Scheduled office hours: 1:00-3:00, M&Th Cunn. 259A Contact kdelaney@uvic.ca for other times. Quiz (0.5 hrs) midterm (1.4 hrs)
More informationNerve Cells and Behavior
Nerve Cells and Behavior 27 th September, 2016 Touqeer Ahmed Ph.D. Atta-ur-Rahman School of Applied Biosciences National University of Sciences and Technology Nervous System and Behavior Nervous system
More informationChris J. Kubu,* Kenji Orimoto, Sean J. Morrison, Gerry Weinmaster, David J. Anderson, and Joseph M. Verdi*,,1 INTRODUCTION
Developmental Biology 244, 199 214 (2002) doi:10.1006/dbio.2002.0568, available online at http://www.idealibrary.com on Developmental Changes in Notch1 and Numb Expression Mediated by Local Cell Cell Interactions
More informationNeural Stem Cell Niches in Health and Diseases
Neural Stem Cell Niches in Health and Diseases Current Pharmaceutical Design, 2012, 18, 1755-1783 1755 Ilaria Decimo 1,*,#, Francesco Bifari 2,#, Mauro Krampera 2 and Guido Fumagalli 1, * 1 Department
More informationElectrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB
Electrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB Kenji Kawamura, Yoshio Kano. Kibi International University, Takahashi-city, Japan. Disclosures: K.
More informationExperimental Neurology
Experimental Neurology 221 (2010) 353 366 Contents lists available at ScienceDirect Experimental Neurology journal homepage: www.elsevier.com/locate/yexnr Bone morphogenetic proteins mediate cellular response
More informationNeurotrophic factor GDNF and camp suppress glucocorticoid-inducible PNMT expression in a mouse pheochromocytoma model.
161 Neurotrophic factor GDNF and camp suppress glucocorticoid-inducible PNMT expression in a mouse pheochromocytoma model. Marian J. Evinger a, James F. Powers b and Arthur S. Tischler b a. Department
More informationIndex Note: Page numbers of article titles are in boldface type.
Neurosurg Clin N Am 18 (2007) 191 198 Index Note: Page numbers of article titles are in boldface type. A AC133 antigen, in brain tumor cancer cells, 32 35 Activity-based restoration therapy, for spinal
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationPregnanolone effects on the blood pressure of stress-induced hypertension in rats
Acta Physiologica Sinica August June 25 25 2004 2004 56 56 (3) (4) 269-274 471-475 http//www.actaps.com.cn 471 * 130021 (pregnanolone ) (stress-induced hypertension SIH) (0.24 mg/kg) (angiotensin Ang )
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationUNIVERSITY OF PUERTO RICO SCHOOL OF MEDICINE PHYSIOLOGY DEPARTMENT COURSE DESCRIPTION
UNIVERSITY OF PUERTO RICO SCHOOL OF MEDICINE PHYSIOLOGY DEPARTMENT COURSE DESCRIPTION COURSE TITLE: INTRODUCTION TO NEUROSCIENCE COURSE CODE: FISA 8525 CREDIT HOURS: COURSE DURATION: 3 CREDITS (54 HOURS)
More informationGSK-3β expression after treatment of glial cells with lithium and Maria lithium mineral water from Malnas-Bai
M K pag 106 Mædica - a Journal of Clinical Medicine ORIGIN RIGINAL PAPERS -3β expression after treatment of glial cells with lithium and Maria lithium mineral water from Malnas-Bai Constantin MUNTEANU,
More informationSupplemental Experimental Procedures
Cell Stem Cell, Volume 2 Supplemental Data A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis Andrew S. Brack, Irina M. Conboy, Michael J. Conboy,
More informationMilestones of neuronal development in the adult hippocampus
Milestones of neuronal development in the adult hippocampus Gerd Kempermann 1,2, Sebastian Jessberger 2, Barbara Steiner 2 and Golo Kronenberg 1,3 1 Max Delbrück Center for Molecular Medicine (MDC) Berlin-Buch,
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationDepartment of Cognitive Science UCSD
Department of Cognitive Science UCSD Verse 1: Neocortex, frontal lobe, Brain stem, brain stem, Hippocampus, neural node, Right hemisphere, Pons and cortex visual, Brain stem, brain stem, Sylvian fissure,
More informationReduction of angiocidin contributes to decreased HepG2 cell proliferation
Reduction of angiocidin contributes to decreased HepG2 cell proliferation Guan XG 1, Guan XQ 2, Feng K 3, Jian R 3, Tian D 1, Tian D 1, Tong HB 1, *Sun X 1 1. Life Science Research Center, Beihua University,
More informationHealthy Brain Development: Protective and Risk Factors
Healthy Brain Development: Protective and Risk Factors Bryce Geeraert PhD Candidate Developmental Neuroimaging Lab January 31, 2018 About me BSc Psychology, Biomedical Engineering PhD candidate Interest
More informationCNTF/LIF/gp130 receptor complex signaling maintains a VZ precursor differentiation gradient in the developing ventral forebrain
Research article 565 CNTF/LIF/gp130 receptor complex signaling maintains a VZ precursor differentiation gradient in the developing ventral forebrain Christopher Gregg and Samuel Weiss* Genes and Research
More information( Purkinje cell, PC) PC. Acta Physiologica Sinica Tsinghua Tongfang Optical Disc Co., Ltd. All rights reserved.
, 1999 4, 51 (2), 219 22 219 Acta Physiologica Sinica (, 21009) ( 100 mol/ L) (9414 %, 51/ 54), (516 %, / 54) Ca 2 + / Mg 2 +, ( n = 4) H 2 ranitidine (011 5 mol/ L) ( n = 20), H 1 triprolidine (015 5
More informationPostnatal Neurogenesis and Gliogenesis in the Olfactory Bulb from NG2-Expressing Progenitors of the Subventricular Zone
10530 The Journal of Neuroscience, November 17, 2004 24(46):10530 10541 Development/Plasticity/Repair Postnatal Neurogenesis and Gliogenesis in the Olfactory Bulb from NG2-Expressing Progenitors of the
More informationHuman Histology The Nervous System. Dr. Rawaa Salim Hameed
Human Histology The Nervous System Dr. Rawaa Salim Hameed The organization of the nervous system Anatomically, the nervous system is divided into:- Neurohistology Structurally, nerve tissue consists of
More informationM2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination
Supplemental Information Title: M2 microglia/ macrophages drive oligodendrocyte differentiation during CNS remyelination Authors: Veronique E. Miron, Amanda Boyd, Jing-Wei Zhao, Tracy J. Yuen, Julia M.
More informationWhat Cell Make Up the Brain and Spinal Cord
What Cell Make Up the Brain and Spinal Cord Jennifer LaVail, Ph.D. (http://anatomy.ucsf.edu/pages/lavaillab/index.html) What kinds of cells are these?" Neuron?" Epithelial cell?" Glial cell?" What makes
More information